Development of a random amplification of polymorphic DNA typing method for Listeria monocytogenes.

The 10-mer primer OPM-01 (5'-GTT GGT GGC T-3') was used to generate random amplification of polymorphic DNA (RAPD) profiles by polymerase chain reaction for 91 strains of Listeria monocytogenes from raw milk, food, and veterinary, medical, and food-environmental sources. The profiles obtained contained 1 to 10 bands within the molecular size range of 0.5 to 5.0 kbp. Reproducibility was enhanced by annealing at low stringency and introducing a 1-min ramp time between annealing and extension temperatures. Thirty-three RAPD profiles were observed, with specific profiles being observed for strains from each source. RAPD profiles allowed discrimination within serogroups, although five RAPD profiles which were not confined to one serotype were found. Within food strains, one RAPD profile was more common than others, suggesting this to be a common type among strains from this source.     

Species-specific detection of Listeria monocytogenes by DNA amplification

The polymerase chain reaction was used to detect and specifically identify Listeria monocytogenes. A 174-bp region of the listeriolysin O gene was shown to be specifically amplified in L. monocytogenes but not in other species of Listeria or in a number of other gram-positive and gram-negative organisms. Less than 50 organisms could routinely be detected by a procedure involving two rounds of 35 amplification cycles each and without the need for subsequent hybridization with labeled probes.     

Species-specific detection of Listeria monocytogenes by DNA amplification.

The polymerase chain reaction was used to detect and specifically identify Listeria monocytogenes. A 174-bp region of the listeriolysin O gene was shown to be specifically amplified in L. monocytogenes but not in other species of Listeria or in a number of other gram-positive and gram-negative organisms. Less than 50 organisms could routinely be detected by a procedure involving two rounds of 35 amplification cycles each and without the need for subsequent hybridization with labeled probes.     

Differentiation of Listeria monocytogenes and Listeria innocua by 16S rRNA genes and intraspecies discrimination of Listeria monocytogenes strains by random amplified polymorphic DNA polymorphisms.

Differences in the 16S rRNA genes (16S rDNA) which can be used to discriminate Listeria monocytogenes from Listeria innocua have been detected. The 16S rDNA were amplified by polymerase chain reaction with a set of oligonucleotide primers which flank a 1.5-kb fragment. Sequence differences were observed in the V2 region of the 16S rDNA both between L. monocytogenes Scott A and L. innocua and between different L. monocytogenes serotypes. Although L. monocytogenes SLCC2371 had the same V2 region sequence as L. innocua, the two species were different within the V9 region at nucleotides 1259 and 1292, in agreement with previous studies (R.-F. Wang, W.-W. Cao, and M.G. Johnson, Appl. Environ. Microbiol. 57:3666-3670, 1991). Intraspecies discrimination of L. monocytogenes strains was achieved by using the patterns generated by random amplified polymorphic DNA primers. Although some distinction can be made within the L. monocytogenes species by their 16S rDNA sequence, a far greater discrimination within species could be made by generating random amplified polymorphic DNA patterns from chromosomal DNA. By using a number of 10-bp primers, unique patterns for each isolate which in all cases examined differentiate between various L. monocytogenes serotypes, even though they may have the same 16S rRNA sequences, could be generated.     

High pressure response of fruit jams contaminated with Listeria monocytogenes

High pressure is an alternative to thermal processing and is used to preserve food. Listeria monocytogenes is a bacterium which grows at low temperature, is able to multiply under vacuum, and is responsible for food poisoning. Pressures of 100, 200, 300 and 400 MPa were used for 5, 10 and 15 min at 20 degrees C on pure culture, and on apple and plum jam baby food artificially contaminated with Listeria. Pure culture was also to test pressures of 200, 300, 350 and 400 MPa at 5 degrees C for 30 min. The results were analysed statistically and showed that there were no significant differences between pressures of 100 and 200 MPa at 5, 10 and 15 min. However, at 300 MPa, there were significant differences at 15 min. When the pressure treatment was 400 MPa, significant differences were observed at pressure times of 5, 10 and 15 min. The results were fitted to a linear curve. In pure culture, no viable cells were detected after high pressure treatment of 350 MPa for 30 min at 5 degrees C. The use of low temperature helps to maintain the sensory properties of the product.     

Characterization of Listeria monocytogenes isolated from poultry products and from the poultry-processing environment by random amplification of polymorphic DNA and multilocus enzyme electrophoresis.

A total of 289 Listeria monocytogenes strains isolated from a poultry-processing environment and poultry products over a 6-month period were characterized by random amplification of polymorphic DNA, (RAPD) to pinpoint sources of contamination within the plant and gain some measure of the persistence of individual genotypes within this environment. Eighteen RAPD profiles (A through R) were identified within this group, with 64% (184 of 289) of all strains displaying a single RAPD profile, RAPD type A. This genotype was more prevalent in the raw-poultry-processing environment, where, although its origin within this environment appeared to be the incoming birds, it was also widespread on food contact surfaces, floors, and drains. This was the only genotype which persisted throughout the entire 6-month period, and it and RAPD type B were the only two genotypes found in both the raw- and cooked-poultry-processing environments. L. monocytogenes strains isolated from cooked poultry products and the cooked-poultry-processing environment up to 1 year later (17 strains) contained only RAPD types A and B, highlighting the potential which exists for persistent strains to cross-contaminate foods processed in that environment. The other genotypes (C through R) occurred more sporadically, suggesting varied sources of contamination. These were confined to either the raw- or the cooked-poultry-processing environment and were relatively short-lived. Further characterization of a selection of RAPD type A strains, together with strains of RAPD types B through R, was carried out by multilocus enzyme electrophoresis. Strains of RAPD type A contained two electrophoretic types, one of which was serotype 1/2a and the other was 1/2c.(ABSTRACT TRUNCATED AT 250 WORDS)     

Random amplification of polymorphic DNA with conserved sequences reveals genome-specific monomorphic amplicons: Implications in clad identification

The enzymatic amplification of genomic DNA with an arbitrary primer generates informative band profile useful for genome analysis. We used a set of synthetic oligodeoxyribonucleotide primers OAT15.2 (GACA)_3.75, OAT18. 2 (GACA)_4.5, OAT24.2 (GACA)₆, OAT36 (GACA)₉, comprising 4–9 consecutive units of GACA repeat, O33.15 (CACCTCTCCACCTGCC) and 033.6 (CCTCCAGCCCTCCTCCAGCCCT) for RAPD reactions of genomic DNA from different sources. The GACA based oligos of 15 and 18 base residues generated discernible genome specific amplicons whereas primers larger than 18 bases revealed smeary signals. The other oligos O33.15 and O33.6 also generated genome specific amplicons with more bands compared with those obtained from OAT15.2 or OAT18.2. The presence of OAT15.1 (GATA)_3.75 and OAT15.2 (GACA)_3.75 sequences in different genomes were ascertained by independent dot-blot hybridization prior to using them for RAPD reactions. The RAPD amplicons generated by evolutionarily conserved primer(s) or sequences shared by many species may be useful for clad identification in controversial systematics, comparative genome analysis, and for establishing the phylogenetic status of an organism.     

Combined Ribotyping and Random Multiprimer DNA Analysis To Probe the Population Structure of Listeria monocytogenes

To improve our understanding of the genetic links between strains originating from food and strains responsible for human diseases, we studied the genetic diversity and population structure of 130 epidemiologically unrelated Listeria monocytogenes strains. Strains were isolated from different sources and ecosystems in which the bacterium is commonly found. We used rRNA gene restriction fragment length polymorphism analysis with two endonucleases and random multiprimer DNA analysis with seven oligonucleotide primers to study multiple genetic features of each strain. We used three clustering methods to identify genetic links between individual strains and to determine the precise genetic structure of the population. The combined results confirmed that L. monocytogenes strains can be divided into two major phylogenetic divisions. The method used allowed us to demonstrate that the genetic structure and diversity of the two phylogenetic divisions differ. Division I is the most homogeneous and can easily be divided into subgroups with dissimilarity distances of less than 0.30. Each of these subgroups mainly, or exclusively, contains a single serotype (1/2b, 4b, 3b, or 4a). The serotype 4a lineage appears to form a branch that is highly divergent from the phylogenetic group containing serotypes 1/2b, 4b, and 3b. Division II contains strains of serotypes 1/2a, 1/2c, and 3a. It exhibits more genetic diversity with no peculiar clustering. The fact that division II is more heterogeneous than division I suggests that division II evolved from a common ancestor earlier than division I. A significant association was found between division I and human strains, suggesting that strains from division I are better adapted to human hosts.     

Prevention of allograft tolerance by bacterial infection with Listeria monocytogenes

Exposure to certain viruses and parasites has been shown to prevent the induction of transplantation tolerance in mice via the generation of cross-reactive memory T cell responses or the induction of bystander activation. Bacterial infections are common in the perioperative period of solid organ allograft recipients in the clinic, and correlations between bacterial infections and acute allograft rejection have been reported. However, whether bacterial infections at the time of transplantation have any effect on the generation of transplantation tolerance remains to be established. We used the Gram-positive intracellular bacterium Listeria monocytogenes (LM) as a model pathogen because its effects on immune responses are well described. Perioperative LM infection prevented cardiac and skin allograft acceptance induced by anti-CD154 and donor-specific transfusion in mice. LM-mediated rejection was not due to the generation of cross-reactive T cells and was largely independent of signaling via MyD88, an adaptor for most TLRs, IL-1, and IL-18. Instead, transplant rejection following LM infection was dependent on the expression of the phagosome-lysing pore former listeriolysin O and on type I IFN receptor signaling. Our results indicate that bacterial exposure at the time of transplantation can antagonize tolerogenic regimens by enhancing alloantigen-specific immune responses independently of the generation of cross-reactive memory T cells.     

Estimation of microbial contamination of food from prevalence and concentration data: application to Listeria monocytogenes in fresh vegetables

A normal distribution and a mixture model of two normal distributions in a Bayesian approach using prevalence and concentration data were used to establish the distribution of contamination of the food-borne pathogenic bacteria Listeria monocytogenes in unprocessed and minimally processed fresh vegetables. A total of 165 prevalence studies, including 15 studies with concentration data, were taken from the scientific literature and from technical reports and used for statistical analysis. The predicted mean of the normal distribution of the logarithms of viable L. monocytogenes per gram of fresh vegetables was -2.63 log viable L. monocytogenes organisms/g, and its standard deviation was 1.48 log viable L. monocytogenes organisms/g. These values were determined by considering one contaminated sample in prevalence studies in which samples are in fact negative. This deliberate overestimation is necessary to complete calculations. With the mixture model, the predicted mean of the distribution of the logarithm of viable L. monocytogenes per gram of fresh vegetables was -3.38 log viable L. monocytogenes organisms/g and its standard deviation was 1.46 log viable L. monocytogenes organisms/g. The probabilities of fresh unprocessed and minimally processed vegetables being contaminated with concentrations higher than 1, 2, and 3 log viable L. monocytogenes organisms/g were 1.44, 0.63, and 0.17%, respectively. Introducing a sensitivity rate of 80 or 95% in the mixture model had a small effect on the estimation of the contamination. In contrast, introducing a low sensitivity rate (40%) resulted in marked differences, especially for high percentiles. There was a significantly lower estimation of contamination in the papers and reports of 2000 to 2005 than in those of 1988 to 1999 and a lower estimation of contamination of leafy salads than that of sprouts and other vegetables. The interest of the mixture model for the estimation of microbial contamination is discussed.     

Heteroduplex mobility assay for the identification of Listeria sp and Listeria monocytogenes strains: application to characterisation of strains from sludge and food samples

One hundred and ten Listeria sp. isolates from sewage sludge were identified according to phenotypic and genotypic methods. The Listeria sp. strains isolated from five types of sludge from three sewage treatment plants in Angers (France) and the surrounding area included L. monocytogenes (55.5%), L. innocua (29.1%), L. seeligeri (13.6%) and L. welshimeri (1.8%). The majority of L. monocytogenes strains belonged to serotypes 4b, 1/2b and 1/2a. Moreover, a heteroduplex mobility assay based on the 16S rRNA sequences was tested for its ability to identify the six species of the genus Listeria. This study, performed on 283 Listeria sp. strains from human, food and sewage sludge samples, showed that all the species were distinguishable from one another. L. innocua and L. seeligeri showed respectively three and two distinct banding patterns. Within L. monocytogenes, four groups (I-IV) were defined. The majority of food and environmental isolates were clustered in group I and it is noteworthy that group IV clustered epidemiologic isolates and strains belonging to serotypes 4b, 1/2a and 1/2b.     

Autophagy targeting of Listeria monocytogenes and the bacterial countermeasure

Autophagy acts as an intrinsic defense system against intracellular bacterial survival. Recently, multiple cellular pathways that target intracellular bacterial pathogens to autophagy have been described. These include the Atg5/LC3 pathway, which targets Shigella, the ubiquitin (Ub)-NDP52-LC3 pathway, which targets Group A Streptococcus (GAS) and Salmonella typhimurium, the Ub-p62-LC3 pathway, which targets Mycobacterium tuberculosis, Listeria monocytogenes and S. typhimurium, and the diacylglycerol-dependent pathway, which targets S. typhimurium. In addition, the bacterial invasion process is targeted by the NOD1 or NOD2-Atg16LLC3 pathway. Bacterial pathogens with an intracytosolic lifestyle, i.e., those capable of inducing actin polymerization and cell-to-cell spreading, also employ diverse tactics to evade autophagic recognition. Thus, Shigella, L. monocytogenes and Burkholderia pseudomallei deploy highly evolved systems to evade autophagic recognition and growth restriction. Here, we briefly review current knowledge of host recognition of L. monocytogenes by the innate immune system, and highlight how autophagic recognition by the host is overcome by bacterial countermeasures.     

Prevalence and growth of Listeria monocytogenes in naturally contaminated cold-smoked salmon

AIM: To investigate Listeria monocytogenes contamination and behaviour in naturally contaminated French cold-smoked salmon (CSS). METHOD AND RESULTS: Between 2001 and 2004, L. monocytogenes was detected in 104 of 1010 CSS packs, produced by nine French plants, with different prevalence (from 0% to 41%). The initial contamination, measured with a sensitive filtration method, was low (92% of contaminated products below 1 CFU g(-1)) and growth was limited. CONCLUSION: Growth was consistent with results of a predictive model including microbial competition. SIGNIFICANCE AND IMPACT OF THE STUDY: To be included in a quantitative risk assessment.     

Random amplification of polymorphic DNA (RAPD) of Salmonella: strain differentiation and characterization of amplified sequences

Random amplification of polymorphic DNA (RAPD) was evaluated for its ability to differentiate Salmonella strains from various sources. Under defined conditions RAPD using a 10-mer primer (1254) produced a series of amplification products able to reproducibly distinguish strains representing 20 different serotypes of Salmonella. Primer 1254 also proved capable of discrimination between some but not all isolates of Salm. ser. Enteritidis and Salm. ser. Typhimurium, phage typing proving to be most discriminatory for the latter serotype. Cloning of fragments into a vector allowed sequencing and database searching for identification of fragments and an indication of criteria for primer template interaction in RAPD. Southern blotting using a digoxigenin-labelled probe allowed identification of related bands between RAPD profiles. These observations demonstrate the potential of rapid molecular typing by RAPD for the genomic typing of Salmonella strains.     

Random amplified polymorphic DNA in cattle and sheep: application for detecting genetic variation

The present study investigated the use of the random amplified polymorphic DNA (RAPD) method to detect genetic variation in cattle and sheep. The animals studied consisted of samples from five Finnish cattle breeds: native Eastern (18 animals), Northern (24), Western Finncattle (24), Finnish Ayrshire (24), and Finnish Friesian (18); as well as a white (6 animals) and a grey (9) colour type of Finnsheep. The cattle and sheep populations were analysed with 11 and 13 RAPD primers demonstrating the most repeatable amplification pattern. Two out of ten RAPD fragments tested by cross hybridization showed homology between the two species. The RAPD method did not prove efficient for finding new polymorphisms in either species, because we found only three polymorphic RAPD markers for cattle and seven markers for sheep with different allele frequencies between the breeds. Although there is a greater presence of polymorphic RAPD markers in sheep, according to the similarity indices the sheep populations showed a higher degree of homogeneity than the cattle breeds. However, the interbreed and intrabreed similarity indices for cattle did not suggest any significant differentiation of the Finnish breeds, contrary to earlier results based on blood group and protein polymorphism.     

Random DNA fragmentation with endonuclease V: application to DNA shuffling

The enzyme endonuclease V nicks uracil-containing DNA at the second or third phosphodiester bond 3′ to uracil sites. I applied the enzyme to random fragmentation of DNA to revise the complex DNA shuffling protocol. The merit of using endonuclease V is that cleavage occurs at random sites and the length of the fragments can easily be adjusted by varying the concentration of dUTP in the polymerase chain reaction. Unlike the conventional method using DNase I, no partial digestion or gel separation of fragments is required. Therefore, labor is dramatically reduced and reproducibility ensured. I applied this method to recombine two truncated green fluorescent protein (GFP) genes and demonstrated successful DNA shuffling by the appearance of the fluorescent full-length GFP genes.     

Development and application of a simple loop-mediated isothermal amplification method on rapid detection of Listeria monocytogenes strains

A loop-mediated isothermal amplification (LAMP) method for rapid detection of the food-borne L. monocytogenes strains had been developed and evaluated in this study. The optimal reaction condition was 65°C for 45 min, with the detection limit as 1 pg DNA/tube and 100 CFU/reaction. Application of the established LAMP assay was performed on 182 food-borne L. monocytogenes strains using a rapid procedure and easy result confirmation, with the sensitivity of LAMP versus PCR assays as 96.7% (176/182) and 91.2% (166/182), respectively; with 100% specificity, positive predictive value (PPV) and negative predictive value (NPV) for both assays.     

Sensitive and isothermal electrochemiluminescence gene-sensing of Listeria monocytogenes with hyperbranching rolling circle amplification technology

Listeria monocytogenes (L. monocytogenes) is one of the most problematic human pathogens, as it is mainly transmitted through the food chain and cause listeriosis. Thus, specific and sensitive detection of L. monocytogenes is required to ensure food safety. In this study, we proposed a method using hyperbranching rolling circle amplification (HRCA) combined with magnetic beads based electrochemiluminescence (ECL) to offer an isothermal, highly sensitive and specific assay for the detection of L. monocytogenes. At first, a linear padlock probe was designed to target a specific sequence in the hly gene which is specific to L. monocytogenes and then ligated by Taq DNA ligase. After ligation and digestion, further amplification by HRCA with a biotiny labeled primer and a tris (bipyridine) ruthenium (TBR) labeled primer was performed. The resulting HRCA products were then captured onto streptavidin-coated paramagnetic beads and were analyzed by magnetic beads based ECL platform to confirm the presence of targets. Through this approach, as low as 10 aM synthetic hly gene targets and about 0.0002 ng/μl of genomic DNA from L. monocytogenes can be detected, the ability to detect at such ultratrace levels could be attributed to the powerful amplification of HRCA and the high sensitivity of current magnetic bead based ECL detection platform.     

Prevalence and lineages of Listeria monocytogenes in Chinese food products

AIMS: This study was undertaken to investigate the prevalence and lineages of Listeria monocytogenes in different kinds of food products in local Chinese markets. METHODS AND RESULTS: A total of 2686 food samples and 645 water samples were collected and L. monocytogenes was isolated from 2.28% (76 of 3331) of all samples. The prevalence of L. monocytogenes (14 of 290, 4.83%) in raw meat products was significantly higher than that in other raw food products (P < 0.05). Among 844 ready-to-eat (RTE) food samples, 21 samples were positive for L. monocytogenes. RTE packaged food products from two supermarkets had a prevalence ranging from 0.00% to 25.00%. The prevalence of L. monocytogenes in meat products of freshly slaughtered hogs was 0.95% (four of 420), significantly lower than that in raw meat products in the retail markets (P < 0.05). Ten isolates were recovered from 645 water samples, which were collected after hands washing by shopkeepers or waiters. A total of 38 isolates were randomly selected for lineage classification based on the nucleotide variation of actA gene. Eighty percentage of isolates from RTE food products belonged to Lineage II while only 20% belonged to Lineage I. CONCLUSIONS: Food products in Chinese markets are contaminated with L. monocytogenes. Raw meat products have the highest contamination rates among all the raw food samples. RTE food products are more likely to be contaminated with Lineage II strains. SIGNIFICANCE AND IMPACT OF THE STUDY: The data presented here show the main contamination sources of L. monocytogenes in Chinese food products.     

Simple method to observe the adaptive response of Listeria monocytogenes in food

A simple, novel method for determining stress-adaptive response of Listeria monocytogenes in food systems is presented. The method involves plating samples on Listeria-selective agar (LSA) acidified to pH 5.25 with incubation at 36 degrees C for 60 h to detect acid adaptation and plating on LSA with 70 gl-1 NaCl and incubation at 7 degrees C for 7 d to detect cold-osmotic adaptation. Adapted cells produced larger colonies (> 1 mm) under these conditions than unadapted cells. Scot A (97%) and Brie-1 (100%) cells incubated in milk at pH 5 for 3 h manifested the acid-adapted colony type compared with 6% and 21% of viable cells in the unstressed control population. After a 5-d adaptation period at 4 degrees C in milk with 80 gl-1 salt, 29% of Scot A and 91% of Brie-1 viable cells exhibited the adapted colony type compared with < 1% of the unstressed control population. Stress-adapted L. monocytogenes were isolated from soft cheese held for 42 d at 10 C.