A Binding Mode of A-[tris(1,10-phenanthroline)ruthenium(II)]2+ Exhibiting Preference for Purine-3′,5′-Pyrimidine Sites of DNA

Abstract

Molecular mechanics calculations and molecular dynamics simulations have been used to study the binding of the partially inserted major groove complex of A-[Ru(1,10-phenanthroline)₃]²⁺ with DNA. Energy refinements of this complex showed a clear preference for binding at purine-3′,5′-pyrimidine sites over pyrimidine-3′,5′-purine sites. The basis for this difference is shown to be a slight change in the binding orientation induced by interchanging the purine and pyrimidine bases. This in turn provides for a better secondary interaction with the helix backbone at a point beyond the immediate binding site. It is this secondary interaction that provides the additional energetic stabilisation for complexes formed at purine-3′,5′-pyrimidine sites. Molecular dynamics simulations including explicit representation of solvent support these conclusions and provide an insight into the positional stability of the ligand at a particular site. Repuckering of specific deoxyribose rings to the C3′-endo conformation seems to be an important feature of the DNA/ligand complex.     

Cationic 5,10,15,20-tetrakis(N-methylpyridinium-4-yl)porphyrin fully intercalates at 5'-CG-3' steps of duplex DNA in solution

The interaction of 5,10,15, 20-tetrakis(N-methylpyridinium-4-yl)porphyrin (T4MPyP(4+)) with the oligonucleotide DNA duplex [d(GCACGTGC)](2) was studied by two-dimensional (1)H NMR spectroscopy, optical absorbance, circular dichroism, and molecular dynamics simulation employing particle mesh Ewald methods. T4MPyP(4+) is one of the largest aromatic molecules for which intercalative binding to DNA has been proposed, although this has been called into question by recent X-ray crystallographic work [Lipscomb et al. (1996) Biochemistry 35, 2818-2823]. T4MPyP(4+) binding to [d(GCACGTGC)](2) produced a single set of (mostly) upfield-shifted DNA resonances in slow exchange with the resonances of the free DNA. Intra- and intermolecular NOEs observed in the complex showed that the porphyrin intercalates at the central 5'-CG-3' step of the DNA duplex without disrupting the flanking base pairs. Absorption and circular dichroism spectra of the complex also support intercalative binding. Molecular dynamics simulations (using explicit solvent and PME methods), carried out for fully and partially intercalated complexes, yielded stable trajectories and plausible structures, but only the symmetrical, fully intercalated model agreed with NOESY data. Stable hydrogen bonding was observed during 600 ps of MD simulation for the base pairs flanking the binding site.     

Structural investigation of the hedamycin:d(ACCGGT)2 complex by NMR and restrained molecular dynamics

Hedamycin, a member of the pluramycin family of drugs, displays a range of biological responses including antitumor and antimicrobial activity. The mechanism of action is via direct interaction with DNA through intercalation between the bases of the oligonucleotide and alkylation of a guanine residue at 5'-PyG-3' sites. There appears to be some minor structural differences between two earlier studies on the interaction of hedamycin with 5'-PyG-3' sites. In this study, a high-resolution NMR analysis of the hedamycin:d(ACCGGT)2 complex was undertaken in order to investigate the effect of replacing the thymine with a guanine at the preferred 5'-CGT-3' site. The resultant structure was compared with earlier work, with particular emphasis placed on the drug conformation. The structure of the hedamycin:d(ACCGGT)2 complex has many features in common with the two previous NMR structures of hedamycin:DNA complexes but differed in the conformation and orientation of the N,N-dimethylvancosamine saccharide of hedamycin in one of these structures. The preferential binding of hedamycin to 5'-CG-3' over 5'-TG-3' binding sites is explained in terms of the orientation and location of the N,N-dimethylvancosamine saccharide in the minor groove.     

Mapping the protein-DNA interface and the metal-binding site of the major human apurinic/apyrimidinic endonuclease

Apurinic/apyrimidinic (AP) endonuclease Ape1 is a key enzyme in the mammalian base excision repair pathway that corrects AP sites in the genome. Ape1 cleaves the phosphodiester bond immediately 5' to AP sites through a hydrolytic reaction involving a divalent metal co-factor. Here, site-directed mutagenesis, chemical footprinting techniques, and molecular dynamics simulations were employed to gain insights into how Ape1 interacts with its metal cation and AP DNA. It was found that Ape1 binds predominantly to the minor groove of AP DNA, and that residues R156 and Y128 contribute to protein-DNA complex stability. Furthermore, the Ape1-AP DNA footprint does not change along its reaction pathway upon active-site coordination of Mg(2+) or in the presence of DNA polymerase beta (polbeta), an interactive protein partner in AP site repair. The DNA region immediately 5' to the abasic residue was determined to be in close proximity to the Ape1 metal-binding site. Experimental evidence is provided that amino acid residues E96, D70, and D308 of Ape1 are involved in metal coordination. Molecular dynamics simulations, starting from the active site of the Ape1 crystal structure, suggest that D70 and E96 bind directly to the metal, while D308 coordinates the cation through the first hydration shell. These studies define the Ape1-AP DNA interface, determine the effect of polbeta on the Ape1-DNA interaction, and reveal new insights into the Ape1 active site and overall protein dynamics.     

Enthalpy/entropy compensation: influence of DNA flanking sequence on the binding of 7-amino actinomycin D to its primary binding site in short DNA duplexes

The effect of the context of the flanking sequence on ligand binding to DNA oligonucleotides that contain consensus binding sites was investigated for the binding of the intercalator 7-amino actinomycin D. Seven self-complementary DNA oligomers each containing a centrally located primary binding site, 5'-A-G-C-T-3', flanked on either side by the sequences (AT)(n) or (AA)(n) (with n = 2, 3, 4) and AA(AT)(2), were studied. For different flanking sequences, (AA)(n)-series or (AT)(n)-series, differential fluorescence enhancements of the ligand due to binding were observed. Thermodynamic studies indicated that the flanking sequences not only affected DNA stability and secondary structure but also modulated ligand binding to the primary binding site. The magnitude of the ligand binding affinity to the primary site was inversely related to the sequence dependent stability. The enthalpy of ligand binding was directly measured by isothermal titration calorimetry, and this made it possible to parse the binding free energy into its energetic and entropic terms. Our results reveal a pronounced enthalpy-entropy compensation for 7-amino actinomycin D binding to this family of oligonucleotides and suggest that the DNA sequences flanking the primary binding site can strongly influence ligand recognition of specific sites on target DNA molecules.     

Epstein-Barr virus nuclear antigen forms a complex that binds with high concentration dependence to a single DNA-binding site.

A bacterially synthesized 28-kilodalton carboxyl-terminal fragment (28K-EBNA of Epstein-Barr virus nuclear antigen shows highly concentration dependent binding to monomer, dimer, and trimer copies of synthetic DNA-binding site 5' GATCTAGGATAGCATATGCTACCCCGGGG 3' 3' ATCCTATCGTATACGATGGGGCCCCCTAG 5' in bacterial plasmids. The rate of the binding reaction is independent of the number of sites, but dependent upon the length of the DNA containing the sites. These data are consistent with 28K-EBNA locating its binding sites by a process of facilitated transfer or sliding along the DNA. The highly concentration dependent binding suggests that multiple 28K-EBNA monomer polypeptides form a complex before or during binding. Binding occurs equally well at 24 and 37 degrees C, but not at 0 degrees C. A 28K-EBNA complex bound to a single site has unoccupied binding sites capable of interacting with additional DNA molecules. Such interaction is confirmed by agarose gel electrophoresis of protein-DNA complexes which indicate that a 28K-EBNA complex forms bridges between two DNA molecules. A bridge between the two binding regions in the Epstein-Barr virus origin of plasmid replication (oriP) would form a loop structure which could be an important feature for the regulatory function of authentic Epstein-Barr virus nuclear antigen.     

The paperclip triplex: understanding the role of apex residues in tight turns

In this study, we investigate the role of the apex nucleotides of the two turns found in the intramolecular "paperclip" type triplex DNA formed by 5'-TCTCTCCTCTCTAGAGAG-3'. Our previously published structure calculations show that residues C7-A18 form a hairpin turn via Watson-Crick basepairing and residues T1-C6 bind into the major groove of the hairpin via Hoogsteen basepairing resulting in a broad turn of the T1-T12 5'-pyrimidine section of the DNA. We find that only the C6C7/G18 apex triad (and not the T12A13/T1 apex triad) is required for intramolecular triplex formation, is base independent, and occurs whether the purine section is located at the 5' or 3' end of the sequence. NMR spectroscopy and molecular dynamics simulations are used to investigate a bimolecular complex (which retains only the C6C7/G18 apex) in which a pyrimidine strand 5'- TCTCTCCTCTCT-3' makes a broad fold stabilized by the purine strand 5'-AGAGAG-3' via Watson Crick pairing to the T8-T12 and Hoogsteen basepairing to T1-T5 of the pyrimidine strand. Interestingly, this investigation shows that this 5'-AGAGAG-3' oligo acts as a new kind of triplex forming oligonucleotide, and adds to the growing number of triplex forming oligonucleotides that may prove useful as therapeutic agents.     

The thermodynamics of polyamide-DNA recognition: hairpin polyamide binding in the minor groove of duplex DNA

Crescent-shaped synthetic ligands containing aromatic amino acids have been designed for specific recognition of predetermined DNA sequences in the minor groove of DNA. Simple rules have been developed that relate the side-by-side pairings of Imidazole (Im) and Pyrrole (Py) amino acids to their predicted target DNA sequences. We report here thermodynamic characterization of the DNA-binding properties of the six-ring hairpin polyamide, ImImPy-gamma-PyPyPy-beta-Dp (where gamma = gamma-aminobutyric acid, beta = beta-alanine, and Dp = dimethylaminopropylamide). Our data reveal that, at 20 degrees C, this ligand binds with a relatively modest 1.8-fold preference for the designated match site, 5'-TGGTA-3', over the single base pair mismatch site, 5'-TGTTA-3'. By contrast, we find that the ligand exhibits a 102-fold greater affinity for its designated match site relative to the double base pair mismatch site, 5'-TATTA-3'. These results demonstrate that the energetic cost of binding to a double mismatch site is not necessarily equal to twice the energetic cost of binding to a single mismatch site. Our calorimetrically measured binding enthalpies and calculated entropy data at 20 degrees C reveal the ligand sequence specificity to be enthalpic in origin. We have compared the DNA-binding properties of ImImPy-gamma-PyPyPy-beta-Dp with the hairpin polyamide, ImPyPy-gamma-PyPyPy-beta-Dp (an Im --> Py "mutant"). Our data reveal that both ligands exhibit high affinities for their designated match sites, consistent with the Dervan pairing rules. Our data also reveal that, relative to their corresponding single mismatch sites, ImImPy-gamma-PyPyPy-beta-Dp is less selective than ImPyPy-gamma-PyPyPy-beta-Dp for its designated match site. This result suggests, at least in this case, that enhanced binding affinity can be accompanied by some loss in sequence specificity. Such systematic comparative studies allow us to begin to establish the thermodynamic database required for the rational design of synthetic polyamides with predictable DNA-binding affinities and specificities.     

Structural and energetic requirements for a second binding site at the dimeric β-lactoglobulin interface

Through experimental and theoretical approaches, it has been shown that bovine β-lactoglobulin (βlg) uses its hydrophobic cavity or calyx as the primary binding site for hydrophobic molecules, whereas the existence of a second ligand binding site at the dimeric interface has only been structurally identified for vitamin D3 (VD3). This binding exists even in the thermally denatured state, suggesting the prevalence of this secondary site. Although crystallographic experiments have suggested that VD3 can bind to both monomeric and dimeric states without significant structural differences, theoretical and experimental reports have proposed some structural requirements. Thus, in this study, based on known experimental data, the dynamic interaction of VD3 with the monomeric or dimeric forms of βlg was investigated through a protocol combining blind docking and 2 microsecond molecular dynamics simulations coupled with binding free energy and per-residue binding free energy decomposition analyses using the Molecular Mechanics Generalized Born Surface Area approach. Binding free energy calculations allowed us to estimate the energetic differences of coupling VD3 at the calyx and the dimeric interface for the monomeric or dimeric state, revealing that the dimeric structure is required to form a stable complex with VD3 at the dimeric interface. This also has an important impact on the dimerization process, whereas although the monomeric state also forms a stable complex with VD3 at the dimeric interface, the incorporation of the entropy component contributed to producing a marginally favorable binding free energy. Finally, the per-residue decomposition analysis provided energetic information about the most relevant residues in stabilizing the different systems.     

Theoretical studies of cis-Pt(II)-diammine binding to duplex DNA

The binding of cis-Pt(II) diammine (cis-DP) to double-stranded DNA was studied with several kinked conformations that can accommodate the formation of a square planar complex. Molecular mechanics (MM) calculations were performed to optimize the molecular fit. These results were combined with quantum mechanical (QM) calculations to ascertain the relative energetics of ligand binding through water vs direct binding of the phosphate to the ammine and platinum, and to guide the selection of DNA conformations to model complex formation. Based on QM and MM calculations, models are proposed that may be characterized by several general features. A structure involving hydrogen bonding between each ammine and distinct adjacent phosphate groups, referred to as closed conformation (CC), has already been reported. This is also found in the crystal structure of small dimers. We report alternative conformations that may be important in platination of duplex DNA. They are characterized by an intermediate conformation (IC), involving hydrogen bonding between one ammine and phosphate group, and an open conformation (OC), without ammine phosphate hydrogen bonding. The IC and OC can be stabilized by water bridges in the space between the ammine and the phosphate groups. Sugar puckers alternate from the type C(2')-endo or C(1')-exo (S), to the type C(3')-endo or C(2')-exo (N), with intermediate types near O(1')-endo (O). In general, the sugar puckers alternate from S to N to S through the platinated region (3'-TpG*pG*p-5'), with the complexed strand exhibiting, (3')-S*-N*-S-(5') alternation, while the complementary strand shows either (3')-S*-N*-S-(5') or (3')-S*-N*-O-(5') alternation. In both the OC and IC, a hydrogen bond is found between the ammine and O4(T) on thymine (T) at the (3') end, adjacent to the complex site. There is a continuous range of backbone conformations through the platinated region which relate the OC to the IC. The models presented suggest that the dynamics of the binding of the cis-Pt(II)-diammines to adjacent N7(G) in double-stranded DNA may encompass several conformational possibilities, and that water bridges may play a roll in supporting open and intermediate conformations. Proton-proton distances are reported to assist in the experimental determination of conformations.     

Molecular dynamic simulations of cisplatin- and oxaliplatin-d(GG) intrastand cross-links reveal differences in their conformational dynamics

Mismatch repair proteins, DNA damage-recognition proteins and translesion DNA polymerases discriminate between Pt-GG adducts containing cis-diammine ligands (formed by cisplatin (CP) and carboplatin) and trans-RR-diaminocyclohexane ligands (formed by oxaliplatin (OX)) and this discrimination is thought to be important in determining differences in the efficacy, toxicity and mutagenicity of these platinum anticancer agents. We have postulated that these proteins recognize differences in conformation and/or conformational dynamics of the DNA containing the adducts. We have previously determined the NMR solution structure of OX-DNA, CP-DNA and undamaged duplex DNA in the 5'-d(CCTCAGGCCTCC)-3' sequence context and have shown the existence of several conformational differences in the vicinity of the Pt-GG adduct. Here we have used molecular dynamics simulations to explore differences in the conformational dynamics between OX-DNA, CP-DNA and undamaged DNA in the same sequence context. Twenty-five 10 ns unrestrained fully solvated molecular dynamics simulations were performed starting from two different DNA conformations using AMBER v8.0. All 25 simulations reached equilibrium within 4 ns, were independent of the starting structure and were in close agreement with previous crystal and NMR structures. Our data show that the cis-diammine (CP) ligand preferentially forms hydrogen bonds on the 5' side of the Pt-GG adduct, while the trans-RR-diaminocyclohexane (OX) ligand preferentially forms hydrogen bonds on the 3' side of the adduct. In addition, our data show that these differences in hydrogen bond formation are strongly correlated with differences in conformational dynamics, specifically the fraction of time spent in different DNA conformations in the vicinity of the adduct, for CP- and OX-DNA adducts. We postulate that differential recognition of CP- and OX-GG adducts by mismatch repair proteins, DNA damage-recognition proteins and DNA polymerases may be due, in part, to differences in the fraction of time that the adducts spend in a conformation favorable for protein binding.     

Assessment of the sequence dependency for the binding of 2-aminonaphthyridine to the guanine bulge

We have studied the sequence dependent binding of 2-amino-1,8-naphthyridine derivative 1 to a single guanine bulge. The free energy changes for the binding to a guanine bulge with different sequence contexts (5'X_Y3'/3'X'GY'5') were determined by a curve fitting of the thermal denaturation profile of DNA in the presence and absence of 1. The data showed that (i) the binding of 1 to a guanine bulge is stronger for those flanking the G-C base pair than A-T base pair, (ii) the guanine 3' side to 1 in the complex is especially effective for the complex stabilization, and (iii) the increase of T(m) in the presence of 1 is not a good estimate for the sequence dependent binding. The most efficient 1-binding was observed for the sequence of G_G/CGC. Molecular modeling simulations suggested that stacking interaction between the 3' side guanine and 1 is the molecular basis for the strong binding to G_G/CGC.     

Drug recognition of a DNA single strand break: nogalamycin intercalation between coaxially stacked hairpins.

Two DNA hairpin motifs (5'-GCGAAGC-3' and 5'-ACGA AGT-3'), both stabilized by a 5'-GAA loop, have been used to design novel intramolecular double hairpin structures (5'-GCGAAGCACGAAGT-3' and 5'-ACGAAGTGCG AAGC-3') in which coaxial stacking of the two hairpin components generates a double-stranded stem region effectively with a single-strand break in the middle of the sequence at either the TG or CA step between unconnected 3' and 5' terminal bases. We have investigated by NMR the conformation and dynamics of the DNA at the strand break site. We show that mutual stacking significantly enhances the stability of each hairpin. Further, the anthracycline antibiotic nogalamycin binds cleanly to the 5'-TG (5'-CA) site formed by the mutually stacked hairpins despite the break in the sugar-phosphate backbone on one strand. The complex resembles the structure of nogalamycin-DNA complexes with the drug bound at 5'-TG sites in intact duplex sequences, with pi-stacking interactions probably the single dominant stabilizing interaction.