Synthesis of Iodoaminoimidazole Arabinoside (IAIA): A Potential Reductive Metabolite of the Spect Imaging Agent,Iodoazomycin Arabinoside (IAZA)

Abstract

The stereospecific synthesis of 1-(5-deoxy-5-iodo-α-D-arabino-furanosyl)-2-aminoimidazole (iodoaminoimidazole arabinoside: IAIA, 2) is described. The reaction of the protected sugar bromide (8) and trifluoroacetamidoimidazole (10B) gave the coupled product (11B), which gave the free nucleoside (4) on deblocking. It was identical with AIA obtained by reduction of AZA (azomycin arabinoside), whose anomeric configuration was found to be a by the X-ray crystallography.     

Synthesis and Anti-HIV Activity of Novel 4′-Trifluoromethylated 5′-Deoxycarbocyclic Nucleoside Phosphonic Acids

Efficient synthetic route to novel 4′-trifluoromethylated 5′-deoxycarbocyclic nucleoside phosphonic acids was described from α-trifluoromethyl-α,β-unsaturated ester. Coupling of purine nucleosidic bases with cyclopentanol using a Mitsunobu reaction gave the nucleoside intermediates which were further phosphonated and hydrolyzed to reach desired nucleoside analogs. Synthesized nucleoside analogs were tested for anti-HIV activity as well as cytotoxicity. Adenine analog 22 shows significant anti-HIV activity (EC₅₀ = 8.3 μM) up to 100 μM.     

Chemical-Enzymatic Synthesis of 3′-Amino-2′, 3′-dideoxy-β-D-ribofuranosides of Natural Heterocyclic Bases and Their 5′-Monophosphates

Abstract

Treatment of O², 3′-anhydro-5′-O-trityl derivatives of thymidine (1) and 2′-deoxyuridine (2) with lithium azide in dimethylformamide at 150 °C resulted in the formation of the corresponding isomeric 3′-azido-2′, 3′-dideoxy-5′-O-trityl-β-D-ribofuranosyl N¹- (the major products) and N³-nucleosides (3/4 and 5/6). 3′-Amino-2′, 3′-dideoxy-β-D-ribofuranosides of thymidine [Thd(3′NH₂)], uridine [dUrd(3′NH₂)], and cytidine [dCyd(3′NH₂)] were synthesized from the corresponding 3′-azido derivatives. The Thd(3′NH₂) and dUrd(3′NH₂) were used as donors of carbohydrate moiety in the reaction of enzymatic transglycosylation of adenine and guanine to afford dAdo(3′NH₂) and dGuo(3′NH₂). The substrate activity of dN(3′NH₂) vs. nucleoside phosphotransferase of the whole cells of Erwinia herbicola was studied.     

Synthesis of (Dicarbonyl)(η5-cyclopentadienyl)Manganese Complex Stabilized Nucleoside Phosphite Esters

Abstract

We have found that stable nucleoside derived phosphite ester manganese complexes can be generated by the reaction of Mn(CO)₂(THF)(η⁵-C₅H₄R) with nucleoside phosphite esters. These complexes appear to be stable towards oxygen and reagents used for DNA synthesis and deprotection. The cyclopentadienyl ligand can be modified by a strong electron withdrawing group and still retain the photochemical and chemical properties necessary to complex readily to phosphite esters.     

SYNTHESIS of 2′-DEOXY-2′-FLUOROGUANYL-(3′,5′)-GUANOSINE

ABSTRACT

The protected analogue of 2-amnio-6-chloropurine arabinoside (3b) was subjected to reaction with diethylaminosulfur trifluoride (DAST) and subsequently treated with NaOAc in Ac₂O/AcOH to give N ²,O ^3′,O ^5′-triacetyl-2′-deoxy-2′-fluoroguanosine (5a). After deacetylation of the sugar moiety and protection of 5′-OH by a 4,4′-dimethoxytrityl group, this nucleoside component was converted to 2′-deoxy-2′-fluoroguanyl-(3′,5′)-guanosine (6c, GfpG).     

Design and Synthesis of Dually Branched 5′-Norcarbocyclic Adenosine Phosphonodiester Analogue as a New Anti-HIV Prodrug

A novel 3′,4′-dimethyl-5′-norcarbocyclic adenosine phosphonic acid was prepared using acyclic stereoselective route from 4-hydroxybutan-2-one (4). To improve the cellular permeability and enhance the anti-HIV activity of this phosphonic acid, a (bis)SATE phosphonodiester nucleoside prodrug (20) was prepared and its chemical stability was evaluated. The newly synthesized bis(SATE) analogue (20) and its parent nucleoside phosphonic acid (18) were assayed for anti-HIV activity using an in vitro assay system in a CEM cell line.     

Synthesis of a New Hydroxyamino Linked Thymidine Dimer via a Radical C-C Bond Formation

Abstract

An efficient synthesis of a thymidine nucleoside dimer [T-3′-β-O-N(CH₃)-CH₂-5′-T] has been accomplished via an intermolecular radical coupling reaction. The novel dimer contains an achiral and neutral backbone linkage which may have potential application in constructing backbone modified antisense oligonucleosides.     

A Practical Synthesis of N1-Methyl-2′-deoxy-ψ-uridine (ψ-Thymidine) and Its Incorporation into G-Rich Triple Helix Forming Oligonucleotides

Abstract

A convenient synthesis of N1-methyl-2′-deoxy-ψ-uridine (ψ-thymidine, ψT, 7a) has been accomplished in good yield. The structural conformation of 7a was derived by 2D NMR and 1D NOE experiments. The nucleoside 7a has been incorporated into G-rich triplex forming oligonucleotides (TFOs) by solid-support, phosphoramidite method. The triplex forming capabilities of the modified TFOs (S4, S5 and S6) containing ψT has been evaluated in antiparallel motif with a target duplex (duplex-31) 5′d(CTGAGACCGGGAAGGAGGAAGGGCCAGTGAC)3′-5′d(GACTCTGGCCCTTCCTCCTTCCCGGTCACTG)3′(D1) at pH 7.6. The triplex formation of modified homopyrimidine-oligomers (S1, S2 and S3) has also been studied in parallel motif with a duplex-10 (A₁₀:T₁₀) at pH 7.0.     

Preparation of a Fludarabine Intermediate via Selective Alkylation of 2-Fluoroadenine

The reaction between 2-fluoroadenine (3) and 1,3,5-tri-O-benzyl-1-α-d-chloroarabinofuranose (4) with potassium t-amylate was evaluated in various solvents to afford 9-β-d-(2,3,5-tri-O-benzyl-arabinofuranosyl)-2-fluoroadenine (5) and the corresponding α-anomer (6). In addition, 7-β-d-(2,3,5-tri-O-benzyl-arabinofuranosyl)-2-fluoroadenine (7) and an unusual “bis-fluoroadenine” nucleoside (8) were isolated as by-products. The highest anomeric ratio (β/α > 10) and conversion (>80%) were observed with the highly polar solvent sulfolane. This reaction was demonstrated on gram scale as a practical laboratory synthesis of 5, a known intermediate in the synthesis of fludarabine.     

3′-O- and 5′-O-Propargyl Derivatives of 5-Fluoro-2′-Deoxyuridine: Synthesis,Cytotoxic Evaluation and Conformational Analysis

A series of new 3′-O- and 5′-O-propargyl derivatives of 5-fluoro-2′-deoxyuridine (1–4) was synthesized by means of propargyl reaction of properly blocked nucleosides (2,4), followed by the deprotection reaction with ammonium fluoride. The synthesized propargylated 5-fluoro-2′-deoxyuridine analogues (1–4) were evaluated for their cytotoxic activity in three human cancer cell lines: cervical (HeLa), oral (KB) and breast (MCF-7), using the sulforhodamine B (SRB) assay. The highest activity and the best SI coefficient in all of the investigated cancer cells were displayed by 3′-O-propargyl-5-fluoro-2′-deoxyuridine (1), and its activity was higher than that of the parent nucleoside. The other new compounds exhibited moderate activity in all of the used cell lines.     

Studies on Non-Covalent Interaction of Coumarin Attached Pyrimidine and 1-Methyl Indole 1,2,3 Triazole Analogues with Intermolecular Telomeric G-Quadruplex DNA Using ESI-MS and Spectroscopy

In the present study, electrospray ionization mass spectrometry (ESI-MS) and spectroscopy have been used to evaluate the non-covalent interaction, stoichiometry, and selectivity of two synthetic coumarin-attached nucleoside and non-nucleoside 1,2,3-triazoles, namely, (1-(5-(hydroxymethyl)-4-(4-((2-oxo-2H-chromen-4-yloxy)methyl)-1H-1,2,3-triazol-1-yl)tetrahydro-furan-2-yl)5-methyl pyrimidine-2,4(1H,3H)-dione (Tr1) and 4-((1-((-1-methyl-1H-indol-2-yl)methyl)-1H-1,2,3-triazol-4-yl)methoxy)-2H-chromen-2-one (Tr2) with two different human telomeric intermolecular G-quadruplex DNA structures formed by d(T₂AG₃) and d(T₂AG₃)₂ sequences. ESI-MS studies indicate that Tr1 specifically interacts with four-stranded intermolecular parallel quadruplex complex, whereas Tr2 interacts with two hairpin as well as four-stranded intermolecular parallel quadruplex complexes. UV–Visible spectroscopic studies suggest that Tr1 and Tr2 interact with G-quadruplex structure and unwind them. Job plots show that stoichiometry of ligand:quadruplex DNA is 1:1. Circular dichroism (CD) studies of G-quadruplex DNA and Tr1/Tr2 ligands manifest that they unfold DNA on interaction. Fluorescence studies demonstrate that ligand molecules intercalate between the two stacks of quadruplex DNA and non-radiative energy transfer occurs between the excited ligand molecules (donor) and quadruplex DNA (acceptor), resulting in enhancement of fluorescence emission intensity. Thus, these studies suggest that nucleoside and non-nucleoside ligands efficiently interact with d(T₂AG₃) and d(T₂AG₃)₂ G-quadruplex DNA but the interaction is not alike with all kinds of quadruplex DNA, this is probably due to the variation in the pharmacophores and structure of the ligand molecules.     

A Convenient Synthesis of A Novel Nucleoside Analogue: 4-(δ-Diformyl-methyl)-1-(β-D-ribofuranosyl)-2-pyrimidinone

Abstract

The nucleoside analogue 4-(δ-diformyl-methyl)-1-(β-D-ribofuranosyl)-2-pyrimidinone (5) was prepared from the corresponding 4-methyl pyrimidinone nucleoside by means of the Vilsmeier reaction. The unprotected nucleoside can be phosphorylated directly with phosphorus oxychloride in triethyl phosphate.     

Quinolone Nucleosides: 6,7-Dihalo-N-β- and α-Glycosyl-l 4-dihydro-4-oxo-quinoline-3-carboxylic Acids and Derivatives. Synthesis,Antimicrobial and Antiviral Activity

Abstract

Reaction of the silylated 6,7-dihaloquinoline bases 10–12 with l-O-acetyl-2,3,5-tri-O-benzoyl-β-D-ribofuranose (13) gave ethyl 7-chloro-6-flouro-l,4-dihydro-4-oxo-1 -(2,3,5-tri-O-benzoyl-β-D-ribofuranosyl)quinoline-3-carboxylate (14) and the free acids 15 and 16, respectively, which led on deblocking of the sugar moiety to the free nucleosides 17, 18 and 20, respectively. Treatment of 14 with methanolic ammonia afforded the amide derivative 19. Ribosylation of 11 with l,2-di-O-acetyl-3-azido-3-deoxy-5-p-toluoyl-β-D-ribofuranose (21) afforded the azido nucleoside 22, which was again converted into the free nucleoside 23. Analogously, reaction of 11 with the chloro deoxyribose derivative 24 led to a mixture of α /β (2:1) anomers of 25. Deblocking and recrystallization of the product gave mainly the α-anomer 26. Compounds 17–19, 23 and 26 were evaluated against Escherichia coli and found inactive. Compound 16–18 and 22 were inactive aganist HIV-1 (III B) and HIV-2 (ROD) induced cytopathicity in human MT-4 lymphocyte cells.     

Synthesis of 2′,3′-Dideoxy-2′-fluoro-3′-thioarabinothymidine and Its 3′-Phosphoramidite Derivative

Abstract

An efficient method for the synthesis of 5′-O-monomethoxytrityl-2′,3′-dideoxy-2′-fluoro-3′-thioarabinothymidine [^5′-MMTaraF-T_3′SH, (5)] and its 3′-phosphoramidite derivative (6) suitable for automated incorporation into oligonucleotides, is demonstrated. A key step in the synthesis involves reaction of 5′-O-MMT-2,3′-O-anhydrothymidine (4) (Eleuteri, A.; Reese, C.B.; Song, Q., J. Chem. Soc. Perkin Trans. 1 1996, 2237 pp.) with sodium thioacetate to give ^5′-MMTaraF-T_3′SAc (5) (Elzagheid, M.I.; Mattila, K.; Oivanen, M.; Jones, B.C.N.M.; Cosstick, Lönnberg, H. Eur. J. Org. Chem. 2000, 1987–1991). This nucleoside was then converted to its corresponding phosphoramidite derivative, 6, as described previously ((a) Sun, S.; Yoshida, A.; Piccirilli, J.A. RNA, 1997, 3, 1352–1363; (b) Matulic-Adamic, J.; Beigelman, L. Helvetica Chemica Acta 1999, 82, 2141–2150; (c) Fettes, K.J.; O’Neil, I.; Roberts, S.M.; Cosstick, R. Nucleosides, Nucleotides and Nucl. Acids 2001, 20, 1351–1354).     

Mitsunobu Alkylation of Cancerostatic 5‐Fluorouridine with (2E)‐10‐Hydroxydec‐2‐enoic Acid,a Fatty Acid from Royal Jelly with Multiple Biological Activities

5‐Fluorouridine ( 1 ) – a nucleoside antimetabolite with strong cancerostatic properties – was protected i) at the 2′‐ and 3′‐OH groups with a heptan‐4‐ylidene residue and ii) at the 5′‐OH group with a (4‐methoxyphenyl)(diphenyl)methyl residue. This fully protected compound, 3 , was submitted to a Mitsunobu reaction with the N‐hydroxysuccinimide (NHS) ester, 5 , of (2E)‐10‐hydroxydec‐2‐enoic acid ( 4 ) which gave nucleolipid 6 . The latter was detritylated with Cl₂CHCOOH to yield the co‐drug 7 as NHS ester.     

Kinetic Properties of Adenine Nucleotide Analogues Against Purified 5-Phosphoribosyl-1-pyrophosphate Synthetases from E. coli,Rat Liver and Human Erythrocytes

Abstract

The nucleoside analogue 2′,3′-dideoxyadenosine (ddA), the phosphonate isostere of 2′,3′-dideoxy-2′,3′-didehydro-adenosine (d4A) 5′-monophosphate (d4API), and the acyclic nucleoside phosphonates PMEoA, PMEA, FPMPA and PMPA are potent and selective antiretroviral agents. We found that these compounds are recognized as substrates by the PRPP synthetases from E. coli, rat liver and human erythrocytes, as their monophosphate and triphosphate form in the reverse and forward reaction, respectively. In particular, ddA-5′-monophosphate (ddAMP) and ddA-5′-triphosphate proved to be excellent substrates for the enzymes. D4API was a relatively good substrate of the rat liver and human erythrocyte PRPP synthetases. The acyclic nucleoside phosphonates were rather poor substrates, as evident from their low V_max values. None of the PRPP synthetases are found to act stereospecifically: they recognized both the S- and R-enantiomers of FPMPA and PMPA in a comparably efficient manner. Our data indicate that PRPP synthetase may recognize a much broader range of adenine nucleotide analogues than previously thought.     

Synthesis of a Novel Aldehyde: 4-O-Methyl-5-formylmethyl- 2′-deoxyuridine

Abstract

The synthesis of the blocked nucleoside 3′,5′-di-O-p-toluoyl-4-O-methyl-5-formylmethyl-2′-deoxyuridine (19) was accomplishied in eleven steps from gamma-butyrolactone. This aldehyde, which should facilitate the synthesis of nucleosides containing ¹⁸F, was converted to the corresponding blocked dithianyl nucleoside (21), and also to 5-(2,2-difluoroethyl)-substituted derivatives of 2′-deoxyuridine and 2′-deoxycytidine.     

Synthesis of Novel Polycyclic Nucleoside Analogs

Abstract

We have synthesized polycyclic nucleoside derivatives by a novel, one pot procedure by reacting 4-0-TPS-pyrimidine nucleosides with aromatic diamines. The reaction is limited in scope but provides easy access to certain previously unknown heterocyclic ring systems.₂ 4-0-Triisopro- pylphenylsulfonyl-pyrimidine nucleosides were reacted with aromatic diamines leading to fused, polycyclic ring systems: o-phenylenediamine yielded the pyrimido[1,6-a]benzimidazole, 2.3- diaminonaphthalene gave the naphth[2′,3′:4,5]imidam [1.2-flpyrimidine and 1.8-diaminonaph- thalene led to the pyrimido[l,6-a]perimidine ring system. The reaction is unique because two connected nucleophilic centers react with the pyrimidine nucleoside to form an extended ring system. However, reactions of pyrimidine nucleosides with electrophiles are well known. E.g., reaction of cytidine and adenosine with bromoacetaldehyde yields ethenocytidine and ethenoadenosine) and on reaction of cytidine with 1′-methylthiaminium salts dipyrimido[1,6-a:4′,5′-d]pyrimidine derivatives are obtained.₄ Other polycyclic bases have been made from cytidine and adenosine by photochemical reactions₅.     

Synthesis,characterization and biological evaluation of C5′-N-cyclopropylcarboxamido-C6-amino-C2-alkynylated purine nucleoside analogues

In an effort to develop potent antibacterial and anticancer agents, a series of C5′-N-cyclopropylcarboxamido-C6-amino-C2-alkynylated purine nucleoside analogues 11a-g were synthesized through a Sonogashira cross-coupling reaction. The nine-step synthesis is easy to perform, and employs commercially available reagents. 2-Iodo-5′-N-cyclopropylcarboxamidoadenosine (9) was used as the starting intermediate for the synthesis of title derivatives 11a-g. Synthetic intermediates (2–9) and final products (11a-g) were appropriately characterized by IR, ¹H NMR, ¹³C NMR and mass spectroscopy. The synthesized purine nucleoside analogues (11a-g) were evaluated for their in vitro antibacterial activity against two gram-positive and two gram-negative bacteria. They were then tested for cytotoxicity against MDA-MB-231 and Caco-2 cancer cell lines to determine their anti-cancer activity. Among the tested compounds, compounds 11c and 11g showed most potent antibacterial activity against S.aureus and P.aeruginosa bacterial strains. Compounds 11b and 11e displayed considerable IC₅₀^s of 7.9 and 6.8 µg/mL, respectively, vs MDA-MB-231 cell lines of 7.5 and 8.3 µg/mL, respectively, against the Caco-2 cell lines.     

Synthesis and Biological Study of the Cyclopentenyl Carbocyclic Nucleoside Analogue of 5-Azacytidine

Abstract

Cyclopentenyl cytosine (CPE-C, 3) possesses excellent antitumor and antiviral activity. The synthesis of the analogous cyclopentenyl triazine nucleoside, 5-aza-CPE-C (4), was accomplished by a novel approach that utilized a key 1-cyclopentenyl-4-methylisobiuret intermediate (7) produced from the corresponding cyclopentenylamine 5. 5-Aza-CPE-C was more than six-hundred times less potent than CPE-C both in its capacity to reduce CTP levels as well as in its antitumor and antiviral activity.