共查询到20条相似文献,搜索用时 15 毫秒
1.
Khaled R.A. Abdellatif Carlos A. Velázquez Zhangjian Huang Morshed A. Chowdhury Edward E. Knaus 《Bioorganic & medicinal chemistry letters》2010,20(17):5245-5250
A group of (Z)-1,1-diphenyl-2-(4-methylsulfonylphenyl)alk-1-enes were synthesized using methodologies that will allow incorporation of a [11C]OCH3 substituent at the para-position of the C-1 phenyl ring, a [11C]SO2CH3 substituent at the para-position of the C-2 phenyl ring, a [18F]OCH2CH2F substituent at the para-position of the C-1 phenyl ring, and a [18F]CH2CH2F substituent at the C-2 position of the olefinic bond. The [11C] and [18F] radiotracers are designed as potential radiopharmaceuticals to image cyclooxygenase-2 (COX-2) expression in any organ where COX-2 is upregulated. The COX-1/COX-2 inhibition data acquired suggest that compounds having a [11C]OMe or [18F]OCH2CH2F substituent at the para-position of the C-1 phenyl ring may be more suitable for imaging COX-2 expression in view of their ability to exclusively inhibit the COX-2 isozyme. 相似文献
2.
Abdellatif KR Velázquez CA Huang Z Chowdhury MA Knaus EE 《Bioorganic & medicinal chemistry letters》2011,21(4):1195-1198
A group of (Z)-1,2-diphenyl-1-[4-[2-(4-methylpiperazin-1-yl)ethoxy]phenyl]but-1-enes were synthesized using methodologies that will allow incorporation of a [124I]iodine substituent at the para-position of either the C-1 phenyl ring or the C-2 phenyl ring, or a [18F]OCH2CH2F substituent at the para-position of the C-2 phenyl ring. These [124I] and [18F] radiotracers are designed as potential radiopharmaceuticals to image estrogen positive breast tumors using positron emission tomography (PET). 相似文献
3.
Radha Karki Pritam Thapa Mi Jeong Kang Tae Cheon Jeong Jung Min Nam Hye-Lin Kim Younghwa Na Won-Jea Cho Youngjoo Kwon Eung-Seok Lee 《Bioorganic & medicinal chemistry》2010,18(9):3066-3077
A new series of 2,4-diphenyl-6-aryl pyridines containing hydroxyl group(s) at the ortho, meta, or para position of the phenyl ring were synthesized, and evaluated for topoisomerase I and II inhibitory activity and cytotoxicity against several human cancer cell lines for the development of novel anticancer agents. Structure–activity relationship study revealed that the substitution of hydroxyl group(s) increased topoisomerase I and II inhibitory activity in the order of meta > para > ortho position. Substitution of hydroxyl group on the para position showed better cytotoxicity. 相似文献
4.
Aarajana Shrestha Hyunji Jo Youngjoo Kwon Eung-Seok Lee 《Bioorganic & medicinal chemistry letters》2018,28(4):566-571
Human DNA topoisomerases have become attractive targets for developing more effective anticancer drugs. In this study, a series of new benzofuro[3,2-b]pyridin-7-ols were designed and synthesized for the first time and screened for their topoisomerase I and II inhibitory and antiproliferative activity. Structure-activity relationships revealed the position of ortho- and para-hydroxyl group at 2-phenyl ring, and meta-hydroxyl group at 4-phenyl ring of benzofuro[3,2-b]pyridin-7-ol are important for potent and selective topo II inhibitory activity. Compound 11 showed the most selective and potent topo II inhibition (100% inhibition at 100?µM) and strongest antiproliferative activity (IC50?=?0.86?µM) than all the positive controls in HeLa cell line. 相似文献
5.
A new series of 2-phenol-4-chlorophenyl-6-aryl pyridines were designed, synthesized, and evaluated for topoisomerase (topo) I and II inhibitory activities as well as cytotoxic activity against four different human cancer cell lines such as HCT15, T47D, DU145, and Hela. Most of the tested compounds exhibited stronger topo II inhibitory activity at 100 μM as compared to etoposide. All the compounds, except 39, did not show topo I inhibitory activity. Interestingly, compounds that showed better topo II inhibition than etoposide have ortho- or para-chlorophenyl at 4-position of central pyridine, and none of the compounds possess meta-chlorophenyl. SAR study revealed the importance of ortho- or para-chlorophenyl at 4-position of the central pyridine for selective topo II inhibitory activity. Similarly, all compounds possessing meta- or para-hydroxyphenyl moieties showed moderate to significant cytotoxic effects. Particularly, compounds 27–37, and 39 which showed excellent cytotoxicity (IC50 = 0.68–1.25 μM) against T47D breast cancer cells suggest the importance of meta- or para-hydroxyphenyl moiety at 2-position of the central pyridine for the design of anticancer agents with related scaffolds. 相似文献
6.
Acetylcholinesterase (EC 3:1:1:7) has been demonstrated biochemically within partially purified whole worm homogenates of Moniezia expansa. Linear activity occurred with temperature, enzyme concentration, and time. The pH optimum was 8.5 and the Michaelis constant 2.8 mM with inhibition by excess substrate. Inhibitor and specific substrate studies indicated that butyrylcholinesterase was probably absent. The molecular weight of AChE was in excess of 300,000. Greatest activity occurred in the 22,000 and 100,000g particulate fractions. Ultrastructural staining showed that activity was restricted to the ribosomes and cisternae of the rough endoplasmic reticulum. Quinacrine hydrochloride caused 48% inhibition of AChE at 10?3M and haloxon (di(2-chloroethyl)-3-chloro-4-methyl-7-coumarinyl phosphate) caused 97% inhibition at 10?4M. No appreciable inhibition (< 25%) occurred with 10?4M bunamidine hydroxynaphthoate, bephenium hydroxynaphthoate, pyrantel tartrate, p-toluoyl phenyl hydrazone, dichlorphen, thiabendazole, mebendazole, fenbendazole, cambendazole, albendazole, parbendazole, oxibendazole, oxfendazole, praziquantel, piperazine adipate, arecoline hydrobromide, and sodium acetarsol. 相似文献
7.
Xudong Gong Guan Wang Jing Ren Zheng Liu Zhen Wang Tiantian Chen Xiaojun Yang Xiangrui Jiang Jingshan Shen Hualiang Jiang Haji Akber Aisa Yechun Xu Jianfeng Li 《Bioorganic & medicinal chemistry letters》2013,23(17):4944-4947
The substituents both at the 6-position of the 5-bromopyrimidinone ring and at the 5′-position of the phenyl ring of 5-bromopyrimidin-4(3H)-ones were explored. 5-Bromo-6-isopropyl-2-(2-propoxy-phenyl)pyrimidin-4(3H)-one was identified as a new scaffold for potent PDE5 inhibitors. The crystal structures of PDE5/2e and PDE5/10a complexes provided a structural basis for the inhibition of 5-bromopyrimidinones to PDE5. In addition, it was also found that there is a great tolerance for the substitution at the 5′-position of the phenyl ring of 5-bormopyrimidinones and the resulted compound 13a has the highest inhibition activity to PDE5 (IC50, 1.7 nM). 相似文献
8.
Ali Saber Abdelhameed Saima Nusrat Sanjhi Paliwal Masihuz Zaman Nida Zaidi 《Preparative biochemistry & biotechnology》2017,47(7):655-663
Drug and protein interaction provides a structural guideline in the rational drug designing and in the synthesis of new and improved drugs with greater efficacy. We have examined here the interaction tendency and mechanism of nintedanib (NTB), an anticancer drug (tyrosine kinase inhibitor) with bovine serum albumin (BSA), by spectroscopic techniques. The decline in Stern–Volmer quenching constants and binding constant with the temperature rise suggests that BSA forms a complex with NTB. Binding constant obtained by modified Stern–Volmer equation at 3 temperatures was realized to be of the order of ~104?M?1. Negative ΔG (~?5.93?kcal?mol?1), ΔH (?3.74?kcal?mol?1), and ΔS (?1.50?kcal?mol?1) values exhibited a spontaneous and exothermic reaction between BSA and NTB. NTB molecule interacts with BSA by forming hydrogen bonds, as elucidated by fluorescence results. Moreover, a minor increment in the helical conformation of BSA upon its binding to NTB was observed by circular dichroism spectroscopy. The modification in protein’s symmetry and a decline in hydrodynamic radii were observed in the presence of NTB (from ~3.6 to ~3?nm) as obtained by the dynamic light scattering measurement results. 相似文献
9.
Mahboubeh Hosseini-Kharat Davit Zargarian Zohreh Mehri Lighvan Amir Abbas Momtazi-Borojeni Tayebeh Sharifi 《Journal of biomolecular structure & dynamics》2013,31(14):3788-3802
AbstractThis report describes the results of a study on the antiproliferative activity of the morpholine-based ligand 1,3-bis(1-morpholinothiocarbonyl)benzene (HL) and its nickel(II) complex (NiL) against human breast cancer cells (MCF-7), colon carcinoma cells (C26), and normal fibroblast NIH-3T3 cells. NiL showed better cytotoxicity on both cancerous cells relative to normal cells in vitro with the highest selective index of 2.22 in MCF-7 cells. The interaction of both compounds with calf thymus DNA (CT DNA) and bovine serum albumin (BSA) was studied using various spectroscopic techniques and analytical methods such as UV???vis titrations, thermal denaturation, circular dichroism, competitive fluorescent intercalator displacement assays, as well as molecular modeling. The fluorescence intensity of the probe molecule increases clearly when HL and NiL are added to the methylene blue (MB)–DNA system. Furthermore, the binding of HL and NiL quenches the BSA fluorescence, revealing a 1:1 interaction with a binding constant of about 105?M?1.Communicated by Ramaswamy H. Sarma 相似文献
10.
《Biochimica et Biophysica Acta (BBA)/General Subjects》2023,1867(6):130347
BackgroundSIMR1281 is a potent anticancer lead candidate with multi- target activity against several proteins; however, its mechanism of action at the molecular level is not fully understood. Revealing the mechanism and the origin of multitarget activity is important for the rational identification and optimization of multitarget drugs.MethodsWe have used a variety of biophysical (circular dichroism, isothermal titration calorimetry, viscosity, and UV DNA melting), biochemical (topoisomerase I & II assays) and computational (molecular docking and MD simulations) methods to study the interaction of SIMR1281 with duplex DNA structures.ResultsThe biophysical results revealed that SIMR1281 binds to dsDNA via an intercalation-binding mode with an average binding constant of 3.1 × 106 M−1. This binding mode was confirmed by the topoisomerases' inhibition assays and molecular modeling simulations, which showed the intercalation of the benzopyrane moiety between DNA base pairs, while the remaining moieties (thiazole and phenyl rings) sit in the minor groove and interact with the flanking base pairs adjacent to the intercalation site.ConclusionsThe DNA binding characteristics of SIMR1281, which can disrupt/inhibit DNA function as confirmed by the topoisomerases' inhibition assays, indicate that the observed multi-target activity might originate from ligand intervention at nucleic acids level rather than due to direct interactions with multiple biological targets at the protein level.General significanceThe findings of this study could be helpful to guide future optimization of benzopyrane-based ligands for therapeutic purposes. 相似文献
11.
Jie-hua Shi Dong-qi Pan Min Jiang Ting-Ting Liu Qi Wang 《Journal of biomolecular structure & dynamics》2017,35(10):2211-2223
The binding interaction between quinapril (QNPL) and bovine serum albumin (BSA) in vitro has been investigated using UV absorption spectroscopy, steady-state fluorescence spectroscopic, synchronous fluorescence spectroscopy, 3D fluorescence spectroscopy, Fourier transform infrared spectroscopy, circular dichroism, and molecular docking methods for obtaining the binding information of QNPL with BSA. The experimental results confirm that the quenching mechanism of the intrinsic fluorescence of BSA induced by QNPL is static quenching based on the decrease in the quenching constants of BSA in the presence of QNPL with the increase in temperature and the quenching rates of BSA larger than 1010 L mol?1 s?1, indicating forming QNPL–BSA complex through the intermolecular binding interaction. The binding constant for the QNPL–BSA complex is in the order of 105 M?1, indicating there is stronger binding interaction of QNPL with BSA. The analysis of thermodynamic parameters together with molecular docking study reveal that the main binding forces in the binding process of QNPL with BSA are van der Waal’s forces and hydrogen bonding interaction. And, the binding interaction of BSA with QNPL is an enthalpy-driven process. Based on Förster resonance energy transfer, the binding distance between QNPL and BSA is calculated to be 2.76 nm. The results of the competitive binding experiments and molecular docking confirm that QNPL binds to sub-domain IIA (site I) of BSA. It is confirmed there is a slight change in the conformation of BSA after binding QNPL, but BSA still retains its secondary structure α-helicity. 相似文献
12.
Nahid Shahabadi Ali Ashraf Asadian Mryam Mahdavi 《Nucleosides, nucleotides & nucleic acids》2017,36(11):676-689
In this study, an attempt has been made to study the interaction of a Zn(II) complex containing an antibiotic drug, ciprofloxacin, with calf thymus DNA using spectroscopic methods. It was found that Zn(II) complex could bind with DNA via intercalation mode as evidenced by: hyperchromism in UV–Vis spectrum; these spectral characteristics suggest that the Zn(II) complex interacts with DNA most likely through a mode that involves a stacking interaction between the aromatic chromophore and the base pairs of DNA. DNA binding constant (Kb = 1.4 × 104 M?1) from spectrophotometric studies of the interaction of Zn(II) complex with DNA is comparable to those of some DNA intercalative polypyridyl Ru(II) complexes 1.0 ?4.8 × 104 M?1. CD study showed stabilization of the right-handed B form of DNA in the presence of Zn(II) complex as observed for the classical intercalator methylene blue. Thermodynamic parameters (ΔH < 0 and ΔS < 0) indicated that hydrogen bond and Van der Waals play main roles in this binding prose. Competitive fluorimetric studies with methylene blue (MB) dye have shown that Zn(II) complex exhibits the ability of this complex to displace with DNA-MB, indicating that it binds to DNA in strong competition with MB for the intercalation. 相似文献
13.
Yiqun Geng Amit Kumar Hassan M. Faidallah Hassan A. Albar Ibrahim A. Mhkalid Richard R. Schmidt 《Bioorganic & medicinal chemistry》2013,21(16):4793-4802
Several C-(α-d-glucopyranosyl)-phenyldiazomethanes, with different substituent groups at the para-position of the phenyl ring, were prepared. The stabilities of these diazo compounds were investigated through NMR and UV monitoring. The para-cyano substituted diazo compound was found to be stable in neutral media (pH 7.0 buffer) and could be isolated. Inhibitory activity investigations indicated that this compound is an irreversible inhibitor against α-glucosidase from Saccharomyces cerevisiae. 相似文献
14.
15.
Rui Wang Hong-Fan Shi Jing-Feng Zhao Yan-Ping He Hong-Bin Zhang Jian-Ping Liu 《Bioorganic & medicinal chemistry letters》2013,23(6):1760-1762
A series of novel indole-imidazole derivatives have been prepared and evaluated in vitro on the aromatase inhibitory activities. The results suggested that proton or a small electron-withdrawing group at para-position of the phenyl ring would enhance the inhibitory activities and any bulky group should be avoided in order to keep a relative small volume for this kind of molecules. 相似文献
16.
A. Kosiha C. Parthiban Samuele Ciattini Laura Chelazzi 《Journal of biomolecular structure & dynamics》2013,31(16):4170-4181
Protein binding, DNA binding/cleavage and in vitro cytotoxicity studies of 2-((3-(dimethylamino)propyl)amino)naphthalene-1,4-dione (L) and its four coordinated M(II) complexes [M(II) = Co(II), Cu(II), Ni(II) and Zn(II)] have been investigated using various spectral techniques. The structure of the ligand was confirmed by spectral and single crystal XRD studies. The geometry of the complexes has been established using analytical and spectral investigations. These complexes show good binding tendency to bovine serum albumin (BSA) exhibiting high binding constant values (105 M?1) when compared to free ligand. Fluorescence titration studies reveal that these compounds bind strongly with CT-DNA through intercalative mode (Kapp 105 M?1) and follow the order: Cu(II) > Zn(II) > Ni(II) > Co(II) > L. Molecular docking study substantiate the strength and mode of binding of these compounds with DNA. All the complexes efficiently cleaved pUC18-DNA via hydroxyl radical mechanism and the Cu(II) complex degraded the DNA completely by converting supercoiled form to linear form. The complexes demonstrate a comparable in vitro cytotoxic activity against two human cancer cell lines (MCF-7 and A-549), which is comparable with that of cisplatin. AO/EB and DAPI staining studies suggest apoptotic mode of cell death, in these cancer cells, with the compounds under investigation. 相似文献
17.
Simone A. Baechler Markus Fehr Michael Habermeyer Andreas Hofmann Karl-Heinz Merz Heinz-Herbert Fiebig Doris Marko Gerhard Eisenbrand 《Bioorganic & medicinal chemistry》2013,21(3):814-823
The plant alkaloid lycobetaine has potent topoisomerase-targeting properties and shows anticancer activity. Based on these findings, several lycobetaine analogs were synthesized mainly differing in their substituents at 2, 8 and 9 position and their biological activities were evaluated. The topoisomerase-targeting properties and cytotoxicity of these structural analogs were assessed in the human gastric carcinoma cell line GXF251L. Performing a plasmid relaxation assay, an increased inhibition of topoisomerase I was found with N-methylphenanthridinium chlorides bearing a 8,9-methylenedioxy moiety or a methoxy group in 2-position. Furthermore, quaternized phenanthridinium derivatives bearing either a 2-methoxy or a 8,9-methylenedioxy moiety in conjunction with a 2-hydroxy or 2-methoxy group display potent topoisomerase II inhibition as shown by decatenation of kinetoplast DNA. In general, the N-methylphenanthridinium chlorides possess more potency in inhibiting topoisomerase I than topoisomerase II. All quaternized derivatives also exhibited potent inhibition of tumor cell growth in the low micromolar concentration range. Hence, N-methylphenanthridinium compounds were found to represent a promising class of compounds, potently inhibiting both, topoisomerases I and II, and may be further developed into clinically useful topoisomerase inhibitors. 相似文献
18.
A S Lewis 《Archives of biochemistry and biophysics》1978,190(2):662-670
Rabbit brain purine nucleoside phosphorylase used in this study was purified 6000-fold to apparent homogeneity and a specific activity or 50 μmol min?1 mg ?1 protein. A molecular weight of 70.000 daltons was determined for the native enzyme by gel filtration on Sephadex. Electrophoresis on polyacrylamide gel, in presence of sodium dodecyl sulfate, gave a subunit molecular weight of 34,500 daltons, suggesting that the enzyme is dimeric with, probably, identical subunits. The relationship of the structure of certain biologically active substances to their inhibitory action on the enzyme was examined. Folic acid and the compound d,l-6-methyl 5,6,7,8-tetrahydropterine, with similar substituents on their primary ring structure, were competitive inhibitors of the enzyme. The inhibition constants calculated were 3.37 × 10?5M for folic acid and 3.80 × 10?5m for d,l-6-methyl 5,6,7,8-tetrahydropterine. Aminopterin and the purine analog 8-aza-2,6-diaminopurine, with similar substituents on their primary ring structure, were noncompetitive inhibitors of the enzyme. Their respective inhibition constants were 1.50 × 10?4 and 1.95 × 10?4m. Erythro-9-(2-hydroxy-3-nonyl) adenine, an adenosine deaminase inhibitor, was also examined for inhibitory potency with mammalian purine nucleoside phosphorylase, and was observed to be a competitive inhibitor of this enzyme, with an inhibition constant of 1.90 × 10?4m. The Michaelis constant for the substrate guanosine was near 6.0 × 10?5m. Physical probe of the nature of the functional groups which participate in enzymic catalysis implicated both histidine and cysteine as the essential catalytic species. Photooxidation studies suggested a pH-dependent sensitivity of an essential catalytic group, and its probable location at the active site. 相似文献
19.
Abstract— The association of 125 I-diiodo-Beta nerve growth factor with bovine serum albumin (BSA), as well as with the Gamma and Alpha subunits of the 7S nerve-growth factor (NGF) macromolecule are described. In the absence of added protein, the stable thermodynamic state for Beta (pH 7.4) at concentrations below 10?7 M is absorbed to the walls of the reaction vessel. Above 10?7 M the sites on the wall of the reaction vessel begin to saturate, and Beta is found free in solution. Addition of other soluble proteins to the system (i.e. BSA, Alpha and Gamma) causes a displacement of the Beta from the walls of the reaction vessel. This displacement is the result of the binding of the Beta to the added soluble protein. The binding of Beta to BSA is a complex function of BSA concentration, suggesting multiple sets of sites and/or cooperative interactions. In contrast, the characteristics of the association of Beta with Gamma and Alpha indicate an interaction between discrete sets of sites on the respective polypeptide chains. The Beta-Gama association is a bimolecular association with an apparent first thermodynamic association constant of 6.25 × 105M?1. The association between Beta and Alpha is also bimolecular and has an apparent first thermodynamic association constant of 2.0 × 105M?1. In addition, dissociation studies suggest that the Gamma-Beta complex binds Alpha with a substantially higher affinity than does Beta or Gamma alone. These data strongly support the conclusion that there is a unique biologically determined relationship among these polypeptides. The data are discussed with respect to the experimental use of Beta NGF. A new operational paradigm for the controlled use of the Beta NGF is presented. This approach is based on the use of a thermodynamically stabilized 7S complex and the analysis of relative apparent affinities. 相似文献
20.
Urmila Saha Asma Yasmeen Khan Sutanwi Bhuiya Suman Das Gaetano Fiorillo Paolo Lombardi 《Journal of biomolecular structure & dynamics》2019,37(6):1375-1389
Study on bioactive molecules, capable of stabilizing G-Quadruplex structures is considered to be a potential strategy for anticancer drug development. Berberrubine (BER) and two of its analogs bearing alkyl phenyl and biphenyl substitutions at 13-position were studied for targeting human telomeric G-quadruplex DNA sequence. The structures of berberrubine and analogs were optimized by density functional theory (DFT) calculations. Time-dependent DFT (B3LYP) calculations were used to establish and understand the nature of the electronic transitions observed in UV–vis spectra of the alkaloid. The interaction of berberrubine and its analogs with human telomeric G-quadruplex DNA sequence 5′-(GGGTTAGGGTTAGGGTTAGGG)-3′ was investigated by biophysical techniques and molecular docking study. Both the analogs were found to exhibit higher binding affinity than natural precursor berberrrubine. 13-phenylpropyl analog (BER1) showed highest affinity [(1.45 ± 0.03) × 105 M?1], while the affinity of the 13-diphenyl analog (BER2) was lower at (1.03 ± 0.05) × 105 M?1, and that of BER was (0.98 ± 0.03) × 105 M?1. Comparative fluorescence quenching studies gave evidence for a stronger stacking interaction of the analog compared to berberrubine. The thiazole orange displacement assay has clearly established that the analogs were more effective in displacing the end stacked dye in comparison to berberrubine. Molecular docking study showed that each alkaloid ligand binds primarily at the G rich regions of hTelo G4 DNA which makes them G specific binder towards hTelo G4 DNA. Isothermal titration calorimetry studies of quadruplex–berberrubine analog interaction revealed an exothermic binding that was favored by both enthalpy and entropy changes in BER in contrast to the analogs where the binding was majorly enthalpy dominated. A 1:1 binding stoichiometry was revealed in all the systems. This study establishes the potentiality of berberrubine analogs as a promising natural product based compounds as G-quadruplex-specific ligands. 相似文献