Solid phase peptide synthesis of human endothelin precursor peptides using two-step hard acid deprotection/cleavage methods.

Syntheses are described for the putative human and porcine biosynthetic precursors (hET-38 and pET-39) of endothelin, with the sequence previously deduced from human- and porcine-cDNA coding for preproendothelin. The Boc based solid phase synthetic method was applied, followed by weak hard acid, trimethylsilyl bromide, cleavage. The peptide removal from the resin was optimally accomplished with hydrogen fluoride. Disulfide bridges were formed by air-oxidation, and the linkage modes determined by enzymic (Endoproteinase Asp-N) digestion and HPLC. Five additional C-terminally elongated endothelin homologs were also synthesized. For alternative synthesis of pET-39, the use of trimethylsilyl trifluoromethanesulfonate for the removal of peptide from the resin generated a major side product, which was characterized. hET-38 was found to be less effective in vitro, when compared to endothelin. The vasoconstrictor activity in vitro of other related peptides was comparable to that of hET-38.     

Two-step hard acid deprotection/cleavage procedure for solid phase peptide synthesis

A new two-step deprotection/cleavage procedure for t-butoxycarbonyl (Boc) based solid phase peptide synthesis is reported. First the protective groups are removed from 4-(oxymethyl)-phenylacetamidomethyl (PAM) resin attached peptide with the weak hard acid, trimethylsilyl bromide-thioanisole/trifluoroacetic acid (TFA). In the second step, the peptide is cleaved from the resin with a stronger hard acid such as trimethylsilyl trifluoromethanesulfonate in TFA or with HF. The method is also shown to deformylate Nin-formyltryptophan moiety efficiently. The usefulness of this procedure for practical solid phase peptide synthesis is demonstrated by comparison with other deprotection methods in the synthesis of urotensin II and human endothelin.     

Solid-phase tuftsin (Thr-Lys-Pro-Arg) synthesis: deprotection and resin cleavage with trifluoromethane sulfonic acid.

A method is described for the synthesis of the naturally occurring tetrapeptide tuftsin (Thr-Lys-Pro-Arg). This stimulates phagocytosis of granulocytes and macrophages. Trifluoromethanesulfonic acid is used to cleave the tetrapeptide from its supporting resin in solid-phase synthesis. This reagent also causes deprotection of several protecting groups in bifunctional residues. The most significant is the complete removal of the tosyl group from N^G-tosyl-arginine-resin ester.     

Conductance measurements in solid phase peptide synthesis. I. Monitoring coupling and deprotection in Fmoc chemistry

Potentiated conductance shows promise for monitoring the progress of both coupling and deprotection reactions in solid phase peptide synthesis using Fmoc chemistry. Sterically hindered base may be added to the aprotic polar solvents used for synthesis, this induces ionisation of acids formed in the coupling and deprotection reactions, thus giving rise to a conductance signal in the solvent. Changes in this signal allow reactions occurring at the resin to be followed with no degradation of coupling efficiency.     

Solid phase synthesis of quinolones.

Solid phase syntheses of ethyl 6-carboxyquinol-4(1H-)-one-3-carboxylate (5) and N-substituted 6-carboxyquinol-4(1H)-one-3-carboxamides 7a-d have been described. Antifilarial in vitro activities of 5,7a-d against Brugia malayi have also been delineated.     

Solid phase synthesis and restriction endonuclease cleavage of oligodeoxynucleotides containing 5-(hydroxymethyl)-cytosine.

Emerging data suggest an important role for cytosine methylation in tumorigenesis. Simultaneously, recent studies indicate a significant contribution of endogenous oxidative DNA damage to the development of human disease. Oxidation of the 5-methyl group of 5-methylcytosine (5mC) residues in DNA results in the formation of 5-(hydroxymethyl)cytosine (hmC). The biological consequences ofhmC residues in vertebrate DNA are as yet unknown; however, conversion of the hydrophobic methyl group to the hydrophilic hydroxymethyl group may substantially alter the interaction of sequence-specific binding proteins with DNA. Central to both biophysical and biochemical studies on the potential consequences of specific DNA damage products such as hmC are efficient methods for the synthesis of oligodeoxynucleotides containing such modified bases at selected positions. In this paper, we describe a method for the placement of hmC residues in oligodeoxynucleotides using established phosphoramidite chemistry. In addition, we have examined the influence of specific hmC residues on enzymatic cleavage of oligodeoxynucleotides by the methylation-sensitive restriction endonucleases MspI and HpaII.     

Solid phase synthesis of anthraquinone peptides and their evaluation as topoisomerase I inhibitors.

Anthraquinone peptide derivatives have previously been shown to inhibit the enzyme topoisomerase I (topo I), a pharmaceutical target for the prevention of malignant carcinomas. A highly efficient procedure for the attachment of the anthraquinone moiety to the N-terminus of a peptide on a solid support is reported. This methodology provides a convenient method for the synthesis of labelled peptides, with potential applications for chemotherapy, DNA detection and protein purification. As the synthetic strategy utilizes the solid phase, it should also be amenable to the generation of combinatorial libraries. The utility of the method by synthesizing a pool of peptides and assaying for topo I inhibition is demonstrated.     

Solid phase synthesis of peptide-selenoesters

The synthesis of proteins by native chemical ligation greatly enhances the application of chemistry to complex molecules such as proteins. The essential building blocks for this approach traditionally have been peptide-thioester segments that are linked chemoselectively in consecutive reactions. By using peptide selenoesters instead of thioesters, the ligation rate can be significantly accelerated permitting couplings at difficult sites and potentially enabling new ligation strategies. To facilitate the routine synthesis of selenoester peptides, a general and straightforward procedure has been developed that generates a suitably functionalized resin from which the desired selenoester peptide can be readily synthesized. This simple approach utilizes readily available and cheap chemical agents and enables production of peptide selenoesters of excellent quality in short time and with high recovery. In addition, the stability of peptide selenoesters was examined under different native chemical ligation conditions and compared to thioesters. Selenoesters are slightly more reactive and more susceptible to hydrolysis and aminolysis than thioesters but sufficiently stable under mildly acidic conditions (pH 6.5). Under these conditions, rapid selenoester-mediated ligation is kinetically favoured.     

A rapid deprotection procedure for phosphotriester DNA synthesis.

An equimolar solution of aldoxime and tetramethylguanidine at 70 degrees C removes both the base and phosphate protection from oligonucleotides prepared by solid phase phosphate triester technology. The rate of cleavage from the succinyl linkage commonly used for solid phase synthesis is also increased. The method is simpler, faster and more easily automated than existing methods.     

Solid phase synthesis of oligodeoxyribonucleoside phosphorodithioates from thiophosphoramidites.

Oligonucleoside phosphorodithioates 1 are modified DNA sequences with potential use as antisense oligonucleotides. The preparation of up to 20-mers containing all four bases by solid phase synthesis is described, with details on the preparation of the four monomer units (protected nucleoside thiophosphoramidites 2), the conditions used for the assembly of the strands with up to 19 phosphorodithioate linkages, and the purification and characterisation of the products. Full-length homogeneity of HPLC-purified all-phosphorodithioate products is demonstrated by PAGE, but 31P NMR discloses the presence of phosphorothioate impurities (typically 8-9%), the origin of which is discussed. Oligonucleoside phosphorodithioates are freely soluble in water at neutral or basic pH, and are very stable towards oxidation, hydrolysis, and nuclease cleavage. Their ability to hybridize to complementary DNA has been studied by UV melting point (Tm) measurements. The observed depression of Tm, 0.5-2 degrees C per phosphorodithioate linkage, is higher that the 0.4-0.6 degrees C found for phosphorothioates.     

Solid phase synthesis of glycopeptide dendrimers with Tn antigenic structure and their biological activities. Part I

Multiple antigenic peptides containing dimeric Tn antigen [Ac‐(Tn)₂‐γ‐Abu]₄‐(Lys‐X)₂‐Lys‐β‐Ala ( V : X=0; VIII : X=γ‐Abu) and [Ac‐(Tn)₂‐γ‐Abu]₈‐(Lys‐X)₄‐(Lys‐X)₂‐Lys‐β‐Ala ( XI : X=0; XIV : X=γ‐Abu), immobilized on biocompatible Tenta Gel S NH₂ support were prepared by SPPS. Rosetting tests of V , VIII , XI and XIV showed positive reactions with anti‐Tn (DAKO) and Tn+ erythrocytes, with anti‐Tn/A (BRIC 66) and Tn+ and A erythrocytes, other combinations were negative. In all the animals immunized with XIV , we found a remarkable increase in the level of anti‐Tn (titre 2000–64 000, score 105–167) and no change of anti‐A levels (titre 8, score 13–17). Neither non‐immune nor immune sera showed any reactivity with T⁺, Cad⁺ and blood group O erythrocytes. Immunized mice did not exhibit any sign of adverse reaction to the administered conjugates. Biological activities were correlated with molecular modelling and molecular dynamic calculations. The biological activities of these synthetic Tn antigen conjugates (good availability for the immunological interactions, highly specific immunogenicity, good biological tolerance) together with their precise chemical characterization seem to be a promising approach to preparation of anti‐tumour vaccine and affinity purification of anti‐Tn antibodies. Copyright © 1999 European Peptide Society and John Wiley & Sons, Ltd.     

alpha-DNA. VII. Solid phase synthesis of alpha-anomeric oligodeoxyribonucleotides.

An efficient procedure for the synthesis of unnatural alpha-anomeric oligodeoxyribonucleotides is described. This solid-phase procedure is based on the use of alpha-nucleoside phosphoramidites and alpha-nucleoside derivatized solid supports corresponding to the four natural bases and allow rapid synthesis of oligonucleotides up to 20 alpha-deoxynucleotide units in length. After HPLC purification, a 15-mer: alpha-d(CCTCTCGTTCTTTAC) and a 20-mer: alpha-d(ATACTTGAGGAAGAGGTGTT) were obtained respectively in 27 and 29% overall yields. Their purity, nucleoside composition and primary structure were ascertained by HPLC and Maxam-Gilbert sequence analyses.     

Solid phase synthesis of somatostatin-28

The synthesis of ovine hypothalamic somatostatin-28 (Ser-Ala-Asn-Ser-Asn-Pro-Ala-Met-Ala-Pro-Arg-Glu-Arg-Lys-Ala-Gly-$\text{Cys-Lys-Asn-Phe-Phe-Trp-Lys-Thr-Phe-Thr-Ser-Cys}$-OH) has been accomplished by solid phase methodology. The structure of the synthetic material was verified by: (1) direct sequence analysis with a Beckman 89°C sequencer, (2) correlation of the amino acid analyses of the isolated tryptic peptide fragments with their theoretical compositions, and (3) comparison, using high performance liquid chromatography, of the synthetic methionine-sulfoxide and methionine-sulfone modified NH₂-terminal peptides (residues 1–11) with the corresponding tryptic fragment from somatostatin-28.     

Solid phase synthesis of 2-aminobenzothiazoles

A traceless solid supported protocol for the synthesis of 2-aminobenzothiazoles is described, employing resin-bound acyl-isothiocyanate and a series of anilines. Cyclization of the resulting N-acyl, N′-phenyl-thioureas generates the 2-aminobenzothiazole scaffold, which can be further elaborated prior to hydrazine-mediated cleavage of the final products from the carboxy-polystyrene resin. A small, focused library of 2-aminobenzothiazoles was prepared.     

Solid phase peptide synthesis on epoxy-bearing methacrylate monoliths.

Monoliths based on a copolymer of glycidyl methacrylate (GMA) and ethylene dimethacrylate (EDMA) can be used directly as sorbents for affinity chromatography after solid phase peptide synthesis. The quality of the synthesized products, the amount of grown peptides on a support and the reproducibility of the process must be considered. A determination of the quantity of the introducing beta-Ala (and, consequently, the total amount of synthesized peptide) was carried out. Three peptides complementary to recombinant tissue plasminogen activator (t-PA) have been synthesized using Fmoc-chemistry on GMA-EDMA disks. The peptidyl ligands were analysed by amino acid analysis, ES-MS and HPLC methods. The affinity binding parameters were obtained from frontal elution data. The results were compared with those established for GMA-EDMA affinity sorbents formed by the immobilization of the same but separately synthesized and purified ligands. The immobilization on GMA-EDMA disks was realized using a one-step reaction between the amino groups of the synthetic ligand and the original epoxy groups of monolithic material. The affinity constants found for two kinds of sorbent did not vary significantly. Finally, the directly obtained affinity sorbents were tested for t-PA separation from a cellular supernatant.     

Solid phase synthesis of complex natural products and libraries thereof.

Natural products have served as an important source of medicinal compounds and pharmaceutical leads over the last century. Within the last 10 years, significant interest has developed in applying combinatorial chemistry techniques to the study of natural products and their biological activities. In this review, we examine several representative efforts wherein natural product skeletons have been constructed or immobilized on solid support and subsequently derivatized, giving rise to analog libraries useful in understanding the structure-activity relationships of the parent natural product. Issues such as target selection, library design, linker development, automation, and library characterization are addressed.     

Solid phase synthesis of partially protected tocinoic acid: optimization with respect to resin and protecting groups.

A few solid phase and solution approaches of good repute were applied in parallel with the aim to provide optimized routes to Boc- and Fmoc-tocinoic acid (3a and 3c) and the corresponding Tyr(Bu(t)) derivatives (3b and 3d). Boc-tocinoic acid is known to couple with tripeptide amides to give substituted oxytocin precursors in high yields, requiring only Boc-cleavage to furnish the corresponding hormone analogs with minimal loss of material. For comparison, two protected linear hexapeptides (2a and 2b) were prepared on three polystyrene supports, two with acid-labile handles and one a conventional chloromethylated resin, in yields of 62-82 and 58-76%, respectively. The intermediate 2a could be converted to 3a with physical data in agreement with those earlier reported. Similarly, the intermediate 2b was converted to 3b. The highest yields for both 2a and 2b were obtained with a 2-chlorotrityl chloride resin, which in addition provided advantages with respect to overall speed and convenience. Additional syntheses of 3c and 3d on this and of 3c on SASRIN resin, in conjunction with trityl instead of benzyl for side-chain protection of cysteine, were also elaborated.