Identification of positive and negative regulatory regions controlling expression of the cartilage matrix protein gene.

A complex pattern of regulation of the cartilage matrix protein gene was revealed by transient expression experiments. A minimal promoter from positions -15 to +64 functioned in chondrocytes and fibroblasts. An enhancer located in the first intron exerted chondrocyte-specific stimulation on the minimal promoter activity. The same fragment, however, had a negative effect in fibroblasts. Between -334 and -15, a silencer was found which inhibited the gene expression driven from its homologous as well as heterologous promoters both in chondrocytes and fibroblasts. Additional positive and negative control regions were mapped further upstream of the promoter.     

Epithelial-specific keratin gene expression: identification of a 300 base-pair controlling segment.

To elucidate the elements required for regulation of keratin expression in epidermis, we have linked a short, 300 base pair segment, corresponding to the promoter region of a human K#14 gene, to the chloramphenicol-acetyl-transferase gene. This construct was introduced into various mammalian cell lines and primary cultures via Ca3(PO4)2 precipitation. The 300 base pair segment from the keratin gene promoter region was active in all epithelial cells studied including transformed, simple epithelial cells such as HeLa and ME-180, cell lines derived from stratified epithelium, such as SCC-12, as well as primary cultures of epithelial cells. The construct was inactive in all non-epithelial cells tested including fibroblasts and melanocytes. The segment does not function as a silencer in nonepithelial cells but it can function as an enhancer in epithelial cells. Using the polymerase chain reaction we have constructed a series of deletions of the promoter and have localized an essential function within a 40 bp sequence. We conclude that we have identified the keratin gene promoter that is sufficient to confer epithelial-specific expression.     

T cell-specific negative regulation of transcription of the human cytokine IL-4.

IL-4 secreted by activated T cells is a pleiotropic cytokine affecting growth and differentiation of diverse cell types such as T cells, B cells, and mast cells. We investigated the upstream regulatory elements of the human IL-4 promoter. A novel T cell-specific negative regulatory element (NRE) composed of two protein-binding sites were mapped in the 5' flanking region of the IL-4 gene: -311CTCCCTTCT-303 (NRE-I) and -288CTTTTTGCTT-TGC-300 (NRE-II). A T cell-specific protein Neg-1 and a ubiquitous protein Neg-2 binding to NRE-I and NRE-II, respectively, were identified. Furthermore, a positive regulatory element was found 45 bp downstream of the NRE. The enhancer activity of the PRE was completely suppressed when the NRE was present. These data suggest that IL-4 promoter activity is normally down-regulated by an NRE via repression of the enhancer positive regulatory element. These data may have implications for the stringent control of IL-4 expression in T cells.     

A negative regulatory element (base pairs -204 to -177) of the EICP0 promoter of equine herpesvirus 1 abolishes the EICP0 protein's trans-activation of its own promoter

The early EICP0 protein is a powerful trans-activator that activates all classes of equine herpesvirus 1 (EHV-1) promoters but, unexpectedly, trans-activates its own promoter very weakly. Transient transfection assays that employed constructs harboring deletions within the EICP0 promoter indicated that EICP0 cis-acting sequences within bp -224 to -158 relative to the first ATG abolished the EICP0 protein's trans-activation of its own promoter. When inserted into the promoters of other EHV-1 genes, this sequence also downregulated activation of the immediate-early IE(-169/+73), early thymidine kinase TK(-215/+97), and late glycoprotein K gK(-83/+14) promoters, indicating that the cis-acting sequence (-224 to -158) downregulated expression of representative promoters of all classes of EHV-1 genes and contains a negative regulatory element (NRE). To define the cis-acting element(s), three synthetic oligonucleotides (Na [bp -224 to -195], Nb [bp -204 to -177], and Nc [bp -185 to -156]) were synthesized and cloned upstream of the EICP0(-157/-21) promoter. Of the three synthetic sequences, only the Nb oligonucleotide caused the downregulation of the EICP0 promoter. The NRE was identified as a 28-bp element to lie at -204 to -177 that encompassed the sequence of ([-204]AGATACAGATGTTCGATAAATTGGAACC[-177]). Gel shift assays performed with mouse L-M, rabbit RK-13, and human HeLa cell nuclear extracts and gamma-(32)P-labeled wild-type and mutant NREs demonstrated that a ubiquitous nuclear protein(s) (NRE-binding protein, NREBP) binds specifically to a sequence (bp -193 to -183) in the NRE. The NREBP is also present in the nucleus of EHV-1-infected cells; however, the amount of NREBP in EHV-1-infected L-M cells that bound to the Nb oligonucleotide was reduced compared to that in uninfected L-M cells. Transient transfection assays showed that deletions or mutations within the NREBP-binding site abolished the NRE activity of the EICP0 promoter. These results suggested that the NREBP may mediate the NRE activity of the EICP0 promoter and may function in the coordinate expression of EHV-1 genes.     

Analysis of regulatory elements of the promoter and the 3′ untranslated region of the maize<Emphasis Type="Italic"> Hrgp</Emphasis> gene coding for a cell wall protein

Hydroxyproline-rich glycoproteins (HRGP) are structural components of the plant cell wall. Hrgp genes from maize and related species have a conserved 500 bp sequence in the 5'-flanking region, and all Hrgp genes from monocots have an intron located in the 3' untranslated region. To study the role of these conserved regions, several deletions of the Hrgp gene were fused to the beta-glucuronidase ( GUS) gene and used to transform maize tissues by particle bombardment. The overall pattern of GUS activity directed by sequential deletions of the Hrgp promoter was different in embryos and young shoots. In embryos, the activity of the full-length Hrgp promoter was in the same range as that of the p35SI promoter construct, based on the strong 35S promoter, whereas in the fast-growing young shoots it was 20 times higher. A putative silencer element specific for young shoots was found in the -1,076/-700 promoter region. Other major cis elements for Hrgp expression are probably located in the regions spanning -699/-510 and -297/-160. Sequences close to the initial ATG and mRNA leader were also important since deletion of the region -52/+16 caused a 75% reduction in promoter activity. The presence of the Hrgp intron in the 3' untranslated region changed the levels of GUS activity directed by the Hrgp and the 35S promoters. This pattern of activity was complex, and was dependent on the promoter and cell type analysed.