Human Pif1 helicase unwinds synthetic DNA structures resembling stalled DNA replication forks

Pif-1 proteins are 5′→3′ superfamily 1 (SF1) helicases that in yeast have roles in the maintenance of mitochondrial and nuclear genome stability. The functions and activities of the human enzyme (hPif1) are unclear, but here we describe its DNA binding and DNA remodeling activities. We demonstrate that hPif1 specifically recognizes and unwinds DNA structures resembling putative stalled replication forks. Notably, the enzyme requires both arms of the replication fork-like structure to initiate efficient unwinding of the putative leading replication strand of such substrates. This DNA structure-specific mode of initiation of unwinding is intrinsic to the conserved core helicase domain (hPifHD) that also possesses a strand annealing activity as has been demonstrated for the RecQ family of helicases. The result of hPif1 helicase action at stalled DNA replication forks would generate free 3′ ends and ssDNA that could potentially be used to assist replication restart in conjunction with its strand annealing activity.     

Eukaryotic DNA does not form nucleosomes as readily as some prokaryotic DNA.

Nucleosomal-length DNA was prepared from the genomic DNA of various prokaryotic and eukaryotic organisms by limited nuclease digestion after reconstitution with core histones. The DNAs ranged in base composition from 26.5% to 72% guanosine-plus-cytosine (%GC). The nucleosomal-length DNAs were then used in a competitive reconstitution assay in order to quantitatively determine their relative abilities to form nucleosomes. The results of the assay indicate a linear dependence of the free energy of nucleosome formation on base composition and, surprisingly, show that several prokaryotic DNAs form nucleosomes as well as or better than eukaryotic DNAs.     

Systematic search for compact structures of telomeric nucleosomes

Telomeres are structures functionally and structurally distinct from bulk chromatin. They are constituted of highly conserved 5-7 bp tandemly repeated units, organized into nucleosomes with short linkers, whereas the knowledge of the linker histone role in telomeric chromatin is still fragmentary. Experimental evidence suggests the structural organization of telomeric nucleosomes is different from that of the bulk chromatin. This work presents a systematic search of the telomeric nucleosome arrangements. A low-resolution molecular model was used to evaluate the relative nucleosome packing energy. Structures with favorable energy were found, reducing the possible telomeric chromatin conformations to two different three-dimensional folds.     

The yeast Pif1p DNA helicase preferentially unwinds RNA DNA substrates

Pif1p is the prototypical member of the PIF1 family of DNA helicases, a subfamily of SFI helicases conserved from yeast to humans. Baker's yeast Pif1p is involved in the maintenance of mitochondrial, ribosomal and telomeric DNA and may also have a general role in chromosomal replication by affecting Okazaki fragment maturation. Here we investigate the substrate preferences for Pif1p. The enzyme was preferentially active on RNA–DNA hybrids, as seen by faster unwinding rates on RNA–DNA hybrids compared to DNA–DNA hybrids. When using forked substrates, which have been shown previously to stimulate the enzyme, Pif1p demonstrated a preference for RNA–DNA hybrids. This preferential unwinding could not be correlated to preferential binding of Pif1p to the substrates that were the most readily unwound. Although the addition of the single-strand DNA-binding protein replication protein A (RPA) stimulated the helicase reaction on all substrates, it did not diminish the preference of Pif1p for RNA–DNA substrates. Thus, forked RNA–DNA substrates are the favored substrates for Pif1p in vitro. We discuss these findings in terms of the known biological roles of the enzyme.     

Human werner syndrome DNA helicase unwinds tetrahelical structures of the fragile X syndrome repeat sequence d(CGG)n

Formation of hairpin and tetrahelical structures by a d(CGG) trinucleotide repeat sequence is thought to cause expansion of this sequence and to engender fragile X syndrome. Here we show that human Werner syndrome DNA helicase (WRN), a member of the RecQ family of helicases, efficiently unwinds G'2 bimolecular tetraplex structures of d(CGG)7. Unwinding of d(CGG)7 by WRN requires hydrolyzable ATP and Mg2+ and is proportional to the amount of added helicase and to the time of incubation. The efficiencies of unwinding of G'2 d(CGG)7 tetraplex with 7 nucleotide-long single-stranded tails at their 3' or 5' ends are, respectively, 3.5- and 2-fold greater than that of double-stranded DNA. By contrast, WRN is unable to unwind a blunt-ended d(CGG)7 tetraplex, bimolecular tetraplex structures of a telomeric sequence 5'-d(TAGACATG(TTAGGG)2TTA)-3', or tetramolecular quadruplex forms of an IgG switch region sequence 5'-d(TACAGGGGAGCTGGGGTAGA)-3'. The ability of WRN to selectively unwind specific tetrahelices may reflect a specific role of this helicase in DNA metabolism.     

Ion-induced DNA structure change in nucleosomes

Physical methods have been used to study calcium binding to the nucleosome core particle. Equilibrium dialysis of Ca2+ and spectroscopic analysis of a Ca2+ analogue show that the ion binds tightly to the particles, resulting in a significant change of DNA circular dichroism. This suggests that base stacking may be altered as a result of Ca2+ binding. In the presence of Ca2+, the absorbance and fluorescence properties of methylene blue (MB), a DNA-specific intercalator, confirm that the dye binds tightly to nucleosomes by intercalation. However, secondary changes occur which suggest that the MB binding site is altered as a result of Ca2+ binding. Triplet state anisotropy decay and triplet lifetime quenching both show that in the Ca2+-nucleosome complex, methylene blue is capable of wobbling over a substantial angular range at its binding site. To explain these data, it is proposed that Ca2+ binding to nucleosomes causes DNA to fold by means of a series of sharp bends (kinks). The properties of bound MB are best explained if it is presumed that the intercalator binds tightly to such kinked sites in the nucleosome. On the basis of these observations, we discuss the possibility that multivalent ion concentration in the nucleus is high enough that the smooth to kinked helix equilibrium may be near to its midpoint. Near such a midpoint, the secondary structure of DNA in the nucleosome might prove to be sensitive to effector molecule binding and to site-specific variation of DNA or histone composition within genes.     

Supercoiling unwinds two-micrometer plasmid yeast DNA at the origin of replication

All studied origins of replication of DNA in Saccharomyces cerevisiae contain DNA unwinding elements. The introduction of unrestrained negative supercoiling leads to melting of the two DNA strands in DNA unwinding elements. To understand the mechanism of DNA replication it is important to know whether the most unstable region of DNA coincides with the origin of replication. Two-micrometer plasmid DNA from S. cerevisiae inserted in pBR322 was investigated by cleaving with snake venom phosphodiesterase. Its single-strand endonucleolytic activity allows cutting of negatively supercoiled DNA in the DNA unwinding elements. The sites of the venom phosphodiesterase hydrolysis were mapped by restriction enzymes. This study shows that the unwinding of the two-micrometers plasmid DNA of S. cerevisiae takes place only in the origin of replication as a result of unrestrained negative supercoiling.     

Transferring DNA from electrophoretically resolved nucleosomes to diazobenzyloxymethyl cellulose: properties of nucleosomes along mouse satellite DNA.

Electrophoresis fractionates nucleosomes which possess different protein compositions. We report here a procedure for transferring the DNA components of electrophoretically resolved nucleosomes to diazobenzyloxymethyl cellulose (DBM-paper). Histones are first removed from nucleosome components by electrophoresis in the presence of cetyltrimethylammonium bromide (CTAB), leaving DNA fragments fixed within the original gel as the CTAB salts. The DNA is then converted to the sodium salt, denatured, and electrophoretically transferred to DBM-paper. The overall pattern of DNA on the resulting blot is visualized either by fluorography or by immunoautoradiography. This DNA pattern is then compared with autoradiograms obtained after hybridizing the same blot with specific 32P-labeled probes. Using mouse satellite DNA as a hybridization probe, we illustrate the above techniques and demonstrate that nucleosomes carrying satellite sequences are compositionally heterogeneous. The procedures described here should also be useful in the analysis of the nucleic acid components associated with other nucleoprotein complexes.     

Negative constrained DNA supercoiling in archaeal nucleosomes

Archaeal histones have significant sequence and structural similarity to their eukaryal counterparts. However, whereas DNA is wrapped in negatively constrained supercoils in eukaryal nucleosomes, it has been reported that DNA is positively supercoiled by archaeal nucleosomes. This was inferred from experiments performed at low temperature and low salt concentrations, conditions markedly different from those expected for many archaea in vivo. Here, we report that the archaeal histones HMf and HTz wrap DNA in negatively constrained supercoils in buffers containing potassium glutamate (K-Glu) above 300 mM, either at 37 degrees C or at 70 degrees C. This suggests that high salt concentrations allow an alternate archaeal nucleosome topology: a left-handed tetramer rather than the right-handed tetramer seen in low salt conditions. In contrast, the archaeal histone MkaH produces DNA negative supercoiling at all salt concentrations, suggesting that this duality of structure is not possible for this atypical protein, which is formed by the association of two histone folds in a single polypeptide. These results extend the already remarkable similarity between archaeal and eukaryal nucleosomes, as it has been recently shown that DNA can be wrapped into either positive or negative supercoils around the H3/H4 tetramer. Negative supercoiling could correspond to the predominant physiological mode of DNA supercoiling in archaeal nucleosomes.     

DNA sequence patterns in precisely positioned nucleosomes

Several investigators have recognized the importance of non-periodic DNA sequence information in determining the translational position of precisely positioned nucleosomes. The purpose of this study is to determine the extent of such information, in addition to the character of periodic information present. This is accomplished by examining the half-nucleosome DNA sequences of a considerable number of precisely positioned nucleosomes, and determining the probability of occurrence of each dinucleotide type as a function of position from the nucleosome center to the terminus (positions 0 to 72). By the nature of this procedure, no assumptions of periodicity are made. The results show the importance of several DNA sequence periodicities including 6-7, 10, and 21 base pairs, in addition to significant nonperiodic information. The results demonstrate that each dinucleotide type is unique in terms of its positional preference in precisely positioned nucleosomes (for example AA not equal to TT). The probabilities of occurrence for the dinucleotide types can be used to predict the translational positions of a number of observed nucleosomes.     

DNA associated with nucleosomes in plants.

50 to 55% of tobacco and barley nuclear DNA is accessible to micrococcal endonuclease digestion. The DNA fragments resulting from a mild endonuclease treatment are multiples of a basic unit of 194 +/- 6 base pairs in tobacco and 195 +/- 6 base pairs in barley. After extensive digestion, a DNA fragment of approximately 140 base pairs is predominant. Hence the "extra-core" or "linker"-DNA is 55 base pairs long. Other fragments having 158 and less than 140 base pairs are present as well. Treatment with DNase I results in multiples of 10 bases when analysed under denaturating conditions. These results show that the general organization of the DNA within the nucleosomes is about the same in higher plants as in other higher eukaryotes.     

Srs2 helicase of Saccharomyces cerevisiae selectively unwinds triplet repeat DNA

Trinucleotide repeat expansions are the mutational cause of at least 15 genetic diseases. In vitro, single-stranded triplet repeat DNA forms highly stable hairpins, depending on repeat sequence, and a strong correlation exists between hairpin-forming ability and the risk of expansion in vivo. Hairpins are viewed, therefore, as likely mutagenic precursors to expansions. If a helicase unwinds the hairpin, it would be less likely to expand. Previous work indicated that yeast Srs2 DNA helicase selectively blocks expansions in vivo (Bhattacharyya, S., and Lahue, R. S. (2004) Mol. Cell. Biol. 24, 7324-7330). For example, srs2 mutants, including an ATPase-defective point mutant, exhibit substantially higher expansion rates than wild type controls. In contrast, mutation of another helicase gene, SGS1, had little effect on expansion rates. These findings prompted the idea that Srs2 might selectively unwind triplet repeat hairpins. In this study, DNA helicase assays were performed with purified Srs2, Sgs1, and Escherichia coli UvrD (DNA helicase II). Srs2 shows substantially faster unwinding than Sgs1 or UvrD on partial duplex substrates containing (CTG) x (CTG) sequences, provided that Srs2 encounters the triplet repeat DNA immediately on entering the duplex. Srs2 was also faster at unwinding (CAG) x (CAG)- and (CCG) x (CCG)-containing substrates and an intramolecular (CTG) x (CTG) hairpin. In contrast, all three enzymes unwind about equally well control substrates with either Watson-Crick base pairs or mismatched substrates with non-CNG repeats. Overall, the selective unwinding activity of Srs2 on triplet repeat hairpin DNA helps explain the genetic evidence that Srs2, not the RecQ homolog Sgs1, is a preferred helicase for preventing expansions.     

Enhanced DNA repair synthesis in hyperacetylated nucleosomes

We have investigated the level of "early" DNA repair synthesis in nucleosome subpopulations, varying in histone acetylation, from normal human fibroblasts treated with sodium butyrate. We find that repair synthesis occurring during the first 30 min after UV irradiation is significantly enhanced in hyperacetylated mononucleosomes. Nucleosomes with an average of 2.3 acetyl residues/H4 molecule contained approximately 1.8-fold more repair synthesis than nucleosomes with an average of 1.5 or 1.0 acetyl residues/H4 molecule. Fractionation of highly acetylated nucleosomes by two-dimensional gel electrophoresis yielded an additional 2.0-fold enrichment of repair synthesis in nucleosomes containing 2.7 acetyl residues/H4 molecule as compared to nucleosomes containing 1.9 acetyl residues/H4 molecule. This enhanced repair synthesis is associated primarily with nucleosome core regions and does not appear to result from increased UV damage in hyperacetylated chromatin. In addition, the distribution of repair synthesis within nucleosome core DNA from hyperacetylated chromatin is nonrandom, showing a bias toward the 5' end which is similar to that obtained for bulk (unfractionated) chromatin. These results provide strong evidence that enhanced repair occurs within nucleosome cores of hyperacetylated chromatin in butyrate-treated human cells. Finally, pulse-chase experiments demonstrate that the association of enhanced repair synthesis with hyperacetylated nucleosomes is transient, lasting only about 12 h after UV damage.     

Photochemical cross-linking of histones to DNA nucleosomes.

Ultraviolet (UV)-induced cross-linking was utilized in order to identify histone-DNA interacting regions in the chromatin repeating unit. Fractionated mononucleosomes which contained 185 base pairs of DNA and a full complement of the histones, including histone H1, were irradiated with light of lambda greater than 290nm in the presence of a photosensitizer. Equimolar amounts of histones H2A and H2B were found, by two independent labeling experiments, to be cross-linked to the DNA. Based on previous finding that the UV irradiation specifically cross-links residues which are in close proximity, irrespective of the nature of the amino acid side chain or the nucleotide involved, our results indicate that the four core histones are not positioned equivalently with respect to the DNA. This arrangement allows histones H2A and H2B to preferentially cross-link to the DNA. A water soluble covalent complex of DNA and histones was isolated. This complex was partially resistant to mild nuclease digestion, it exhibited a CD spectrum similar to that of chromatin, and was found to contain histone H1. These results are compatible with a model which suggests that histone H1, though anchored to the linker, is bound to the DNA at additional sites. By doing so it spans the whole length of the nucleosome and clamps together the DNA fold around the histone core.     

Sequence-dependent bending of DNA and phasing of nucleosomes

Conformational analysis has revealed anisotropic flexibility of the B-DNA double helix: it bends most easily into the grooves, being the most rigid when bent in a perpendicular direction. This result implies that DNA in a nucleosome is curved by means of relatively sharp bends ("mini-kinks") which are directed into the major and minor grooves alternatively and separated by 5-6 base pairs. The "mini-kink" model proved to be in keeping with the x-ray structure of the B-DNA dodecamer resolved later, which exhibits two "annealed kinks", also directed into the grooves. The anisotropy of B DNA is sequence-dependent: the pyrimidine-purine dimers (YR) favor bending into the minor groove, and the purine-pyrimidine dinucleotides (RY), into the minor one. The RR and YY dimers appear to be the most rigid dinucleotides. Thus, a DNA fragment consisting of the interchanging oligopurine and oligopyrimidine blocks 5-6 base pairs long should manifest a spectacular curvature in solution. Similarly, a nucleotide sequence containing the RY and YR dimers separated by a half-pitch of the double helix is the most suitable for wrapping around the nucleosomal core. Analysis of the numerous examples demonstrating the specific alignment of nucleosomes on DNA confirms this concept. So, the sequence-dependent "mechanical" properties of the double helix influence the spatial arrangement of DNA in chromatin.     

Yeast nucleosomes allow thermal untwisting of DNA.

Thermal untwisting of DNA is suppressed in vitro in nucleosomes formed with chicken or monkey histones. In contrast, results obtained for the 2 micron plasmid in Saccharomyces cerevisiae are consistent with only 30% of the DNA being constrained from thermal untwisting in vivo. In this paper, we examine thermal untwisting of several plasmids in yeast cells, nuclei, and nuclear extracts. All show the same quantitative degree of thermal untwisting, indicating that this phenomenon is independent of DNA sequence. Highly purified yeast plasmid chromatin also shows a large degree of thermal untwisting, whereas circular chromatin reconstituted using chicken histones is restrained from thermal untwisting in yeast nuclear extracts. Thus, the difference in thermal untwisting between yeast chromatin and that assembled with chicken histones is most likely due to differences in the constituent histone proteins.     

Deduction of DNA from artificial aggregates of erythrocyte nucleosomes

The nucleosomal aggregates were obtained by micrococcal nuclease treatment to chicken erythrocyte nuclei. There still leaves a bulk of nucleosomes. We used two different DNA assay methods to determine DNA in in situ nucleosomes; the Feulgen DNA assay which shows a positive apurinic acid, and the fluorometry with Hoechst 33258 which reveals only intact AT base pairs. On applying those methods to the aggregates, even in a short digestion, Feulgen DNA remains only about 1/4 of the non-digested nuclei and the fluoroassay leaves only a trace amount of AT base pairs. Thus, the nucleosomes derived from the heterochromatin of erythrocytes are not preserved as the residual DNA of Feulgen hydrolysis. This also suggests that the bulk of nucleosomal DNA is masked and sensitive to neither the Feulgen assay nor the fluorometry of AT base pairs.