Sequence specificity of DNA topoisomerase I in the presence and absence of camptothecin.

Previously, we have demonstrated that in Tetrahymena DNA topoisomerase I has a strong preference in situ for a hexadecameric sequence motif AAGACTTAGAAGAAAAAATTT present in the non-transcribed spacers of r-chromatin. Here we characterize more extensively the interaction of purified topoisomerase I with specific hexadecameric sequences in cloned DNA. Treatment of topoisomerase I-DNA complexes with strong protein denaturants results in single strand breaks and covalent linkage of DNA to the 3' end of the broken strand. By mapping the position of the resulting nicks, we have analysed the sequence-specific interaction of topoisomerase I with the DNA. The experiments demonstrate that: the enzyme cleaves specifically between the sixth and seventh bases in the hexadecameric sequence; a single base substitution in the recognition sequence may reduce the cleavage extent by 95%; the sequence specific cleavage is stimulated 8-fold by divalent cations; 30% of the DNA molecules are cleaved at the hexadecameric sequence while no other cleavages can be detected in the 1.6-kb fragment investigated; the sequence specific cleavage is increased 2- to 3-fold in the presence of the antitumor drug camptothecin; at high concentrations of topoisomerase I, the cleavage pattern is altered by camptothecin; the equilibrium dissociation constant for interaction of topoisomerase I and the hexadecameric sequence can be estimated as approximately 10(-10) M.     

Sequence-dependent effect of camptothecin on human topoisomerase I DNA cleavage

We have studied the effect of the antitumor drug, camptothecin, on the interaction of human topoisomerase I with DNA at the sequence level. At a low molar ratio of enzyme to DNA, cleavage is prominent and unique, located at a previously described hexadecameric recognition sequence, while a number of strong additional cleavage sites appear in the presence of the drug. Camptothecin stimulates cleavage at the recognition sequence less than twofold, whereas cleavage at the additional sites is stimulated up to 200-fold. Camptothecin greatly enhances the stability of the cleavable complexes formed at the additional sites, whereas the complex formed at the hexadecameric sequence is only marginally affected. Cleavage was eliminated at certain sites in the presence of camptothecin. Taken together these observations demonstrate that at least three types of potential eukaryotic topoisomerase I cleavage sites can be distinguished by the use of camptothecin. Comparison of the sequences at the additional cleavage sites in the presence of camptothecin reveals that the most frequently cleaved dinucleotide is TG with no consensus for the flanking nucleotides.     

Induction of cleavage in topoisomerase I c-DNA by topoisomerase I enzymes from calf thymus and wheat germ in the presence and absence of camptothecin.

In this study, we further examined the sequence selectivity of camptothecin in mammalian topoisomerase I cDNA from human and Chinese hamster. In the absence of camptothecin, almost all the bases at the 3'-terminus of cleavage sites are T for calf thymus and wheat germ topoisomerase I. In addition, wheat germ topoisomerase I exhibits preference for C (or not T) at -3 and for T at -2 position. As for camptothecin-stimulated cleavage with topoisomerase I, G (or not T) at +1 is an additional strong preference. This sequence selectivity of camptothecin is similar to that previously found in SV40 DNA, suggesting that camptothecin preferentially interacts with topoisomerase I-mediated cleavage sites where G is the base at the 5'-terminus. These results support the stacking model of camptothecin (Jaxel et al. (1991) J. Biol. Chem. 266, 20418-20423). Comparison of calf thymus and wheat germ topoisomerase I-mediated cleavage sites in the presence of camptothecin shows that many major cleavage sites are similar. However, the relative intensities are often different. One of the differences was attributable to a bias at position -3 where calf thymus topoisomerase I prefers G and wheat germ topoisomerase I prefers C. This difference may explain the unique patterns of cleavage sites induced by the two enzymes. Sequencing analysis of camptothecin-stimulated cleavage sites in the surrounding regions of point mutations in topoisomerase I cDNA, which were found in camptothecin-resistant cell lines, reveals no direct relationship between DNA cleavage sites in vitro and mutation sites.     

DNA sequence selectivity of human topoisomerase I‐mediated DNA cleavage induced by camptothecin

In probing the mechanism of inhibition of hypoxia inducible factor (HIF-1) by campothecins, we investigated the ability of human topoisomerase I to bind and cleave HIF-1 response element (HRE), which contains the known camptothecin-mediated topoisomerase I cleavage site 5′-TG. We observed that the selection of 5′-TG by human topoisomerase I and topotecan depends to a large extent on the specific flanking sequences, and that the presence of a G at the −2 position (where cleavage occurs between −1 and +1) prevents the HRE site from being a preferred site for such cleavage. Furthermore, the presence of −2 T/A can induce the cleavage at a less preferred TC or TA site. However, in the absence of a more preferred site, the HRE site is shown to be cleaved by human topoisomerase I in the presence of topotecan. Thus, it is implied that the −2 base has a significant influence on the selection of the camptothecin-mediated Topo I cleavage site, which can overcome the preference for +1G. While the cleavage site recognition has been known to be based on the concerted effect of several bases spanning the cleavage site, such a determining effect of an individual base has not been previously recognized. A possible base-specific interaction between DNA and topoisomerase I may be responsible for this sequence selectivity.     

The different cleavage DNA sequence specificity explains the camptothecin resistance of the human topoisomerase I Glu418Lys mutant

Yeast cells expressing the Glu418Lys human topoisomerase I mutant display a camptothecin resistance that slowly decreases as a function of time. Molecular characterization of the single steps of the catalytic cycle of the purified mutant indicates that it has a relaxation activity identical to the wild-type protein but a different DNA sequence specificity for the cleavage sites when compared to the wild-type enzyme, as assayed on several substrates. In particular the mutant has a low specificity for CPT sensitive cleavable sites. In fact, the mutant has, at variance of the wild-type enzyme, a reduced preference for cleavage sites having a thymine base in position −1 of the scissile strand. This preference, together with the strict requirement for a thymine base in position −1 for an efficient camptothecin binding, explains the temporary camptothecin resistance of the yeast cell expressing the mutant and points out the importance of the DNA sequence in the binding of the camptothecin drug.     

Local base sequence preferences for DNA cleavage by mammalian topoisomerase II in the presence of amsacrine or teniposide.

Several classes of antitumor drugs are known to stabilize topoisomerase complexes in which the enzyme is covalently bound to a terminus of a DNA strand break. The DNA cleavage sites generally are different for each class of drugs. We have determined the DNA sequence locations of a large number of drug-stimulated cleavage sites of topoisomerase II, and find that the results provide a clue to the possible structure of the complexes and the origin of the drug-specific differences. Cleavage enhancements by VM-26 and amsacrine (m-AMSA), which are representative of different classes of topoisomerase II inhibitors, have strong dependence on bases directly at the sites of cleavage. The preferred bases were C at the 3' terminus for VM-26 and A at the 5' terminus for m-AMSA. Also, a region of dyad symmetry of 12 to 16 base pairs was detected about the enzyme cleavage positions. These results are consistent with those obtained with doxorubicin, although in the case of doxorubicin, cleavage requires the presence of an A at the 3' terminus of at least one the pair of breaks that constitute a double-strand cleavage (Capranico et al., Nucleic Acids Res., 1990, 18: 6611). These findings suggest that topoisomerase II inhibitors may stack with one or the other base pair flanking the enzyme cleavage sites.     

Local sequence requirements for DNA cleavage by mammalian topoisomerase II in the presence of doxorubicin

Doxorubicin, a DNA-intercalator, is one of several anti-cancer drugs that have been found to stabilizes topoisomerase II cleavage complexes at drug-specific DNA sites. The distribution and DNA sequence environments of doxorubicin-stabilized sites were determined in the SV40 genome. The sites were found to be most concentrated in the major nuclear matrix-associated region and nearly absent in the vicinity of the replication origin including the enhancer sequences in the 21-bp and 72-bp tandem repeats. Among 97 doxorubicin-stabilized sites that were localized at the DNA sequence level, none coincided with any of the 90 topoisomerase II cleavage sites detected in the same regions in the absence of drug. Cleavage at the 90 enzyme-only sites was inhibited by doxorubicin and never stimulated even at low drug concentrations. All of the doxorubicin-stabilized sites had an A at the 3' terminus of at least one member of each pair of strand breaks that would constitute a topoisomerase II double-strand scission. Conversely, none of the enzyme-only sites had an A simultaneously at the corresponding positions on opposite strands. The 3'-A requirement for doxorubicin-stabilized cleavage is therefore incompatible with enzyme-only cleavage and explains the mutual exclusivity of the two classes of sites.     

Design and optimization of camptothecin conjugates of triple helix-forming oligonucleotides for sequence-specific DNA cleavage by topoisomerase I.

To achieve a sequence-specific DNA cleavage by topoisomerase I, derivatives of the antitumor drug camptothecin have been covalently linked to triple helix-forming oligonucleotides that bind in a sequence-specific manner to the major groove of double-helical DNA. Triplex formation at the target sequence positions the drug selectively at the triplex site, thereby stimulating topoisomerase I-mediated DNA cleavage at this site. In a continuous effort to optimize this strategy, a broad set of conjugates consisting of (i) 16-20-base-long oligonucleotides, (ii) alkyl linkers of variable length, and (iii) camptothecin derivatives substituted on the A or B quinoline ring were designed and synthesized. Analysis of the cleavage sites at nucleotide resolution reveals that the specificity and efficacy of cleavage depends markedly on the length of both the triple-helical structure and the linker between the oligonucleotide and the poison. The optimized hybrid molecules induced strong and highly specific cleavage at a site adjacent to the triplex. Furthermore, the drug-stabilized DNA-topoisomerase I cleavage complexes were shown to be more resistant to salt-induced reversal than the complexes induced by camptothecin alone. Such rationally designed camptothecin conjugates could provide useful antitumor drugs directed selectively against genes bearing the targeted triplex binding site. In addition, they represent a powerful tool to probe the molecular interactions in the DNA-topoisomerase I complex.     

Effect of phosphorothioate substitutions on DNA cleavage by Escherichia coli DNA topoisomerase I

To evaluate the structural influence of the DNA phosphate backbone on the activity of Escherichia coli DNA topoisomerase I, modified forms of oligonucleotide dA(7) were synthesized with a chiral phosphorothioate replacing the non-bridging oxygens at each position along the backbone. A deoxy-iodo-uracil replaced the 5'-base to crosslink the oligonucleotides by ultraviolet (UV) and assess binding affinity. At the scissile phosphate there was little effect on the cleavage rate. At the +1 phosphate, the rectus phosphorus (Rp)-thio-substitution reduced the rate of cleavage by a factor of 10. At the +3 and -2 positions from the scissile bond, the Rp-isomer was cleaved at a faster rate than the sinister phosphorus (Sp)-isomer. The results demonstrate the importance of backbone contacts between DNA substrate and E. coli topoisomerase I.     

Site-specific DNA cleavage by vaccinia virus DNA topoisomerase I. Role of nucleotide sequence and DNA secondary structure.

Cleavage of linear duplex DNA by purified vaccinia virus DNA topoisomerase I occurs at a conserved sequence element (5'-C/T)CCTT decreases) in the incised DNA strand. Oligonucleotides spanning the high affinity cleavage site CCCTT at nucleotide 2457 in pUC19 DNA are cleaved efficiently in vitro, but only when hybridized to a complementary DNA molecule. As few as 6 nucleotides proximal to the cleavage site and 6 nucleotides downstream of the site are sufficient to support exclusive cleavage at the high affinity site (position +1). Single nucleotide substitutions within the consensus pentamer have deleterious effects on the equilibria of the topoisomerase binding and DNA cleavage reactions. The effects of base mismatch within the pentamer are more dramatic than are the effects of mutations that preserve base complementarity. Competition experiments indicate that topoisomerase binds preferentially to DNA sites containing the wild-type pentamer element. Single-stranded DNA containing the sequence CCCTT in the cleaved stand is a more effective competitor than is single-stranded DNA containing the complementary sequence in the noncleaved strand.     

Platinated DNA adducts enhance poisoning of DNA topoisomerase I by camptothecin

Camptothecins constitute a novel class of chemotherapeutics that selectively target DNA topoisomerase I (Top1) by reversibly stabilizing a covalent enzyme-DNA intermediate. This cytotoxic mechanism contrasts with that of platinum drugs, such as cisplatin, which induce inter- and intrastrand DNA adducts. In vitro combination studies using platinum drugs combined with Top1 poisons, such as topotecan, showed a schedule-dependent synergistic activity, with promising results in the clinic. However, whereas the molecular mechanism of these single agents may be relatively well understood, the mode of action of these chemotherapeutic agents in combination necessitates a more complete understanding. Indeed, we recently reported that a functional homologous recombination pathway is required for cisplatin and topotecan synergy yet represses the synergistic toxicity of 1-beta-D-arabinofuranosyl cytidine in combination with topotecan (van Waardenburg, R. C., de Jong, L. A., van Delft, F., van Eijndhoven, M. A., Bohlander, M., Bjornsti, M. A., Brouwer, J., and Schellens, J. H. (2004) Mol. Cancer Ther. 3, 393-402). Here we provide direct evidence for Pt-1,3-d(GTG) poisoning of Top1 in vitro and demonstrate that persistent Pt-DNA adducts correlate with increased covalent Top1-DNA complexes in vivo. This contrasts with a lack of persistent lesions induced by the alkylating agent bis[chloroethyl]nitrosourea, which exhibits only additive activity with topotecan in a range of cell lines. In human IGROV-1 ovarian cancer cells, the synergistic activity of cisplatin with topotecan requires processive DNA polymerization, whereas overexpression of Top1 enhances yeast cell sensitivity to cisplatin. These results indicate that the cytotoxic activity of cisplatin is due, in part, to poisoning of Top1, which is exacerbated in the presence of topotecan.     

DNA topoisomerase I cleavage sites in DNA and in nucleoprotein complexes.

The intracellular substrate for eukaryotic DNA topoisomerases is chromatin rather than protein-free DNA. Yet, little is known about the action of topoisomerases on chromatin-associated DNA. We have analyzed to what extent the organization of DNA in chromatin influences the accessibility of DNA molecules for topoisomerase I cleavage in vitro. Using potassium dodecyl sulfate precipitation (Trask et al., 1984), we found that DNA in chromatin is cleaved by the enzyme with somewhat reduced efficiency compared to protein-free DNA. Furthermore, using native SV40 chromatin and mononucleosomes assembled in vitro, we show that DNA bound to histone octamer complexes is cleaved by topoisomerase I and that the cleavage sites as well as their overall distribution are identical in histone-bound and in protein-free DNA molecules.     

Drosophila topoisomerase II double-strand DNA cleavage: analysis of DNA sequence homology at the cleavage site.

In order to study the sequence specificity of double-strand DNA cleavage by Drosophila topoisomerase II, we have mapped and sequenced 16 strong and 47 weak cleavage sites in the recombinant plasmid p pi 25.1. Analysis of the nucleotide and dinucleotide frequencies in the region near the site of phosphodiester bond breakage revealed a nonrandom distribution. The nucleotide frequencies observed would occur by chance with a probability less than 0.05. The consensus sequence we derived is 5'GT.A/TAY decrease ATT.AT..G 3', where a dot means no preferred nucleotide, Y is for pyrimidine, and the arrow shows the point of bond cleavage. On average, strong sites match the consensus better than weak sites.     

A consensus sequence for cleavage by vertebrate DNA topoisomerase II.

Topoisomerase II, purified from chicken erythrocytes, was reacted with a large number of different DNA fragments and cleavages were catalogued in the presence and absence of drugs that stabilize the cleavage intermediate. Cleavages were sequenced to derive a consensus for topoisomerase II that predicts catalytic sites. The consensus is: (sequence; see text) where N is any base and cleavage occurs at the indicated mark between -1 and +1. The consensus accurately predicts topoisomerase II sites in vitro. This consensus is not closely related to the Drosophila consensus sequence, but the two enzymes show some similarities in site recognition. Topoisomerase II purified from human placenta cleaves DNA sites that are essentially identical to the chicken enzyme, suggesting that vertebrate type II enzymes share a common catalytic sequence. Both viral and tissue specific enhancers contain sites sharing strong homology to the consensus and endogenous topoisomerase II recognizes some of these sites in vivo.     

The basis for camptothecin enhancement of DNA breakage by eukaryotic topoisomerase I.

The eukaryotic topoisomerase I (topo I) is the target of the cytotoxic alkaloid camptothecin (CTT). In vitro, CTT enhances the breakage of DNA by topo I when the reaction is stopped with detergent. Although breakage at some sites is enhanced to a great extent while breakage at others is enhanced only minimally, CTT does not significantly change the breakage specificity of topo I in vitro. It has been suggested that CTT acts by slowing the reclosure step of the nicking-closing reaction. To test this hypothesis, we have measured the rate of reclosure for different break sites in the presence of CTT after adding 0.5 M NaCl to a standard low salt reaction. In support of the hypothesis, we find that topo I-mediated DNA breakage is enhanced the greatest at those sites where closure of the break is the slowest. These results suggest a mechanism for the toxicity of CTT in vivo.     

DNA cleavage assay for the identification of topoisomerase I inhibitors

The inhibition of DNA topoisomerase I (Top1) has proven to be a successful approach in the design of anticancer agents. However, despite the clinical successes of the camptothecin derivatives, a significant need for less toxic and more chemically stable Top1 inhibitors still persists. Here, we describe one of the most frequently used protocols to identify novel Top1 inhibitors. These methods use uniquely 3'-radiolabeled DNA substrates and denaturing polyacrylamide gel electrophoresis to provide evidence for the Top1-mediated DNA cleaving activity of potential Top1 inhibitors. These assays allow comparison of the effectiveness of different drugs in stabilizing the Top1-DNA intermediate or cleavage (cleavable) complex. A variation on these assays is also presented, which provides a suitable system for determining whether the inhibitor blocks the forward cleavage or religation reactions by measuring the reversibility of the drug-induced Top1-DNA cleavage complexes. This entire protocol can be completed in approximately 2 d.     

Role of the protein in the DNA sequence specificity of the cleavage site stabilized by the camptothecin topoisomerase IB inhibitor: a metadynamics study

Camptothecin (CPT) is a topoisomerase IB (TopIB) selective inhibitor whose derivatives are currently used in cancer therapy. TopIB cleaves DNA at any sequence, but in the presence of CPT the only stabilized protein–DNA covalent complex is the one having a thymine in position −1 with respect to the cleavage site. A metadynamics simulation of two TopIB–DNA–CPT ternary complexes differing for the presence of a thymine or a cytosine in position −1 indicates the occurrence of two different drug’s unbinding pathways. The free-energy difference between the bound state and the transition state is large when a thymine is present in position −1 and is strongly reduced in presence of a cytosine, in line with the different drug stabilization properties of the two systems. Such a difference is strictly related to the changes in the hydrogen bond network between the protein, the DNA and the drug in the two systems, indicating a direct role of the protein in determining the specificity of the cleavage site sequence stabilized by the CPT. Calculations carried out in presence of one compound of the indenoisoquinoline family (NSC314622) indicate a comparable energy difference between the bound and the transition state independently of the presence of a thymine or a cytosine in position −1, in line with the experimental results.