2-Bromoadenosine-Substituted 2′,5′-Oligoadenylates Modulate Binding and Activation Abilities of Human Recombinant RNase L

Abstract

2-Bromoadenosine-substituted analogues of 2–5A, p5′A2′p-5′A2′p5′(br²A), p5′(br²A)2′p5′A2′p5′A, and p5′(br²A)2′p5′(br²A)2′p-S′(br²A), were prepared via a modification of a lead ion-catalyzed ligation reaction and were subsequently converted into the corresponding 5′-triphosphates. Both binding and activation of human recombinant RNase L by various 2-bromoadenosine-substituted 2–5A analogues were examined. Among the 2-bromoadenosine-substituted 2–5A analogues, the analogue with 2-bromoadenosine residing in the 2′-terminal position, p5′A2′p5′A2′p-5′(br²A), showed the strongest binding affinity and was as effective as 2–5A itself as an activator of RNase L. The CD spectrum of p5′A2′p-5′A2′p5′(br²A) was superimposable on that of p5′A2′p5′A2′p5′A, indicative of an anti orientation about the base-glycoside bonds as in naturally occurring 2–5A.     

Binding of Bis-linked Netropsin Derivatives in the Parallel-Stranded Hairpin Form to DNA

Abstract

Cis-diammine Pt(II)- bridged bis-netropsin and oligomethylene-bridged bis-netropsin in which two monomers are linked in a tail-to-tail manner bind to the DNA oligomer with the sequence 5′-CCTATATCC-3′ in a parallel-stranded hairpin form with a stoichiometry 1:1. The difference circular dichroism (CD) spectra characteristic of binding of these ligands in the hairpin form are similar. They differ from CD patterns obtained for binding to the same duplex of another bis-netropsin in which two netropsin moieties were linked in a head-to-tail manner. This reflects the fact that tail-to-tail and head-to-tail bis-netropsins use parallel and antiparallel side-by-side motifs, respectively, for binding to DNA in the hairpin forms. The binding affinity of cis -diammine Pt(II)- bridged bis-netropsin in the hairpin form to DNA oligomers with nucleotide sequences 5′-CCTATATCC-3′ (I), 5′-CCTTAATCC-3′ (II), 5′-CCTTATTCC-3′ (III), 5′-CCTTTTTCC-3′ (IV) and 5′-CCAATTTCC-3′ (V) decreases in the order I = II > III > IV> V. The binding of oligomethylene-bridged bis-netropsin in the hairpin form follows a similar hierarchy. An opposite order of sequence preferences is observed for partially bonded monodentate binding mode of the synthetic ligand.     

Superior working memory and behavioural habituation but diminished psychomotor coordination in mice lacking the ecto-5′-nucleotidase (CD73) gene

Adenosine is an important neuromodulator in the central nervous system involved in the regulation of wakefulness, sleep, learning and memory, fear and anxiety as well as motor functions. Extracellular adenosine is synthesized by the cell-surface ectoenzyme ecto-5′-nucleotidase (CD73) from 5′-adenosine monophosphate. While CD73 is widely expressed throughout the mammalian brain, its specific role for behaviour is poorly understood. We examined spatial working memory, emotional responses, motor coordination and motor learning as well as behavioural habituation in mice with a targeted deletion of CD73. CD73 knockout (CD73?/?) mice exhibit enhanced spatial working memory in the Y-maze and enhanced long-term behavioural habituation in the open field. Furthermore, impaired psychomotor coordination on the accelerating rotarod was found in CD73?/? mice. No changes in motor learning and/or anxiety-like behaviour were evident in CD73?/? mice. Our data provide evidence for a role of CD73 in the regulation of learning and memory and psychomotor coordination. Our results might be important for the evaluation of adenosine neuromodulators as possible treatments to ameliorate cognitive and motor deficits associated with neurodegenerative diseases.     

Conformational and stacking properties of 3′–5′ and 2′–5′ linked oligoribonucleotides studied by CD

Comparative CD studies have been carried out to characterize the properties of 2′–5′ and 3′–5′ oligoriboadenylates and oligoribouridylates from dimer to decamer. The CD band of the 3′–5′ oligoribonucleotides was larger than that of the 2′–5′ oligoribonucleotides and increased with the increase in chain length, while the CD band of the 2′–5′ oligoribonucleotides increased little beyond the dimer level. The CD analysis of the chain length dependency revealed that the 3′–5′ oligoribonucleotides adopt mainly the base-base stacking interaction, while the base-sugar interaction is predominant in the 2′–5′ oligoribonucleotides. The CD intensity of 3′–5′ oligoribonucleotides decreased to a larger extent at elevated temperatures or in the presence of ethanol compared to that of the 2′–5′ counterparts. Mg²⁺ or Mn²⁺ ion enhanced the magnitude of the CD of 3′–5′ octariboadenylate, while a small decrease in the CD was observed by the presence of Mg²⁺ or Mn²⁺ ion to the 2′–5′ octariboadenylate. The 3′–5′ oligoribonucleotide is likely conformationally flexible and can form helical ordered structure with strong base-base stacking depending on changes in the environment such as temperature, the presence of Mg²⁺ ion, or hydrophobicity of the solution. © 1996 John Wiley & Sons, Inc.     

7-Azido-Actinomycin D: A Photoaffinity Probe of the Sequence Specificity of DNA Binding by Actinomycin D

Abstract

Actinomycin D (ActD) is a DNA-binding antitumor antibiotic that appears to act in vivo by inhibiting RNA polymerase. The mechanism of DNA binding of ActD has attracted much attention because of its strong preference for 5′-dGpdC-3′ sequences. Binding is thought to involve intercalation of the tricyclic aromatic phenoxazone ring into a GC step, with the two equivalent cyclic pentapeptide lactone substituents lying in the minor groove and making hydrogen bond contacts with the 2-amino groups of the nearest neighbor guanines. Recent studies have indicated, however, that binding is also influenced by next-nearest neighboring bases. We have examined this higher order specificity using 7-azido-actinomycin-D as a photoaffinity probe, and DNA sequencing techniques to quantitatively monitor sites of covalent photoaddition. We found that GC doublets were strongly preferred only if the 5′- flanking base was a pyrimidine and the 3′-flanking base was not cytosine. In addition we observed a previously unreported preference for binding at a GG doublet in the sequence 5′- TGGG-3′.     

A cyclic AMP binding-protein from barley seedlings

A protein fraction extracted from barley seedlings was shown to bind 3′:5′-cyclic AMP. The binding effect is real and not due to interference with the standard binding-protein assay used. Evidence is presented that this is a specific binding-protein; even at high concentrations other protein fractions from the same source showed no affinity for cyclic AMP. None of a range of cyclic and non-cyclic nucleotides that were examined exhibited a degree of binding with the protein comparable to that with cyclic AMP. The cyclic AMP/binding protein complex has a K_d of 8 nM. This complex eluted at an identical position in the elution sequence from a Sephadex G-150 column as the uncomplexed binding-protein. The barley binding-protein is in a fraction which also exhibits the enzymic activities of glucose 6-phosphatase, ATPase, 5′-nucleotidase, and fructose 1,6-diphosphatase.     

The ecto-enzymes CD73 and adenosine deaminase modulate 5′-AMP-derived adenosine in myofibroblasts of the rat small intestine

Adenosine is a versatile signaling molecule recognized to physiologically influence gut motor functions. Both the duration and magnitude of adenosine signaling in enteric neuromuscular function depend on its availability, which is regulated by the ecto-enzymes ecto-5′-nucleotidase (CD73), alkaline phosphatase (AP), and ecto-adenosine deaminase (ADA) and by dipyridamole-sensitive equilibrative transporters (ENTs). Our purpose was to assess the involvement of CD73, APs, ecto-ADA in the formation of AMP-derived adenosine in primary cultures of ileal myofibroblasts (IMFs). IMFs were isolated from rat ileum longitudinal muscle segments by means of primary explant technique and identified by immunofluorescence staining for vimentin and α-smooth muscle actin. IMFs confluent monolayers were exposed to exogenous 5′-AMP in the presence or absence of CD73, APs, ecto-ADA, or ENTs inhibitors. The formation of adenosine and its metabolites in the IMFs medium was monitored by high-performance liquid chromatography. The distribution of CD73 and ADA in IMFs was detected by confocal immunocytochemistry and qRT-PCR. Exogenous 5′-AMP was rapidly cleared being almost undetectable after 60-min incubation, while adenosine levels significantly increased. Treatment of IMFs with CD73 inhibitors markedly reduced 5′-AMP clearance whereas ADA blockade or inhibition of both ADA and ENTs prevented adenosine catabolism. By contrast, inhibition of APs did not affect 5′-AMP metabolism. Immunofluorescence staining and qRT-PCR analysis confirmed the expression of CD73 and ADA in IMFs. Overall, our data show that in IMFs an extracellular AMP-adenosine pathway is functionally active and among the different enzymatic pathways regulating extracellular adenosine levels, CD73 and ecto-ADA represent the critical catabolic pathway.     

STRUCTURAL STUDIES ON LNA QUADRUPLEXES

LNAs (locked nucleic acids) are new DNA analogues with higher binding affinities toward nucleic acids than the canonical counterparts mainly due to the characteristic conformational restriction arising from the 2′-O, 4′-C methylene bridge. In light of the promising therapeutic applications and considering the advantageous characteristics of LNAs, such as their high water solubility, easy handling, and synthetic accessibility through the conventional phosphoramidite chemistry, we undertook a study concerning the capability of these nucleic acid analogues to form quadruplex structures. Particularly, we have been investigating the LNA/DNA chimeras corresponding to the well-known DNA sequences 5′-GGTTGGTGTGGTTGG-3′, capable of forming an unimolecular quadruplex. This article deals with the study of the sequence 5′-ggTTggTGTggTTgg-3′ (upper and lower case letters represent DNA and LNA residues, respectively), which, according to CD spectroscopy, is able to fold into a quadruplex structure.     

Circular dichroism study of 2'-5' dinucleoside monophosphates modified with N-2-acetylaminofluorene.

The conformational properties of four 2′ – 5′ dinucleoside monophosphates modified with $\text{N}$-2-acetylaminofluorene have been studied by circular dichroism spectroscopy. Covalent binding of this chemical carcinogen at the C₈ position of guanosine in the 2′ – 5′ dinucleoside monophosphates induces striking changes in their circular dichroic spectra depending on their base sequence and composition. The changes in CD spectra, redshift of the extrema and change of their polarity, not observed in the spectra of corresponding 3′ – 5′ derivatives modified with $\text{N}$-2-acetylaminofluorene are correlated with the difference in the configuration of 2′ – 5′ and 3′ – 5′ dinucleoside monophosphates and discussed in respect to the intramolecular stacking interactions.     

Sequence‐specific interactions of minor groove binders with restriction fragments of cDNAs for H tau 40 protein and MAP kinase 2. A qualitative and quantitative footprinting study

A series of DNA minor groove binders comprising netropsin, distamycin, the bisquaternary ammonium heterocycles SN 6999 and SN 6570, cis‐diammine platinum(II)‐bridged bis‐netropsin, cis‐diammine platinum(II)‐bridged bis‐distamycin and bis‐glycine‐linked bis‐distamycin were investigated for sequence‐specific interactions. The oligonucleotides used were the 154 base pair HindIII–RsaI restriction fragment of cDNA of h tau 40 protein and the 113 base pair NcoI–PvuII restriction fragment of cDNA of MAP kinase 2. Both proteins are believed to be involved in the pathology of Alzheimer's disease. For all these ligands, binding sites were localised at positions 1134–1139 (5′AATCTT3′), 1152–1156 (5′ATATT3′) and 1178–1194 (5′TTTCAATCTTTTTATTT3′) for the former and 720–726 (5′TATTCTT3′), 751–771 (5′AATTGTATAATAAATTTAAAA3′) and 781–785 (5′TATTT3′) for the latter. The AT‐preference of ligand binding was obvious and footprint titration experiments were applied to estimate binding constants (K_a) for each individual binding site mentioned above. The binding strength decreases in the order netropsin > distamycin > SN 6999 ≈ SN 6570>platinum‐bridged netropsin or distamycin≈bis‐glycine‐bridged distamycin and was found independently of the binding sites examined. GC‐base pairs interspersed in short AT‐tracts reduced the K_a‐values by as much as two orders of magnitudes. The dependence of extended bidentate as well as of monodentate binding of netropsin and distamycin derivatives on the length of AT‐stretches has been discussed. Copyright © 1999 John Wiley & Sons, Ltd.     

Binding sites for type C viral phosphoprotein on the viral RNA genome

The distribution of binding sites for R-MuLV p12 phosphoprotein on the viral genome has been examined. Ribonucleoprotein complexes formed using 3′-poly A-containing viral RNA fragments of varying lengths and $\text{in vitro}$ radioiodinated p12 protein have been analyzed by sedimentation velocity and buoyant density gradients. Binding sites for 2–3 molecules of p12 protein can be detected within the first 400 nucleotides from the 3′-poly A segment. The possible presence of binding sites near the middle of the genome (～2500 nucleotides from the 3′-end) and very close to the 5′-terminus (within the terminal 100–200 nucleotides) is also indicated.     

Mutational tests of the NMR-docked structure of the staphylococcal nuclease–metal–3′,5′-pdTp complex

In the X-ray structure of the staphylococcal nuclease–Ca²⁺ ?3′,5′-pdTp complex, the conformation of the inhibitor 3′,5′-pdTp is distroteed Lys-70* and Lys-71* from an adjacent molecule of staphylococcal nuclease (Loll, P.J., Lattman, E.E. Proteins 5 : 183-201, 1989). In order to correct this crystal packing problem, the solution conformation of enzyme-bound 3′,5′-pdTp in the staphylococcal nuclease–metal–pdTp Complex determined by NMR methods was docked into the X-ray structure of the enzyme [Weber, D. J., Serpersu, E. H., Gittis, A. G., Lattman, E. E., Mildvan, A. S. (preceding paper)]. In the NMR-docked structure, the 5′-phophate of 3′,5′-pdTp overlaps with that in the X-ray Structure. However the 3′-phosphate accepts a hydrogen bond from Lys-49 (2.89Å) rather than from Lys-84 (8.63 Å), and N3 of thymine donates a hydrogen bond to the OH of Tyr-115 (3.16 Å) which does not occur in the X-ray structure (5.28 Å). These interactions have been tested by binding studies of 3′,5′-pdTp, Ca²⁺, and Mn²⁺ to the K49A, K84A, and Y115A mutants of staphylococcal nuclease using water proton relaxation rate and EPR methods. Each mutant was fully active and structurally intact, as found by CD and two-dimensional NMR spectroscopy, but bound Ca²⁺ 9.1- to 9.9-fold more weakly than the wild-type enzyme. While thye K84A mutation did not significantly weaken 3′,5′-pdTp binding to the enzyme (1.5 ± 0.7 fold), the K49A mutation weakened 3′,5′-pdTp binding to the enzyme by the factor of 4.4 ± 1.8-fold. Similarly, the Y115A mutation weakened 3′,5′-pdTp binding to the enzyme 3.6 ± 1.6-fold. Comparable weakening effects of these mutations were found on the binding of Ca²⁺-3′,5′-pdTp. These results are more readily explained by the NMR-docked structure of staphylococcal nuclease-metal-3′,5′-pdTp than by the X-ray structure. © 1993 Wiley-Liss, Inc.     

Cooperative stabilization of Zn2+:DNA complexes through netropsin binding in the minor groove of FdU-substituted DNA

The simultaneous binding of netropsin in the minor groove and Zn²⁺ in the major groove of a DNA hairpin that includes 10 consecutive FdU nucleotides at the 3′-terminus (3′FdU) was demonstrated based upon NMR spectroscopy, circular dichroism (CD), and computational modeling studies. The resulting Zn²⁺/netropsin: 3′FdU complex had very high thermal stability with aspects of the complex intact at 85?°C, conditions that result in complete dissociation of Mg²⁺ complexes. CD and ¹⁹F NMR spectroscopy were consistent with Zn²⁺ binding in the major groove of the DNA duplex and utilizing F5 and O4 of consecutive FdU nucleotides as ligands with FdU nucleotides hemi-deprotonated in the complex. Netropsin is bound in the minor groove of the DNA duplex based upon 2D NOESY data demonstrating contacts between AH2 ¹H and netropsin ¹H resonances. The Zn²⁺/netropsin: 3′FdU complex displayed increased cytotoxicity towards PC3 prostate cancer (PCa) cells relative to the constituent components or separate complexes (e.g. Zn²⁺:3′FdU) indicating that this new structural motif may be therapeutically useful for PCa treatment.

An animated interactive 3D complement (I3DC) is available in Proteopedia at http://proteopedia.org/w/Journal:JBSD:32     

Functional dissection of CCR5 coreceptor function through the use of CD4-independent simian immunodeficiency virus strains

With rare exceptions, all simian immunodeficiency virus (SIV) strains can use CCR5 as a coreceptor along with CD4 for viral infection. In addition, many SIV strains are capable of using CCR5 as a primary receptor to infect CD4-negative cells such as rhesus brain capillary endothelial cells. By using coupled fluorescence-activated cell sorter (FACS) and infection assays, we found that even very low levels of CCR5 expression could support CD4-independent virus infection. CD4-independent viruses represent valuable tools for finely dissecting interactions between Env and CCR5 which may otherwise be masked due to the stabilization of these contacts by Env-CD4 binding. Based on the ability of SIV Env to bind to and mediate infection of cells expressing CCR5 chimeras and mutants, we identified the N terminus of CCR5 as a critical domain for direct Env binding and for supporting CD4-independent virus infection. However, the activity of N-terminal domain CCR5 mutants could be rescued by the presence of CD4, indicating that other regions of CCR5 are important for post-binding events that lead to viral entry. Rhesus CCR5 supported CD4-independent infection and direct Env binding more efficiently than did human CCR5 due to a single amino acid difference in the N terminus. Interestingly, uncleaved, oligomeric SIV Env protein bound to both CD4 and CCR5 less efficiently than did monomeric gp120. Finally, several mutations present in chronically infected monkey populations are shown to decrease the ability of CCR5 to serve as a primary viral receptor for the SIV isolates examined.     

Changes in the intracellular levels of pyridoxal 5'-phosphate affect the induction of tyrosine aminotransferase by glucocorticoids

In the present study a cell culture system was used to correlate the intracellular levels of pyridoxal 5′-phosphate with the induction of the hepatic enzyme, tyrosine aminotransferase, by glucocorticoids. Increased intracellular levels of pyridoxal 5′-phosphate produced antiglucocorticoid effects whereas a reduction in pyridoxal 5′-phosphate content increased the sensitivity of cells to glucocorticoids. The data strongly implicate pyridoxal 5′-phosphate as an $\text{in}\text{vivo}$ modulator of the glucocorticoid receptor. The mechanism by which pyridoxal 5′-phosphate modulates the receptor is presumably through its binding to the DNA-binding site of the “activated” form of the receptor complex.     

人淋巴细胞中发现2′—5′—三腺苷酸受体

通过合成的^3H-PPPA2′P5′A2′P5′A（2′－5′P3A3）与人淋巴细胞进行结合反应,结果表明：人淋巴细胞质膜存在着2′－5′P3A3受体。又通过用ATP、UTP与^3H-2′-5′P3A3竞争抑制实验表明,^3H－2′－5′P3A3与淋巴细胞膜受体的结合为特异性结构,结合率受^3H－2′－5′P3A3浓度、pH等因素影响。     

Regulation of proximal tubular epithelial cell CD44-mediated binding and internalisation of hyaluronan

BACKGROUND: Increased expression of the connective tissue polysaccharide hyaluronan (HA) in the renal corticointerstitium is associated with progressive renal fibrosis. Numerous studies have demonstrated involvement proximal tubular epithelial cells in the fibrotic process and in the current study we have characterised their expression of the HA receptor, CD44, and examined changes in CD44 expression and function in response to either IL-1beta or glucose. METHODS: Characterisation of CD44 splice variant expression was carried out in primary cultures of human proximal tubular cells (PTC) and HK2 cells. Binding and internalisation HA was examined by addition of exogenous of fluorescein-HA (fl-HA), and expression of CD44 examined by immunoblot analysis and flow cytometry. Alteration in "functional" CD44 was determined by immunoprecipitation of CD44 following stimulation in the presence of fl-HA. RESULTS: PTC, both primary culture and the PTC cell line, HK2, express at least 5 CD44 splice variants, the expression of which are not altered by addition of either IL-1beta or 25mM D-glucose. Addition of either stimulus increased cell surface binding and internalisation of fl-HA and increased expression of functionally active CD44. Increased binding and internalisation of fl-HA, was blocked by anti-CD44 antibody, and by the inhibition of O-glycosylation. CONCLUSIONS: The data demonstrate that stimuli inducing PTC HA synthesis also regulate PTC-HA interactions. Furthermore increased HA binding and internalisation is the result of post-translational modification of CD44 by O-glycosylation, rather than by alteration in expression of CD44 at the cell surface, or by alternate use of CD44 splice variants.