Purification of a mouse nuclear factor that binds to both the A and B cores of the polyomavirus enhancer.

We have previously identified a protein factor, PEBP2 (polyomavirus enhancer-binding protein), in the nuclear extract from mouse NIH 3T3 cells which binds to the sequence motif, PEA2, located within the polyomavirus enhancer A element. Upon cellular transformation with activated oncogene c-Ha-ras, this factor frequently undergoes drastic molecular modifications into an altered form having a considerably reduced molecular size. In this study, the altered form, PEBP3, was purified to near homogeneity. The purified PEBP3 comprised two sets of families of polypeptides, alpha-1 to alpha-4 and beta-1 to beta-2, which were 30 to 35 kilodaltons and 20 to 25 kilodaltons in size, respectively. Both kinds of polypeptides possessed DNA-binding activities with exactly the same sequence specificity. Individual alpha or beta polypeptides complexed with DNA showed faster gel mobilities than did PEBP3. However, the original gel retardation pattern was restored when alpha and beta polypeptides were mixed together in any arbitrary pair. These observation along with the results of UV- and chemical-cross-linking studies led us to conclude that PEBP3 is a heterodimer of alpha and beta subunits, potentially having a divalent DNA-binding activity. Furthermore, PEBP3 was found to bind a second, hitherto-unnoticed site of the polyomavirus enhancer that is located within the B element and coincides with the sequence previously known as the simian virus 40 enhancer core homology. From comparison of this and the original binding sites, the consensus sequence for PEBP3 was defined to be PuACCPuCA. These findings provided new insights into the biological significance of PEBP3 and PEBP2.     

Evidence for a HeLa nuclear protein that binds specifically to the single-stranded d(CCCTAA)n telomeric motif.

In recent years several telomere binding proteins from eukaryotic organisms have been identified that are able to recognise specifically the duplex telomeric DNA repeat or the G-rich 3'-ending single strand. In this paper we present experimental evidence that HeLa nuclear extracts contain a protein that binds with high specificity to the single-stranded complementary d(CCCTAA)n repeat. Electrophoretic mobility shift assays show that the oligonucleotide d(CCCTAACCCTAACCCTAACCCT) forms a stable complex with this protein in the presence of up to 1000-fold excesses of single-stranded DNA and RNA competitors, but is prevented from doing so in the presence of its complementary strand. SDS-PAGE experiments after UV cross-linking of the complex provide an estimate of 50 kDa for the molecular weight of this protein.     

Characterization of a novel protein that specifically binds to DNA modified by N-acetoxy-acetylaminofluorene and cis-diamminedichloroplatinum

Proteins recognizing DNA damaged by the chemical carcinogen N-acetoxy-acetylaminofluorene (AAAF) were analyzed in nuclear extracts from rat tissues, using a 36 bp oligonucleotide as a substrate and electrophoretic mobility shift and Southwestern blot assays. One major damage-recognizing protein was detected, whose amount was estimated as at least 10(5) copies per cell. Levels of this protein were similar in extracts from brain, kidney and liver, but much lower in extracts from testis. The affinity of the detected protein for DNA damaged by AAAF was about 70-fold higher than for undamaged DNA. DNA damaged by cis-diamminedichloroplatinum (cis-DDP), benzo(a)pyrene diolepoxide (BPDE) or UV-radiation also bound this protein with an increased affinity, the former more strongly and the latter two more weakly as compared to AAAF-damaged DNA. The detected AAAF/DDP-damaged-DNA-binding (AAAF/DDP-DDB) protein had a molecular mass of about 25 kDa and was distinct from histone H1 or HMGB proteins, which are known to have a high affinity for cis-DDP-damaged DNA. The level of this damage-recognizing protein was not affected in rats treated with the carcinogen 2-acetylaminofluorene. The activity of an AAAF/DDP-DDB protein could also be detected in extracts from mouse liver cells but not from the Hep2G human hepatocellular carcinoma.     

Purification of a HeLa cell nuclear protein that binds selectively to DNA irradiated with ultra-violet light.

Ultraviolet (UV) light induces a variety of lesions in DNA of which the pyrimidine dimer represents the major species. Pyrimidine dimers exist as both a cyclobutane type and a 6-4' (pyrimidine-2'-one) photoproduct. We have purified a protein of M(r) approximately 125,000 from HeLa cell nuclei which binds efficiently to double-stranded DNA irradiated with UV light but not to undamaged DNA. This protein was designated UVBP1 (UV damage binding protein 1). UVBP1 did not recognise DNA damaged by cisplatin. Using oligonucleotides with a single dipyrimidine site for induction of UV photoproducts, binding of UVBP1 to a TC-containing substrate was shown to be more efficient than to substrates containing a TT, a CT or a CC pair. This binding specificity implies selective recognition of the 6-4' photoproduct. Further evidence for this was provided by the finding that hot alkali treatment of the substrate (which selectively hydrolyses 6-4' photoproducts) abrogated binding of UVBP1, whereas incubation with DNA photolyase to remove cyclobutane dimers did not. No detectable DNA helicase, ATPase or exonuclease activity was associated with the purified protein. We suggest that UVBP1 may be involved in the lesion recognition step of DNA excision repair and could contribute to the preferential repair of 6-4' photoproducts from the DNA of UV-irradiated mammalian cells.     

Identification and molecular cloning of a novel brain-specific receptor protein that binds to brain injury-derived neurotrophic peptide. Possible role for neuronal survival

Brain injury-derived neurotrophic peptide (BINP) is a synthetic 13-mer peptide that supports neuronal survival and protects hippocampal neurons in primary cultures from cell death caused by glutamate. We have developed a monoclonal antibody named mAb 6A22 against the 40-kDa BINP-binding protein, p40BBP. mAb 6A22 inhibits binding between BINP and rat brain synaptosomes and abolishes the protective effect of BINP. The antigen of mAb 6A22 should be the BINP-binding protein that mediates the neuroprotective action of BINP. Using an expression cloning approach with mAb 6A22, we isolated a cDNA encoding a novel receptor protein that shows binding activity of BINP. COS7 cells transfected with the cloned cDNA show binding of BINP and cell surfaces that are stained by 6A22. The mRNA for p40BBP is specific for the rat brain and is increased after birth. From immunohistochemical studies using mAb 6A22, p40BBP increased after kainic acid treatment in rat hippocampal neurons.     

Identification and characterization of a nuclear factor that specifically binds to the Rev response element (RRE) of human immunodeficiency virus type 1 (HIV-1)

The Rev protein of human immunodeficiency virus type 1 (HIV-1) differentially transactivates the expression of viral structural proteins by allowing the accumulation of unspliced and singly spliced viral mRNA in the cytoplasm. The cis-acting RNA target sequence for the Rev protein, termed the Rev response element (RRE), is present in the env gene and is predicted to form a highly ordered RNA secondary structure. Recent data indicate that Rev directly binds to RRE and, further, that this binding can be mapped to a 90-nucleotide subfragment at the 5' end of RRE. We now report that RRE also binds specifically and predominantly to a nuclear factor of approximately 56 kD. Mapping of the binding site reveals that the same subfragment that binds Rev also binds this nuclear factor. We designate this protein as NFRRE for nuclear factor, RRE binding. Rev and NFRRE appear to bind simultaneously to RRE. NFRRE is widely distributed in various mammalian cells. We speculate that this factor plays an important role in Rev-mediated transactivation and is likely to be involved in the processing or transport of cellular mRNA.     

The novel SAR-binding domain of scaffold attachment factor A (SAF-A) is a target in apoptotic nuclear breakdown.

The scaffold attachment factor A (SAF-A) is an abundant component of the nuclear scaffold and of chromatin, and also occurs in heterogeneous nuclear ribonucleoprotein (hnRNP) complexes. Evidence from previous experiments had suggested that SAF-A most likely has at least two different functions, being involved both in nuclear architecture and RNA metabolism. We now show that the protein has a novel scaffold-associated region (SAR)-specific bipartite DNA-binding domain which is independent from the previously identified RNA-binding domain, the RGG box. During apoptosis, but not during necrosis, SAF-A is cleaved in a caspase-dependent way. Cleavage occurs within the bipartite DNA-binding domain, resulting in a loss of DNA-binding activity and a concomitant detachment of SAF-A from nuclear structural sites. On the other hand, cleavage does not compromise the association of SAF-A with hnRNP complexes, indicating that the function of SAF-A in RNA metabolism is not affected in apoptosis. Our results suggest that detachment of SAF-A from SARs, caused by apoptotic proteolysis of its DNA-binding domain, is linked to the formation of oligonucleosomal-sized DNA fragments and could therefore contribute to nuclear breakdown in apoptotic cells.     

Purification and characterization of a nuclear factor which binds specifically to the upstream activation sequence of Saccharomyces cerevisiae enolase 1 gene

The nuclear factor which specifically binds to the upstream activation sequence (UAS) of the enolase 1 gene (ENO1) of yeast Saccharomyces cerevisiae was purified by sequence-specific affinity chromatography. The purified factor gave two closely migrated bands at 32 kDa on SDS/PAGE. The binding activities were eluted from a gel filtration column at molecular masses of 110 kDa and 60 kDa, suggesting a dimeric and a tetrameric assembly of the factor in the native form. The region protected by the purified factor against deoxyribonuclease I digestion contained the sequence ACCCAAACACC which is highly similar to the consensus sequence present in the 5'-flanking region of the ribosomal protein genes (RPG box). We also identified the other factor specific to the ENO1 UAS which gave a single peak at a molecular mass of 120 kDa in gel filtration. We suggest the existence of multiple binding to the ENO1 UAS by at least two factors: one is the factor which we purified with a molecular mass of 32 kDa on SDS/PAGE and the other is the factor like RAP1 protein which generally recognizes the RPG-box-like sequence.     

Heat-inducible human factor that binds to a human hsp70 promoter.

A factor found in nuclear extracts of human cells bound to the heat shock element of a human heat shock protein 70 gene. The level of this factor was significantly increased after heat shock. This induction was rapid and was not blocked by cycloheximide, suggesting that an initial event in the response of a human cell to heat is the activation of a preexisting regulatory factor.     

A novel nuclear pore protein Nup82p which specifically binds to a fraction of Nsp1p

Nsp1p interacts with nuclear pore proteins Nup49p, Nup57p and Nic96p in a stable complex which participates in nucleocytoplasmic transport. An additional p80 component is associated with Nsp1p, but does not co- purify with tagged Nup57p, Nup49p and Nic96p. The p80 gene was cloned and encodes a novel essential nuclear pore protein named Nup82p. Immunoprecipitation of tagged Nup82p reveals that it is physically associated with a fraction of Nsp1p which is distinct from Nsp1p found in a complex with Nup57p, Nic96p and Nup49p. The Nup82 protein can be divided into at least two different domains both required for the essential function, but it is only the carboxy-terminal domain, exhibiting heptad repeats, which binds to Nsp1p. Yeast cells depleted of Nup82p stop cell growth and concomitantly show a defect in poly(A)+RNA export, but no major alterations of nuclear envelope structure and nuclear pore density are seen by EM. This shows that Nsp1p participates in multiple interactions at the NPC and thus has the capability to physically interact with different NPC structures.     

A 40 kilodalton rat liver nuclear protein binds specifically to apolipoprotein B mRNA around the RNA editing site.

Apolipoprotein (apo) B-48 mRNA is the product of RNA editing which consists of a C----U conversion changing a CAA codon encoding Gln-2153 in apoB-100 mRNA to a UAA stop codon in apoB-48 mRNA. In the adult rat, RNA editing occurs both in the small intestine and the liver. We have studied the ability of rat liver nuclear extracts to bind to synthetic apoB mRNA segments spanning the editing site. Using an RNA gel mobility shift assay, we found the sequence-specific binding of a protein(s) to a 65-nucleotide apoB-100 mRNA. UV crosslinking followed by T1 ribonuclease digestion and SDS-polyacrylamide gel electrophoresis demonstrated the formation of a 40 kDa protein-RNA complex when 32P-labeled apoB-100 mRNA was incubated with a rat liver nuclear extract but not with HeLa nuclear extract. Binding was specific for the sense strand of apoB mRNA, and was not demonstrated with single-stranded apoB DNA, or antisense apoB RNA. The complex also failed to form if SDS was present during the UV light exposure. Binding experiments using synthetic apoB mRNAs indicate that the 40 kDa protein would also bind to apoB-48 mRNA but not apoA-I, apoA-IV, apoC-II or apoE mRNA. Experiments using deletion mutants of apoB-100 mRNA indicate efficient binding of wildtype 65-nucleotide (W65), 40-nucleotide (W40) and 26-nucleotide (W26) apoB-100 mRNA segments, but not 10-nucleotide (or smaller) segments of apoB-100 mRNA to the 40 kDa protein. In contrast, two other regions of apoB-100 mRNA, B-5' (bases 1128-3003) and B-3' (bases 11310-11390), failed to bind to the protein. The 40 kDa sequence-specific binding protein in rat liver nuclear extract may play a role in apoB-100 mRNA editing.     

Constitutive monocyte-restricted activity of NF-M, a nuclear factor that binds to a C/EBP motif.

In a search for monocyte-specific nuclear factors, we analyzed in human cells the promoter of the chicken myelomonocytic growth factor, a gene that, in the chicken, is expressed in myeloid and myelomonocytic cells. Reporter gene constructs were active in monocytic Mono Mac 6 cells and in monoblastic THP-1 cells but not in the hematopoietic stem cell line K562. When a region with homology to the sequence recognized by CAAT enhancer-binding proteins (C/EBP) was inactivated by site-directed mutagenesis, the reporter activity was reduced by a factor of 10. Multimers of this region, termed F, in front of a heterologous promoter were active in Mono Mac 6 and THP-1 cells but not in K562 cells, WIL2 B cells, BT20 mammary carcinoma cells, MelJuso melanoma cells, or SK-Hep-1 hepatoma cells. Gel shift analysis with the F oligonucleotide identified DNA-binding activity in monocytic Mono Mac 6, monoblastic THP-1, and myelomonocytic HL60 cells. No binding was detected in myelomonocytic RC2A cells, in myeloid KG-1 cells, or in the hematopoietic stem cell line K562. Furthermore, a panel of solid tumor cell lines, representing various tissues, were also negative. Stimulation by PMA could not induce this binding factor in any of the negative cell lines. Analysis of primary cells (granulocytes, T cells, monocytes, and alveolar macrophages) revealed binding activity only in monocytes and macrophages. This DNA-binding factor, termed NF-M, was found to consist of two molecules, of 50 and 72 kDa, as determined by affinity cross-linking. Binding of NF-M was competed by the region F oligonucleotide and by the C/EBP motif from the albumin enhancer but not by an AP-2 motif. These data suggest that NF-M is a member of the C/EBP family of nuclear factors. The monocyte-restricted activity of NF-M suggests that this nuclear factor may be involved in regulation of monocyte-specific genes.