Studies of He-T DNA sequences in the pericentric regions of Drosophila chromosomes

He-T DNA is a complex set of repeated DNA sequences with sharply defined locations in the polytene chromosomes of Drosophila melanogaster. He-T sequences are found only in the chromocenter and in the terminal (telomere) band on each chromosome arm. Both of these regions appear to be heterochromatic and He-T sequences are never detected in the euchromatic arms of the chromosomes (Young et al. 1983). In the study reported here, in situ hybridization to metaphase chromosomes was used to study the association of He-T DNA with heterochromatic regions that are under-replicated in polytene chromosomes. Although the metaphase Y chromosome appears to be uniformly heterochromatic, He-T DNA hybridization is concentrated in the pericentric region of both normal and deleted Y chromosomes. He-T DNA hybridization is also concentrated in the pericentric regions of the autosomes. Much lower levels of He-T sequences were found in pericentric regions of normal X chromosomes; however compound X chromosomes, constructed by exchanges involving Y chromosomes, had large amounts of He-T DNA, presumably residual Y sequences. The apparent co-localization of He-T sequences with satellite DNAs in pericentric heterochromatin of metaphase chromosomes contrasts with the segregation of satellite DNA to alpha heterochromatin while He-T sequences hybridize to beta heterochromatin in polytene nuclei. This comparison suggests that satellite sequences do not exist as a single block within each chromosome but have interspersed regions of other sequences, including He-T DNA. If this is so, we assume that the satellite DNA blocks must associate during polytenization, leaving the interspersed sequences looped out to form beta heterochromatin. DNA from D. melanogaster has many restriction fragments with homology to He-T sequences. Some of these fragments are found only on the Y. Two of the repeated He-T family restriction fragments are found entirely on the short arm of the Y, predominantly in the pericentric region. Under conditions of moderate stringency, a subset of He-T DNA sequences cross-hybridizes with DNA from D. simulans and D. miranda. In each species, a large fraction of the cross-hybridizing sequences is on the Y chromosome.     

A repetitive DNA element,associated with telomeric sequences in Drosophila melanogaster,contains open reading frames

He-T sequences are a complex repetitive family of DNA sequences in Drosophila that are associated with telomeric regions, pericentromeric heterochromatin, and the Y chromosome. A component of the He-T family containing open reading frames (ORFs) is described. These ORF-containing elements within the He-T family are designated T-elements, since hybridization in situ with the polytene salivary gland chromosomes results in detectable signal exclusively at the chromosome tips. One T-element that has been sequenced includes ORFs of 1,428 and 1,614 bp. The ORFs are overlapping but one nucleotide out of frame with respect to each other. The longer ORF contains cysteine-histidine motifs strongly resembling nucleic acid binding domains of gag-like proteins, and the overall organization of the T-element ORFs is reminiscent of LINE elements. The T-elements are transcribed and appear to be conserved in Drosophila species related to D. melanogaster. The results suggest that T-elements may play a role in the structure and/or function of telomeres.by W. Hennig     

Molecular Cloning of α-Amylase Genes from DROSOPHILA MELANOGASTER. I. Clone Isolation by Use of a Mouse Probe

A cloned alpha-amylase cDNA sequence from the mouse is homologous to a small set of DNA sequences from Drosophila melanogaster under appropriate conditions of hybridization. A number of recombinant lambda phage that carry homologous Drosophila genomic DNA sequences were isolated using the mouse clone as a hybridization probe. Putative amylase clones hybridized in situ to one or the other of two distinct sites in polytene chromosome 2R and were assigned to one of two classes, A and B. Clone lambda Dm32, representing class A, hybridizes within chromosome section 53CD. Clone lambda Dm65 of class B hybridizes within section 54A1-B1. Clone lambda Dm65 is homologous to a 1450- to 1500-nucleotide RNA species, which is sufficiently long to code for alpha-amylase. No RNA homologous to lambda Dm32 was detected. We suggest that the class B clone, lambda Dm65, contains the functional Amy structural gene(s) and that class A clones contain an amylase pseudogene.     

Localization and characterization of recombinant DNA clones derived from the highly repetitive DNA sequences in the Indian muntjac cells: their presence in the Chinese muntjac

A total of seven, highly repeated, DNA recombinant M13 mp8 clones derived from a Hpa II digest of cultured cells of the Indian muntjac (Muntiacus muntjac vaginalis) were analyzed by restriction enzymes, in situ hybridization, and DNA sequencing. Two of the clones, B1 and B8, contain satellite DNA inserts which are 80% homologous in their DNA sequences. B1 contains 781 nucleotides and consist of tandem repetition of a 31 bp consensus sequence. This consensus sequence, TCCCTGACGCAACTCGAGAGGAATCCTGAGT, has only 3 bp changes, at positions 7, 24, and 27, from the consensus sequence of the 31 bp subrepeats of the bovine 1.715 satellite DNA. The satellite DNA inserts in B1 and B8 hybridize primarily but not specifically to chromosome X, and secondarily to other sites such as the centromeric regions of chromosomes 1 and 2. Under less stringent hybridization conditions, both of them hybridize to the interior of the neck region and all other chromosomes (including chromosomes 3 and Y). The other five DNA clones contain highly repetitive, interdispersed DNA inserts and are distributed throughout the genome except for the neck region of the compound chromosome X+3. Blot hybridization results demonstrate that the satellite DNA component is also present in Chinese muntjac DNA (Muntiacus reevesi) in spite of the very different karyotypes of the Chinese and Indian muntjacs.     

Extensive DNA sequence homologies between the human Y and the long arm of the X chromosome.

It has been proposed that sequence homology should exist between the short arms of the human sex chromosomes, in the regions pairing at meiosis. Out of 40 clones picked at random from a collection of non-repetitive DNA sequences derived from the human Y chromosome, we have found nine sequences which show very high homology with sequences located on the X chromosome. All nine probes originate from the euchromatic part of the Y chromosome. All the homologous sequences are located within the Xq12-Xq22-24 region. None of them map to the short arm of the X chromosome. We conclude that an important part of the euchromatic region of the Y chromosome is homologous to the middle of the X chromosome long arm, possibly as a result of recent translation event(s).     

Transposable elements map in a conserved pattern of distribution extending from beta-heterochromatin to centromeres in Drosophila melanogaster

In situ hybridisation to mitotic chromosomes shows that sequences homologous to different Drosophila melanogaster transposable elements are widely distributed not only in beta but also in alpha-heterochromatin. Clusters of these sequences are detected in most proximal positions. They colocalise with known satellite sequences in several regions, but are also located in places where no known sequence has been mapped so far. The pattern of hybridisation is dinstinctive and specific for each element, and presents constant features in six different D. melanogaster strains studied. The entirely heterochromatic Y chromosome contains large amounts of these sequences. Additionally, some of these sequences appear to be present in substantial quantities in the smallest minichromosome of Drosophila, Dp(1;f)1187.     

A DNA fragment from the human X chromosome short arm which detects a partially homologous sequence on the Y chromosomes long arm.

An X linked human DNA fragment (named DXS31 ) which detects partially homologous sequences on the Y chromosome has been isolated. Regional localisation of the two sex linked sequences was determined using a panel of rodent-human somatic cell hybrids. The X specific sequence is located at the tip of the short arm ( Xp22 .3-pter), i.e. within or close to the region which pairs with the Y chromosome short arm at meiosis. However the Y specific sequence is located in the heterochromatic region of the long arm ( Yq11 -qter) and lies outside from the pairing region. DNAs from several XX male subjects were probed with DXS31 and in all cases a double dose of the X linked fragment was found, and the Y specific fragment was absent. DXS31 detects in chimpanzee a male-female differential pattern identical to that found in man. However results obtained in a more distantly related species, the brown lemur, suggest that the sequences detected by DXS31 in this species might be autosomally coded. The features observed with these X-Y related sequences do not fit with that expected from current hypotheses of homology between the pairing regions of the two sex chromosomes, nor with the pattern observed with other X-Y homologous sequences recently characterized. Our results suggest also that the rule of conservation of X linkage in mammals might not apply to sequences present on the tip of the X chromosome short arm, in bearing with the controversial issue of steroid sulfatase localisation in mouse.     

Y enriched and Y specific DNA sequences from the genome of the mediterranean fruit fly,Ceratitis capitata

DNA sequences that are enriched or specific to the genome of the male medfly, Ceratitis capitata, have been isolated using a differential hybridization approach. Twelve phage clones from a genomic library have been identified that consistently display more intense hybridization with a genomic DNA probe from males as opposed to one from females. Southern DNA blot analysis reveals that these recombinant clones contain at least one EcoRI fragment that is either specific to the male genome, or more highly represented in it, as compared with the female genome. These EcoRI fragments, when used as probes, all generate a similar pattern of intense multiple bands in genomic DNA of males. This suggests the presence of repetitive sequences that are at least partially homologous in these regions of the genome that are specific to or enriched in males. In situ hybridization to mitotic chromosomes confirms a Y chromosomal origin for the male specific repetitive sequences. Data on the genomic organization, representation and evolutionary conservation of these sequences that are specific to or enriched in males are presented. Studies of the genomic organization and representation of flanking sequences that are not male specific are presented as well.by R. Appels     

Specific recognition and differential affinity of meiotic X-Y pairing sites in Lucilia cuprina males (Diptera: Calliphoridae)

Meiotic pairing of X and Y chromosomes in male Lucilia cuprina was studied by cytological observation of normal, rearranged and deficient sex chromosome karyotypes in spermatogenesis. Two X-Y pairing regions located distally in each arm of the X and Y chromosomes were defined. Contrasting with findings in Drosophila melanogaster, these pairing regions show specific recognition of their partners. By studying rearranged sex chromosomes short arm pairing was localised to their distal ends, closely associated with secondary constrictions containing nucleolar organisers in both sex chromosomes. Short arm pairing is very tight and not greatly disrupted by chromosome rearrangement, deficiency for the Y chromosome long arm or the presence of supernumerary X chromosomes. The pairing region of the long arms could not be precisely localised but probably also occurs at their distal ends. Pairing between the long arm sites is much weaker and is easily disrupted by chromosome rearrangement, failing completely in flies deficient for the Y chromosome short arm. No cytologically visible pairing was seen between X chromosomes and the remainder of the Y. In males with an extra X chromosome, the ends of both X chromosomes pair to form multivalents with normal and rearranged Y chromosomes provided the Y short arm is present, otherwise an independent X chromosome bivalent is formed. The mechanism of pairing in male Lucilia sex chromosomes thus seems to depend on specific loci of distinctive structure within the X and Y heterochromatin. Comparison of cytological and genetic data shows that increasing cytological pairing failure is matched by higher genetic X-Y nondisjunction but that the former occurs at much higher levels. In some karyotypes cytologically observed X-Y pairing failure is not matched by high frequencies of nondisjunction presumably because weak pairing associations are disrupted during slide preparation.     

Cloning a fragment from the telomere of the long arm of human chromosome 9 in a YAC vector

The construction of a yeast artificial chromosome containing a human DNA insert is reported. This molecule of about 200 kb behaves as a native yeast chromosome since it has a very high mitotic stability and is present in the yeast transformant clone at a copy number similar to that of the resident chromosomes. Hybridization with the TTAGGG sequence demonstrates that this chromosome contains human telomeric sequences. In situ hybridization of the biotin-labelled artificial chromosome to metaphase human chromosomes shows that the insert occupies a telomeric position on the long arm of chromosome 9. Since the fragment was cloned as an EcoRI insert and not as a telomere, it is situated medially to the telomeric sequences and harbours telomere-associated sequences, that have been shown to contain the TTAGGG sequence. The fragment represents the end of the genetic map of chromosome 9 and thus can be used to characterize the sequence and the structure of the chromosomal region that runs from the end of the chromosome to the first gene.     

A Petunia hybrida chloroplast DNA region, close to one of the inverted repeats, shows sequence homology with the Euglena gracilis chloroplast DNA region that carries the putative replication origin

Summary Three distinct chloroplast (cp) DNA fragments from Petunia hybrida, which promote autonomous replication in yeast, were mapped on the chloroplast genome. Sequence analysis revealed that these fragments (called ARS A, B and C) have a high AT content, numerous short direct and inverted repeats and at least one yeast ARS consensus sequence 5A/TTTTATPuTTTA/T, essential for yeast ARS activity. ARS A and B also showed the presence of (semi-)conserved sequences, present in all Chlamydomanas reinhardii cpDNA regions that promote autonomous replication in yeast (ARS sequences) or in C. reinhardii (ARC sequences). A 431 bp BamHI/EcoRI fragment, close to one of the inverted repeats and adjacent to the ARS B subfragment contains an AT-rich stretch of about 100 nucleotides that show extensive homology with an Euglena gracilis cpDNA fragment which is part of the replication origin region. This conserved region contains direct and inverted repeats, stem-and-loop structures can be folded and it contains an ARS consensus sequence. In the near vicinity a GC-rich block is present. All these features make this cpDNA region the best candidate for being the origin of replication of P. hybrida cpDNA.     

Analysis of the chromocenter DNA composition in polytene chromosomes of <Emphasis Type="Italic">Drosophila orena</Emphasis> ovarian nurse cells

Chromocenter DNA fragments of polytene chromosomes of Drosophila orena ovarian nurse cells were cloned from a region-specific library (Dore1) in a plasmid vector to yield 133 clones. A total of 76 clones were selected and sequenced. The total length of the sequenced fragments was 23940 bp. Analysis with several software packages revealed various repetitive sequences among the fragments of the Dore1 library, including mobile genetic elements (25 fragments homologous to various LTR retrotransposons, five fragments homologous to LINEs, three fragments homologous to Helitrons, one fragment homologous to Polinton, and one fragment homologous to the mini-me non-LTR retrotransposon), four minisatellites, a satellite (SAR_DM), the (TATATG)n simple sequence repeat, and a low-complexity T-rich repeat. Sequences homologous to protein-coding genes were also found in the Dore1 library. Various repetitive DNA sequences and gene homologs were identified as conserved sequences of pericentric heterochromatin of polytene chromosomes of ovarian nurse cells in nine species of the melanogaster species subgroup.     

Meiosis in Drosophila males

The conjunctive mechanism of the XY bivalent is believed to differ from that of the autosomal bivalents in the achiasmate Drosophila melanogaster male. It has been proposed that hypothetical cohesive elements, termed collochores, hold the X and Y chromosomes together at or near their nucleolar organizing regions (NORs) and that collochores are not exhibited by autosomal bivalents. In electron micrographs, unique fibrillar material is observed between the X and Y chromosomes at the synaptic site. Recently, the 240 bp nontranscribed spacer associated with rRNA genes at the NOR has been implicated as the essential DNA sequence for XY pairing. To test whether this DNA sequence is always associated with XY pairing and to determine its relationship to the unique fibrillar material, we studied the XY bivalent in Drosophila simulans. The D. simulans Y chromosome has few, if any, rRNA genes, but does have a large block (3,000 kb or 12,500 copies) of the nontranscribed spacer repeat located at the distal end of its long arm. This is in contrast to the D. melanogaster Y, which has the repeat located among rRNA genes on its short arm. Using light and electron microscopy, we show that the X does indeed pair with the distal end of the long arm of the D. simulans Y. However, no fibrillar material is evident in serial thin sections of the D. simulans XY bivalent, suggesting that this material (in D. melanogaster) may be remnants of the NOR rather than a morphological manifestation of the hypothetical collochores. Indeed, in electron micrographs, the synaptic regions of the XY and autosomal bivalents appear similar with no obvious pairing structures, suggesting that the conjunctive mechanism holding homologous chromosomes together is the same for the XY and autosomal bivalents.     

Chromosomal location of Lg-FLO1 in bottom-fermenting yeast and the FLO5 locus of industrial yeast

Aims: To determine the chromosomal location and entire sequence of Lg-FLO1, the expression of which causes the flocculation of bottom-fermenting yeast. Methods and Results: Two cosmid clones carrying DNA from a bottom-fermenting yeast chromosome VIII right-arm end were selected by colony hybridization. Sequencing revealed that the clones contained DNA derived from a Saccharomyces cerevisiae type chromosome VIII and a Saccharomyces bayanus type chromosome VIII, both from bottom-fermenting yeast. Conclusions: Lg-FLO1 is located on the S. cerevisiae type chromosome VIII at the same position as the FLO5 gene of the laboratory yeast S. cerevisiae S288c. The unique chromosome VIII structure of bottom-fermenting yeast is conserved among other related strains. FLO5 and Lg-FLO1 promoter sequences are identical except for the presence of three 42 bp repeats in the latter, which are associated with gene activity. Flocculin genes might have been generated by chromosomal recombination at these repeats. Significance and Impact of the Study: This is the first report of the exact chromosomal location and entire sequence of Lg-FLO1. This information will be useful in the brewing industry for the identification of normal bottom-fermenting yeast. Moreover, variations in the FLO5 locus among strains are thought to reflect yeast evolution.     

Characterization and Comparative Analysis of DNA from the Pericentric Heterochromatin of Chromosome 2 of Anopheles atroparvus V. Tiel (Culicidae, Diptera)

The library containing DNA sequences from the diffuse pericentric heterochromatin from the right arm ofAnopheles atroparvus V. Tiel (Culicidae, Diptera) chromosome 2 (2R) was generated by use of chromosome microdissection technique. Southern-blot hybridization of the library fragments with the labeled genomic DNA of A. atroparvus and analysis of their primary structure showed that this heterochromatin region contained repeated DNA sequences differed by their primary structure and the number of copies. These were mostly AT-rich sequences harboring the features characteristic of the S/MAR regions. Based on the clones homology to the sequences from the A. gambiae and Drosophila melanogaster genomes, it was demonstrated that the pericentric heterochromatin from the right arm of A. atroparvus chromosome 2 contained gypsy-like transposable elements, as well as the sequences homologous to the structural genes. In situ hybridization with the chromosomes of A. atroparvus and of the two representatives of the Anopheles maculipennis species complex, A. messeae and A. beklemishevi, showed that pericentric regions of all these chromosomes contained DNA sequences homologous to the sequences from the region-specific library. Cloned fragments of conserved repetitive DNA revealed upon interspecific Southern-blot hybridization of the clones with the labeled genomic DNA of A. messeae can be utilized in further investigations of evolutionary rearrangements of the pericentric heterochromatin within the Anopheles maculipennis species complex.     

Defining the minimal length of sequence homology required for selective gene isolation by TAR cloning

The transformation-associated recombination (TAR) cloning technique allows selective and accurate isolation of chromosomal regions and genes from complex genomes. The technique is based on in vivo recombination between genomic DNA and a linearized vector containing homologous sequences, or hooks, to the gene of interest. The recombination occurs during transformation of yeast spheroplasts that results in the generation of a yeast artificial chromosome (YAC) containing the gene of interest. To further enhance and refine the TAR cloning technology, we determined the minimal size of a specific hook required for gene isolation utilizing the Tg.AC mouse transgene as a targeted region. For this purpose a set of vectors containing a B1 repeat hook and a Tg.AC-specific hook of variable sizes (from 20 to 800 bp) was constructed and checked for efficiency of transgene isolation by a radial TAR cloning. When vectors with a specific hook that was ≥60 bp were utilized, ~2% of transformants contained circular YACs with the Tg.AC transgene sequences. Efficiency of cloning dramatically decreased when the TAR vector contained a hook of 40 bp or less. Thus, the minimal length of a unique sequence required for gene isolation by TAR is ~60 bp. No transgene-positive YAC clones were detected when an ARS element was incorporated into a vector, demonstrating that the absence of a yeast origin of replication in a vector is a prerequisite for efficient gene isolation by TAR cloning.     

Synaptonemal complex of the sex-autosome trivalent in a male Indian muntjac

Bright-field microscopy of silver-stained pachytene spermatocytes of a male Indian muntjac, Muntiacus muntjak revealed that (a) the synapsis between the autosomal homologs, including the long arm of the X and Y₂, was normal, (b) the nucleolus organizer regions were present in both the No. 1 bivalent and the long arm of the X and Y₂, (c) the accessory structures of the X chromosome short arm in the forms of light and dark thickenings and the hairpin-like bend were present despite the X-autosome translocation, (d) a short synaptonemal complex was present between the Y₁ (real Y) and the short arm of the X chromosome, and (e) the centromeric orientation of the Y₁ and Y₂ chromosomes was in Cis configuration as opposed to the X chromosome.     

Physical mapping of sequences homologous to an endogenous retrovirus LTR on human chromosome 19

The human genome contains multiple copies of sequences related to the HERV-K family of endogenous retroviruses, homologous to the B-type mouse mammary tumour virus. A DNA fragment closely resembling an HERV-K long tandem repeat (LTR) was detected in a library of hncDNA clones enriched for sequences from human chromosome 19. Sites showing homology to the sequence of this fragment have been identified on human chromosome 19 by hybridization to previously mapped chromosome 19 cosmids. Thus the distribution of LTR sequences on a specific human chromosome has been mapped for the first time. We estimate the total number of such sites on human chromosome 19 to be at least 110. Many of these sites are located in the vicinity of known genes. The precise localizations (to specific cosmids) of LTR-homologous sequences on chromosome 19 can serve as a reference source and will automatically provide further insight into LTR-gene relationships as new genes are mapped onto the chromosome.     

Identification and characterization of the centromere from chromosome XIV in Saccharomyces cerevisiae.

A functional centromere located on a small DNA restriction fragment from Saccharomyces cerevisiae was identified as CEN14 by integrating centromere-adjacent DNA plus the URA3 gene by homologous recombination into the yeast genome and then by localizing the URA3 gene to chromosome XIV by standard tetrad analysis. DNA sequence analysis revealed that CEN14 possesses sequences (elements I, II, and III) that are characteristic of other yeast centromeres. Mitotic and meiotic analyses indicated that the CEN14 function resides on a 259-base-pair (bp) RsaI-EcoRV restriction fragment, containing sequences that extend only 27 bp to the right of the element I to III region. In conjunction with previous findings on CEN3 and CEN11, these results indicate that the specific DNA sequences required in cis for yeast centromere function are contained within a region about 150 bp in length.     

Pleiotropic effects associated with the deletion of heterochromatin surrounding rDNA on the X chromosome of Drosophila

In Drosophila melanogaster X chromosome heterochromatin (Xh) constitutes the proximal 40% of the X chromosome DNA and contains a number of genetic elements with homologous sites on the Y chromosome, one of which is well defined, namely, the bobbed locus, the repetitive structural locus for the 18S and 28S rRNAs. This report presents the localisation of specific repeated DNA sequences within Xh and the employment of this sequence map in constructing new chromosomes to analyse the nature of the heterochromatin surrounding the rDNA region. Repeated sequences were located relative to inversion breakpoints which differentiate Xh cytogenetically. When the rDNA region was manipulated to be in a position in the chromosome so that it was without the Xh which normally surrounds it, the following obser-vations were made, (i) The rDNA region of Xh is intrinsically hetero-chromatic, remaining genetically active and yet possessing major heterochromatic properties even in the absence of the flanking heterochromatin regions, (ii) The size of the deletion removing the portion of Xh normally located distal to the rDNA region affected the dominance relationship between the X and Y nucleolar organizers (activity/endoreduplication assayed in male salivary glands). The X rDNA without any flanking heterochromatin was dominant over Y rDNA while the presence of some Xh allowed both the X and Y rDNA to be utilized, (iii) Enhancement of the position effect variegation on the white locus was demonstrated to occur as a result of the Xh deletions generated. EMS mutagenesis studies argue that the regions of Xh flanking the rDNA region contain no vital loci despite the fact that they strongly effect gene expression in some genotypes. This is consistent with early studies using X-ray mutagenesis (Lindsley et al., 1960). The pleiotropic effects of deleting specific regions of Xh is discussed in relation to the possible influence of heterochromatin on the organisation of the functional interphase nucleus.