共查询到20条相似文献,搜索用时 328 毫秒
1.
Heparin-mimetic sulfated peptides with modulated affinities for heparin-binding peptides and growth factors 总被引:2,自引:0,他引:2
Heterogeneity in the composition and in the polydispersity of heparin has motivated the development of homogeneous heparin mimics, and peptides of appropriate sequence and chemical function have therefore recently emerged as potential replacements for heparin in selected applications. Here, we report the assessment of the binding affinities of multiple sulfated peptides (SPs) for a set of heparin-binding peptides (HBPs) and for vascular endothelial growth factor isoform 165 (VEGF165); these binding partners have application in the selective immobilization of proteins and in hydrogel formation through non-covalent interactions. Sulfated peptides were produced via solid-phase methods, and their affinity for the HBPs and VEGF165 was assessed via affinity liquid chromatography (ALC), surface plasmon resonance (SPR), and in selected cases, isothermal titration calorimetry (ITC). The shortest peptide, SP(a), showed the highest affinity binding of HBPs and VEGF165 in both ALC and SPR measurements, with slight exceptions. Of the investigated HBPs, a peptide based on the heparin-binding domain of human platelet factor 4 showed greatest binding affinities toward all of the SPs, consistent with its stronger binding to heparin. The affinity between SP(a) and PF4(ZIP) was indicated via SPR (K(D)=5.27 microM) and confirmed via ITC (K(D)=8.09 microM). The binding by SP(a) of both VEGF and HBPs suggests its use as a binding partner to multiple species, and the use of these interactions in assembly of materials. Given that the peptide sequences can be varied to control binding affinity and selectivity, opportunities are also suggested for the production of a wider array of matrices with selective binding and release properties useful for biomaterials applications. 相似文献
2.
Two synthetic analogues of the heparin-binding domain of heparin/heparan sulfate-interacting protein (Ac-SRGKAKVKAKVKDQTK-NH2) and the all-d-amino acid version of the same peptide (l-HIPAP and d-HIPAP, respectively) were synthesized, and their efficacy as agents for neutralization of the anticoagulant activity of heparin was assayed. The two analogue peptides were found to be equally effective for neutralization of the anticoagulant activity of heparin, as measured by restoration of the activity of serine protease factor Xa by the Coatest heparin method. The finding that l-HIPAP and d-HIPAP are equally effective suggests that d-amino acid peptides show promise as proteolytically stable therapeutic agents for neutralization of the anticoagulant activity of heparin. The interaction of l-HIPAP and d-HIPAP with heparin was characterized by 1H NMR, isothermal titration calorimetry (ITC), and heparin affinity chromatography. The two peptides were found to interact identically with heparin. Analysis of the dependence of heparin-peptide binding constants on Na+ concentration by counterion condensation theory indicates that, on average, 2.35 Na+ ions are displaced from heparin per peptide molecule bound and one peptide molecule binds per hexasaccharide segment of heparin. The analysis also indicates that both ionic and nonionic interactions contribute to the binding constant, with the ionic contribution decreasing as the Na+ concentration increases. 相似文献
3.
Yasuo Inoshima Masayuki Oda Takahiro Maruno Yuji Kobayashi Naotaka Ishiguro 《Protein science : a publication of the Protein Society》2014,23(8):1050-1059
We previously generated a monoclonal antibody (mAb), G2, by immunizing mice with Residues 174–247 of the chicken prion protein (ChPrPC). In this study, we found that G2 possessed an extremely unusual characteristic for a mAb; in particular, it could react with at least three proteins other than ChPrPC, the original antigenic protein. We immunoscreened a complementary DNA library from chicken brain DNA and found three proteins (SEPT3, ATP6V1C1, and C6H10orf76) that reacts with G2. There were no regions of amino acid sequence similarity between ChPrPC and SEPT3, ATP6V1C1, or C6H10orf76. We selected ATP6V1C1 as a representative of the three proteins and identified the epitope within ATP6V1C1 that reacts with G2. The amino acid sequence of the G2 epitope within ATP6V1C1 (Pep8) was not related to the G2 epitope within ChPrPC (Pep18mer). However, enzyme-linked immunosorbent assay, surface plasmon resonance (SPR), and isothermal titration calorimetry (ITC) experiments indicated that these two peptides have similar binding affinity for G2. The apparent KD values of Pep18mer and Pep8 obtained from SPR experiments were 2.9 × 10−8 and 1.6 × 10−8
M, respectively. Antibody inhibition test using each peptide indicated that the binding sites of the two different peptides overlapped each other. We observed that these two peptides substantially differed in several binding characteristics. Based on the SPR experiments, the association and dissociation rate constants of Pep18mer were higher than those of Pep8. A clear difference was also observed in ITC experiments. These differences may be explained by G2 adopting different binding conformations and undergoing different binding pathways. 相似文献
4.
Mori T Inamori K Inoue Y Han X Yamanouchi G Niidome T Katayama Y 《Analytical biochemistry》2008,375(2):223-231
We developed a peptide microarray based on surface plasmon resonance (SPR) imaging for monitoring protein kinase activities in cell lysates. The substrate peptides of kinases were tethered to the microarray surface modified with a self-assembled monolayer of an alkanethiol with triethylene glycol terminus to create a low nonspecific binding surface. The phosphorylation of the substrate peptides immobilized on the surface was detected with the following phosphate specific binders by amplifying SPR signals: anti-phosphotyrosine antibody for tyrosine kinases and Phos-tag biotin (a phosphate-specific ligand with biotin tag) for serine/threonine kinases. Using the microarray, 9 kinds of protein kinases were evaluated as a pattern of phosphorylation of 26 kinds of substrate peptides. The pattern was unique for each protein kinase. The microarray could be used to evaluate the inhibitory activities of kinase inhibitors. The microarray was applied successfully for kinase activity monitoring of cell lysates. The chemical stimuli responsive activity changes of protein kinases in cell lysates could also be monitored by the peptide microarray. Thus, the peptide microarray based on SPR imaging would be applicable to cell-based drug discovery, diagnosis using tissue lysates, and biochemical studies to reveal signal transduction pathways. 相似文献
5.
M Fath V VanderNoot I Kilpel?inen T Kinnunen H Rauvala R J Linhardt 《FEBS letters》1999,454(1-2):105-108
The interaction of heparin with heparin binding growth-associated molecule (HB-GAM) was studied using isothermal titration calorimetry (ITC) and surface plasmon resonance (SPR). ITC studies showed that, in solution, heparin bound HB-GAM with a deltaH of -30 kcal/mole corresponding to a dissociation constant (Kd) of 460 nM. The stoichiometry of interaction was 3 moles of HB-GAM per mole of heparin, corresponding to a minimum heparin binding site for HB-GAM of 12-16 saccharide residues. Kinetic measurements of heparin interaction with HB-GAM made by SPR afforded a Kd of 4 nM, suggesting considerably tighter binding when HB-GAM was immobilized on a surface. Affinity chromatography of a sized mixture of heparin oligosaccharides, having a degree of polymerization (dp) of > 14 saccharide units, on HB-GAM-Sepharose demonstrated that oligosaccharides having more than 18 saccharide residues showed the tightest interaction. 相似文献
6.
Isothermal titration calorimetry (ITC), differential scanning calorimetry (DSC), and biosensor-surface plasmon resonance (SPR) are evaluated for their accuracy in determining equilibrium constants, ease of use, and range of application. Systems chosen for comparison of the three techniques were the formation of complexes between two minor groove binding compounds, netropsin and 4,6-diamidino-2-phenylindole (DAPI), and a DNA hairpin having the sequence 5'-d(CGAATTCGTCTCCGAATTCG)-3'. These systems were chosen for their structural differences, simplicity (1:1 binding), and binding affinity in the range of interest (K approximately 10(8) M(-1)). The binding affinities determined from all three techniques were in excellent agreement; for example, netropsin/DNA formation constants were determined to be K = 1.7x10(8) M(-1) (ITC), K = 2.4x10(8) M(-1) (DSC), and K = 2.9x10(8) M(-1) (SPR). DSC and SPR techniques have an advantage over ITC in studies of ligands that bind with affinities greater than 10(8) M(-1). The ITC technique has the advantage of determining a full set of thermodynamic parameters, including deltaH, TdeltaS, and deltaC(p) in addition to deltaG (or K). The ITC data revealed complex binding behavior in these minor groove binding systems not detected in the other methods. All three techniques provide accurate estimates of binding affinity, and each has unique benefits for drug binding studies. 相似文献
7.
Soykut EA Dudak FC Boyaci IH 《Biochemical and biophysical research communications》2008,370(1):104-108
In this study, peptides were selected to recognize staphylococcal enterotoxin B (SEB) which cause food intoxication and can be used as a biological war agent. By using commercial M13 phage library, single plaque isolation of 38 phages was done and binding affinities were investigated with phage-ELISA. The specificities of the selected phage clones showing high affinity to SEB were checked by using different protein molecules which can be found in food samples. Furthermore, the affinities of three selected phage clones were determined by using surface plasmon resonance (SPR) sensors. Sequence analysis was realized for three peptides showing high binding affinity to SEB and WWRPLTPESPPA, MNLHDYHRLFWY, and QHPQINQTLYRM amino acid sequences were obtained. The peptide sequence with highest affinity to SEB was synthesized with solid phase peptide synthesis technique and thermodynamic constants of the peptide-SEB interaction were determined by using isothermal titration calorimetry (ITC) and compared with those of antibody-SEB interaction. The binding constant of the peptide was determined as 4.2 ± 0.7 × 105 M−1 which indicates a strong binding close to that of antibody. 相似文献
8.
M M Schenone S E Warder J A Martin M Prorok F J Castellino 《The journal of peptide research》2000,56(6):438-445
The determinants of binding of a peptide lacking C-termini-exposed lysine residues to a kringle domain were investigated using an up-regulated lysine binding kringle (K2Pg[C4G/E56D/K72Y]) of plasminogen and a peptide (a1-PAM) with a sequence derived from a surface-exposed M-like streptococcal protein. Significant kringle-induced chemical shifts in a His side-chain of a1-PAM were revealed by two-dimensional NMR. Further studies using isothermal titration calorimetry (ITC) provided support for the involvement of His12 in the peptide/ protein complex. In an effort to screen a1-PAM-derived truncation peptides, a combinatorial mixture, a1deltaa2-PAM[H12X] (where X=Pro, Arg, His, Trp, Lys, Ala, Phe, Asp and Gly), was analyzed using the surface-enhanced laser desorption ionization time-of-flight mass spectrometry (SELDI) platform. The major peptide that remained bound to the surface of the K2Pg[C4G/ E56D/K72Y]-containing chip was that containing His12, corresponding to the wild-type sequence. Minor peaks, representing binding, were obtained for Lys12-, Arg12- and Trp12-containing peptides. Individual peptides containing these amino acids were then examined using ITC and the binding constants obtained correlated with the relative strengths of binding estimated from the SELDI-based screen. 相似文献
9.
Lesiak M Augusciak-Duma A Szydlo A Pruszczynska K Sieron AL 《Acta biochimica Polonica》2008,55(2):297-305
Procollagen C-endopeptidase (BMP-1) and N-endopeptidase (ADAMTS-2) are key enzymes for correct and efficient conversion of fibrillar procollagens to their self assembling monomers. Thus, they have an essential role in building and controlling the quality of extracellular matrices (ECMs). Here, we tested inhibition of activity of the largest variant of BMP-1, a recombinant mammalian tolloid (mTld), in vitro by three synthetic peptides with conservative amino-acid sequences found in chordin using procollagen type I as a substrate. We also verified the specific action of best inhibitory 16 amino-acid peptide in the procollagen type I cleavage assay with the use of ADAMTS-2 (procollagen N-endopeptidase). Subsequently, we determined the critical residues and minimal sequence of six amino acids in the original 16 amino-acid peptide required to maintain the inhibitory potential. Studies on the interactions of 6 and 16 amino acid long peptides with the enzyme revealed their binding to non-catalytic, regulatory domains of mTld; the inhibitory activity was not due to the competition of peptides with the substrate for the enzyme active center, because mTld did not cleave the peptides. However, in the presence of mTld both peptides underwent cyclization by disulfide bond formation. Concluding, we have shown that procollagen C-endopeptidase may be specifically blocked via its non-catalytic domains by synthetic peptide consisting of 6 amino acids in the sequence found in highly conservative region of chordin. Thus, we hypothesize that the 6 amino-acid peptide could be a good candidate for anti-fibrotic drug development. 相似文献
10.
We have investigated the thermodynamic parameters and binding of a regulatory subunit of cAMP-dependent protein kinase (PKA) to its natural low-molecular-weight ligand, cAMP, and analogues thereof. For analysis of this model system, we compared side-by-side isothermal titration calorimetry (ITC) with surface plasmon resonance (SPR). Both ITC and SPR analyses revealed that binding of the protein to cAMP or its analogues was enthalpically driven and characterised by similar free energy values (DeltaG=-9.4 to -10.7 kcal mol-1) for all interactions. Despite the similar affinities, binding of the cyclic nucleotides used here was characterised by significant differences in the contribution of entropy (-TDeltaS) and enthalpy (DeltaH) to DeltaG. The comparison of ITC and SPR data for one cAMP analogue further revealed deviations caused by the method. These equilibrium parameters could be complemented by thermodynamic data of the transition state (DeltaHnot equal, DeltaGnot equal, DeltaSnot equal) for both association and dissociation measured by SPR. This direct comparison of ITC and SPR highlights method-specific advantages and drawbacks for thermodynamic analyses of protein/ligand interactions. 相似文献
11.
Ganesh Kumar Krishnamoorthy Prashanth Alluvada Shahul Hameed Mohammed Sherieff Timothy Kwa Janarthanan Krishnamoorthy 《Biochemistry and Biophysics Reports》2020
Biophysical techniques such as isothermal titration calorimetry (ITC) and surface plasmon resonance (SPR) are routinely used to ascertain the global binding mechanisms of protein-protein or protein-ligand interaction. Recently, Dumas etal, have explicitly modelled the instrument response of the ligand dilution and analysed the ITC thermogram to obtain kinetic rate constants. Adopting a similar approach, we have integrated the dynamic instrument response with the binding mechanism to simulate the ITC profiles of equivalent and independent binding sites, equivalent and sequential binding sites and aggregating systems. The results were benchmarked against the standard commercial software Origin-ITC. Further, the experimental ITC chromatograms of 2′-CMP + RNASE and BH3I-1 + hBCLXL interactions were analysed and shown to be comparable with that of the conventional analysis. Dynamic approach was applied to simulate the SPR profiles of a two-state model, and could reproduce the experimental profile accurately. 相似文献
12.
Exploring the development of nonviral nucleic acid delivery vectors with progressive, specific, and novel designs in molecular architecture is a fundamental way to investigate how aspects of chemical and physical structure impact the transfection process. In this study, macromolecules comprised of a four-arm star poly(ethylene glycol) and termini modified with one of five different heparin binding peptides have been investigated for their ability to bind, compact, and deliver DNA to mammalian cells in vitro. These new delivery vectors combine a PEG-derived stabilizing moiety with peptides that exhibit unique cell-surface binding ability in a molecular architecture that permits multivalent presentation of the cationic peptides. Five peptide sequences of varying heparin binding affinity were studied; each was found to sufficiently bind heparin for biological application. Additionally, the macromolecules were able to bind and compact DNA into particles of proper size for endocytosis. In biological studies, the PEG-star peptides displayed a range of toxicity and transfection efficiency dependent on the peptide identity. The vectors equipped with peptides of highest heparin binding affinity were found to bind DNA tightly, increase levels of cellular internalization, and display the most promising transfection qualities. Our results suggest heparin binding peptides with specific sequences hold more potential than nonspecific cationic polymers to optimize transfection efficiency while maintaining cell viability. Furthermore, the built-in multivalency of these macromolecules may allow simultaneous binding of both DNA at the core of the polyplex and heparan sulfate on the surface of the cell. This scheme may facilitate a bridging transport mechanism, tethering DNA to the surface of the cell and subsequently ushering therapeutic nucleic acids into the cell. This multivalent star shape is therefore a promising architectural feature that may be exploited in the design of future polycationic gene delivery vectors. 相似文献
13.
Aaron P. Yamniuk John A. Newitt Michael L. Doyle Fumio Arisaka Anthony M. Giannetti Preston Hensley David G. Myszka Fred P. Schwarz James A. Thomson Edward Eisenstein 《Journal of biomolecular techniques》2015,26(4):125-141
A significant challenge in the molecular interaction field is to accurately determine the stoichiometry and stepwise binding affinity constants for macromolecules having >1 binding site. The mission of the Molecular Interactions Research Group (MIRG) of the Association of Biomolecular Resource Facilities (ABRF) is to show how biophysical technologies are used to quantitatively characterize molecular interactions, and to educate the ABRF members and scientific community on the utility and limitations of core technologies [such as biosensor, microcalorimetry, or analytic ultracentrifugation (AUC)]. In the present work, the MIRG has developed a robust model protein interaction pair consisting of a bivalent variant of the Bacillus amyloliquefaciens extracellular RNase barnase and a variant of its natural monovalent intracellular inhibitor protein barstar. It is demonstrated that this system can serve as a benchmarking tool for the quantitative analysis of 2-site protein-protein interactions. The protein interaction pair enables determination of precise binding constants for the barstar protein binding to 2 distinct sites on the bivalent barnase binding partner (termed binase), where the 2 binding sites were engineered to possess affinities that differed by 2 orders of magnitude. Multiple MIRG laboratories characterized the interaction using isothermal titration calorimetry (ITC), AUC, and surface plasmon resonance (SPR) methods to evaluate the feasibility of the system as a benchmarking model. Although general agreement was seen for the binding constants measured using solution-based ITC and AUC approaches, weaker affinity was seen for surface-based method SPR, with protein immobilization likely affecting affinity. An analysis of the results from multiple MIRG laboratories suggests that the bivalent barnase-barstar system is a suitable model for benchmarking new approaches for the quantitative characterization of complex biomolecular interactions. 相似文献
14.
One-step immobilization method for peptides and proteins is developed by using modified parylene film with formyl groups which is suitable for microplate-based immunoassay and SPR biosensor application. The immobilization of peptides and proteins is achieved through the covalent bonding of the formyl group with the primary amine groups of peptides and proteins, which no additional activation step is required. In this work, the immobilization efficiency of parylene-H is estimated in comparison with parylene-A and physical adsorption, using biotinylated-cyclic citrullinated peptide (biotinylated-CCP), human chorionic gonadotropin (hCG) and horseradish peroxidase (HRP) as model proteins. The applicability of parylene-H film to SPR biosensor is demonstrated by estimating the detection range and sensitivity of SPR biosensor at various thicknesses. The immobilization efficiency of parylene-H film for SPR biosensor was compared with physical adsorption by using HRP as a model protein. 相似文献
15.
Takakusagi Y Kuramochi K Takagi M Kusayanagi T Manita D Ozawa H Iwakiri K Takakusagi K Miyano Y Nakazaki A Kobayashi S Sugawara F Sakaguchi K 《Bioorganic & medicinal chemistry》2008,16(22):9837-9846
Here, we report an efficient one-cycle affinity selection using a natural-protein or random-peptide T7 phage pool for identification of binding proteins or peptides specific for small-molecules. The screening procedure involved a cuvette type 27-MHz quartz-crystal microbalance (QCM) apparatus with introduction of self-assembled monolayer (SAM) for a specific small-molecule immobilization on the gold electrode surface of a sensor chip. Using this apparatus, we attempted an affinity selection of proteins or peptides against synthetic ligand for FK506-binding protein (SLF) or irinotecan (Iri, CPT-11). An affinity selection using SLF-SAM and a natural-protein T7 phage pool successfully detected FK506-binding protein 12 (FKBP12)-displaying T7 phage after an interaction time of only 10 min. Extensive exploration of time-consuming wash and/or elution conditions together with several rounds of selection was not required. Furthermore, in the selection using a 15-mer random-peptide T7 phage pool and subsequent analysis utilizing receptor ligand contact (RELIC) software, a subset of SLF-selected peptides clearly pinpointed several amino-acid residues within the binding site of FKBP12. Likewise, a subset of Iri-selected peptides pinpointed part of the positive amino-acid region of residues from the Iri-binding site of the well-known direct targets, acetylcholinesterase (AChE) and carboxylesterase (CE). Our findings demonstrate the effectiveness of this method and general applicability for a wide range of small-molecules. 相似文献
16.
Lipopolysaccharide, the invariant structural component of Gram-negative bacteria, when present in minute amounts in the circulation in humans elicits 'endotoxic shock' syndrome, which is fatal in 60% of the cases. Polymyxin B (PMB), a cyclic cationic peptide, neutralizes the endotoxin, but also induces many harmful side effects. Many peptide-based drugs mimicking the activity of PMB have been synthesized in an attempt to reduce toxicity while still retaining the anti-endotoxic activity. The study attempts to use the recent technique of surface plasmon resonance (SPR), in determining the kinetics of association and dissociation involved in the interaction of endotoxin with a few selected peptides that have structural features resembling PMB. The results, in conjunction with the thermodynamic data derived using isothermal titration calorimetry (ITC), stress the vital role played by amphiphilicity of the peptides and hydrophobic forces in this biologically important interaction. 相似文献
17.
The primary structure of the psychrophilic lactate dehydrogenase from Bacillus psychrosaccharolyticus 总被引:1,自引:0,他引:1
L-lactate dehydrogenase of the psychrophilic bacterium B. psychrosaccharolyticus was isolated by a three-step procedure and its total amino-acid sequence determined by automated Edman degradation. The protein consists of 318 amino-acid residues and its calculated molecular mass is 35,254 Da. Most of the primary structure could be established by sequencing large peptide fragments obtained by chemical cleavages, namely with BNPS-skatole and with CNBr. Further fragmentations of two tryptophan peptides with the endoproteinase Lys-C and with diluted HCl resulted in shorter overlapping peptides, the analysis of which completed the sequence. The C-terminal sequence Glu-Gln was established by carboxypeptidase A experiments and was then verified by the analysis of short C-terminal tryptic and chymotryptic peptides. The first lactate dehydrogenase sequenced so far of a psychrophilic bacillus shows sequence homologies between 60% and 75% to the enzymes from the mesophilic B. megaterium and B. subtilis and the thermophilic B. stearothermophilus, B. caldolyticus and B. caldotenax. Within the 50 N-terminal residues, three additional sequences could be included in our comparisons. In this part of the molecule, sequence homologies between 56% and 74% were calculated. 相似文献
18.
Biosensor technology employing surface plasmon resonance (SPR) detection provides a highly-sensitive (sub ng), non-extrinsic labelling approach for monitoring protein interactions in real-time. We have used this approach to map the binding sites on human interleukin-6 (hIL-6) for a series of anti-hIL-6 monoclonal antibodies (mAbs). Epitopes were localised by monitoring the ability of ten synthetic peptides, spanning the sequence of hIL-6, to inhibit the binding of anti-hIL-6 mAbs to immobilised hIL-6. Peptide P8 (Pro139-Gln153) inhibited binding of anti-IL-6-mAbs 1, 2 and 7. To increase the sensitivity of detection of antibody-synthetic peptide interactions, a procedure was developed for immobilising the synthetic peptides directly to the sensor surface of the SPR instrument. From this study, association equilibrium constants of 2.1 x 10(6)M-1 and 3.6 x 10(4)M-1 were calculated for the mAb7-immobilised P8 and mAb7-free P8 interactions, respectively. 相似文献
19.
M Sobel D F Soler J C Kermode R B Harris 《The Journal of biological chemistry》1992,267(13):8857-8862
Human von Willebrand factor, a plasma glycoprotein which plays a critical role in regulating hemostasis, binds heparin, but the physiological importance and mode of this interaction is poorly understood. Using the motif of an amino acid sequence of a consensus heparin binding synthetic peptide, a 23-residue sequence (Tyr565-Ala587) of human von Willebrand factor was identified that retains the consensus motif and binds heparin with affinity comparable with native von Willebrand factor and the consensus peptide. In a fluid phase binding assay, the Tyr565-Ala587 peptide competed effectively with von Willebrand factor for binding heparin. Synthesis and testing of peptides overlapping Tyr565-Ala587, as well as adjacent cationic regions, showed this core sequence to be the optimal linear binding domain. Far ultraviolet circular dichroism spectrometry of the Tyr565-Ala587 peptide suggested that the peptide undergoes conformational change upon binding heparin. The Tyr565-Ala587 peptide thus encompasses part (or all) of a functionally important heparin binding domain of von Willebrand factor. Further study of this and related peptides may be useful for exploring how heparin may influence von Willebrand factor-mediated platelet hemostasis. 相似文献
20.
Koichiro Kitamura Yasunori Kinoshita Yoko Takahashi Tomoyo Kawakubo Md. Salimullah Kazunori Hanada Kenji Yamamoto Koichi Nishigaki 《Journal of molecular biology》2009,387(5):1186-1198
Proteases are involved in various biological functions. Thus, inhibition of their activities is scientifically interesting and medically important. However, there is no systematic method established to date to generate endopeptidase inhibitory peptides. Here, we report a general system to identify endopeptidase inhibitory peptides based on the use of in vitro evolution. Using this system, we generated peptides that inhibit cathepsin E (CE) specifically at a submicromolar IC50. This system generates protease inhibitor peptides utilizing techniques of cDNA display, selection-by-function, Y-ligation-based block shuffling, and others. We further demonstrated the importance and effectiveness of a secondary library for obtaining small-sized and active peptides. CE inhibitory peptides generated by this method were characterized by a small size (8 to 12 aa) and quite different sequences, suggesting that they bind to different sites on CE. Typical CE inhibitory peptide aptamers obtained here (Pi101; SCGG IIII SCIA) have half an inhibition activity (Ki; 5 nM) of pepstatin A (potent CE inhibitor) without inhibiting cathepsin D (structurally similar to CE). The general applicability of this system suggests that it may be useful to identify inhibitory peptides for various kinds of proteases and that it may therefore contribute to protein science and drug discovery. The peptide binding to a protein is discussed in comparison with the antibody binding to an antigen. 相似文献