Structural features unique to the 5 S ribosomal RNAs of the thermophilic cyanobacterium Synechococcus lividus III and the green plant chloroplasts

The complete nucleotide sequence of the 5 S ribosomal RNA from the thermophilic cyanobacterium Synechococcus lividus III was determined. The sequence is: ^5′U-C- C-U-G-G-U-G-G-U-G-A-U-G-G-C-G-A-U-G-U-G-G-A-C-C-C-A-C-A-C-U-C-A-U-C- C-A-U-C-C-C-G-A-A-C-U-G-A-G-U-G-G-U-G-A-A-A-C-G-C-A-U-U-U-G-C-G-G-C- G-A-C-G-A-U-A-G-U-U-G-G-A-G-G-G-U-A-G-C-C-U-C-C-U-G-U-C-A-A-A-A-U-A- G-C-U-A-A-C-C-G-C-C-A-G-G-G-U_OH^3′This 5 S RNA has regional structural characteristics that are found in the green plant chloroplast 5 S RNAs and not in other known sequences of 5 S ribosomal RNAs. These homologies suggest a close phylogenetic relationship between S. lividus and the green plant chloroplasts.     

Nucleotide sequence and structure of cytoplasmic 5S RNA and 5.8S RNA of Chlamydomonas reinhardii.

Three small RNAs of the cytoplasmic 8OS ribosomes of the green unicellular alga Chlamydomonas reinhardii have been sequenced. They include two species of ribosomal 5S RNA, a major and a minor one of 122 and 121 nucleotides respectively, which differ from each other by 17 bases, and also the ribosomal 5.8S RNA of 156 nucleotides. Novel structural features can be recognized in the 5S RNAs of C. reinhardii by a comparison with published 5S RNA sequences. In addition the secondary structure of these small RNA molecules has been examined using a newly developed method based on differential nuclease susceptibility.     

The nucleotide sequence of the chloroplast 5S ribosomal RNA from spinach.

Spinacia oleracia cholorplast 5S ribosomal RNA was end-labeled with [32P] and the complete nucleotide sequence was determined. The sequence is: pUAUUCUGGUGUCCUAGGCGUAGAGGAACCACACCAAUCCAUCCCGAACUUGGUGGUUAAACUCUACUGCGGUGACGAU ACUGUAGGGGAGGUCCUGCGGAAAAAUAGCUCGACGCCAGGAUGOH. This sequence can be fitted to the secondary structural model proposed for prokaryotic 5S ribosomal RNAs by Fox and Woese (1). However, the lengths of several single- and double-stranded regions differ from those common to prokaryotes. The spinach chloroplast 5S ribosomal RNA is homologous to the 5S ribosomal RNA of Lemna chloroplasts with the exception that the spinach RNA is longer by one nucleotide at the 3' end and has a purine base substitution at position 119. The sequence of spinach chloroplast 5S RNA is identical to the chloroplast 5S ribosomal RNA gene of tobacco. Thus the structures of the chloroplast 5S ribosomal RNAs from some of the higher plants appear to be almost totally conserved. This does not appear to be the case for the higher plant cytoplasmic 5S ribosomal RNAs.     

A novel variety of 4.5 S RNA from Codium fragile chloroplasts

An unusual new chloroplast RNA has been isolated and sequenced in the siphonous green alga, Codium fragile. This RNA is 94 nucleotides in length, has an unusually high A + U content (73%), contains no modified residues, and is as abundant as a single chloroplast tRNA species. Although this RNA is 4.5 S in size, it bears little sequence homology to the widely found and highly conserved 4.5 S RNAs present in the chloroplasts of higher plants. Nevertheless, this RNA may indeed by analogous to the higher plant 4.5 S RNAs, since the Codium 4.5 S RNA has the potential to form a secondary structure which in many respects is remarkably similar to that of known chloroplast 4.5 S RNAs, and hybridization data strongly suggests that the 4.5 S RNA is part of the ribosomal RNA operon, as is the case in higher plant chloroplasts.     

Structure analysis at the ends of the intervening DNA sequences in the chloroplast 23S ribosomal genes of C. reinhardii

All of the chloroplast 23S ribosomal genes of C. reinhardii are interrupted by a 0.87 kb sequence (Rochaix and Malnoë, 1978). We have sequenced the DNA across the two ends of this intervening element. In parallel, we have examined the nucleotide sequences in the corresponding part of the 23S ribosomal RNA. This allowed us to locate precisely the boundaries between the coding (that is, transcribed into mature 23S rRNA) and the noncoding DNA. The results show that the intervening sequence is flanked by two identical sets of 3 bp (5′-CGT) oriented as direct repeats. In addition, a sequence of 5 bp (5′-CGTGA) lies exactly next to one end and is found very close (16 bp) to the other end, in the coding part of the gene. These two sets are also oriented as direct repeats. Finally, sequences near one end of the intervening element are found with a few alterations near the other end, but in an inverted orientation. Possible interpretations of these results are discussed.     

The 5S ribosomal RNA of Euglena gracilis cytoplasmic ribosomes is closely homologous to the 5S RNA of the trypanosomatid protozoa.

The complete nucleotide sequence of the major species of cytoplasmic 5S ribosomal RNA of Euglena gracilis has been determined. The sequence is: 5' GGCGUACGGCCAUACUACCGGGAAUACACCUGAACCCGUUCGAUUUCAGAAGUUAAGCCUGGUCAGGCCCAGUUAGUAC UGAGGUGGGCGACCACUUGGGAACACUGGGUGCUGUACGCUUOH3'. This sequence can be fitted to the secondary structural models recently proposed for eukaryotic 5S ribosomal RNAs (1,2). Several properties of the Euglena 5S RNA reveal a close phylogenetic relationship between this organism and the protozoa. Large stretches of nucleotide sequences in predominantly single-stranded regions of the RNA are homologous to that of the trypanosomatid protozoan Crithidia fasticulata. There is less homology when compared to the RNAs of the green alga Chlorella or to the RNAs of the higher plants. The sequence AGAAC near position 40 that is common to plant 5S RNAs is CGAUU in both Euglena and Crithidia. The Euglena 5S RNA has secondary structural features at positions 79-99 similar to that of the protozoa and different from that of the plants. The conclusions drawn from comparative studies of cytochrome c structures which indicate a close phylogenetic relatedness between Euglena and the trypanosomatid protozoa are supported by the comparative data with 5S ribosomal RNAs.     

Sequence of the chloroplast 16S rRNA gene and its surrounding regions of Chlamydomonas reinhardii.

The sequence of a 2 kb DNA fragment containing the chloroplast 16S ribosomal RNA gene from Chlamydomonas reinhardii and its flanking regions has been determined. The algal 16S rRNA sequence (1475 nucleotides) and secondary structure are highly related to those found in bacteria and in the chloroplasts of higher plants. In contrast, the flanking regions are very different. In C. reinhardii the 16S rRNA gene is surrounded by AT rich segments of about 180 bases, which are followed by a long stretch of complementary bases separated from each other by 1833 nucleotides. It is likely that these structures play an important role in the folding and processing of the precursor of 16S rRNA. The primary and secondary structures of the binding sites of two ribosomal proteins in the 16SrRNAs of E. coli and C. reinhardii are considerably related.     

The 5S ribosomal RNA sequences of a red algal rhodoplast and a gymnosperm chloroplast. Implications for the evolution of plastids and cyanobacteria

Summary The 5S ribosomal RNA sequences have been determined for the rhodoplast of the red algaPorphyra umbilicalis and the chloroplast of the coniferJuniperus media. The 5S RNA sequence of theVicia faba chloroplast is corrected with respect to a previous report. A survey of the known sequences and secondary structures of 5S RNAs from plastids and cyanobacteria shows a close structural similarity between all 5S RNAs from land plant chloroplasts. The algal plastid 5S RNAs on the other hand show much more structural diversity and have certain structural features in common with bacterial 5S RNAs. A dendrogram constructed from the aligned sequences by a clustering algorithm points to a common ancestor for the present-living cyanobacteria and the land plant plastids. However, the algal plastids branch off at an early stage within the plastid-cyanobacteria cluster, before the divergence between cyanobacteria and land plant chloroplasts. This evolutionary picture points to the occurrence of multiple endosymbiotic events, with the ancestors of the present algal plastids already established as photosynthetic endosymbionts at a time when the ancestors of the present land plant chloroplasts were still free-living cells.     

Sequence organization of repetitive elements in the flanking regions of the chloroplast ribosomal unit of Chlamydomonas reinhardii.

The flanking regions and the end of the chloroplast ribosomal unit of Chlamydomonas reinhardii have been sequenced. The upstream region of the ribosomal unit contains three open reading frames coding for 111, 117 and 124 amino acids, respectively. The latter polypeptide is partially related to the ribosomal protein L16 of E. coli. Two of the open reading frames overlap each other and are oriented in opposite direction. The region between these open reading frames and the 5' end of the 16S rRNA gene contains numerous short direct and inverted repeats which can be folded into large stem-loop structures. Sequence elements that resemble prokaryotic promoters are found in the same region. Several of the repeated elements are distributed throughout the non-coding regions of the chloroplast inverted repeat. Sequence comparison between the 5S rRNA and its gene does not reveal any significant sequence heterogeneity between the chloroplast 5S rRNA genes.     

Composite structure of the chloroplast 23 S ribosomal RNA genes of Chlamydomonas reinhardii: Evolutionary and functional implications

The chloroplast ribosomal unit of Chlamydomonas reinhardii displays two features which are not shared by other chloroplast ribosomal units. These include the presence of an intron in the 23 S ribosomal RNA gene and of two small genes coding for 3 S and 7 S rRNA in the spacer between the 16 S and 23 S rRNA genes (Rochaix & Malnoë, 1978). Sequencing of the 7 S and 3 S rRNAs as well as their genes and neighbouring regions has shown that: (1) the 7 S and 3 S rRNA genes are 282 and 47 base-pairs long, respectively, and are separated by a 23 base-pair A + T-rich spacer. (2) A sequence microheterogeneity exists within the 3 S RNA genes. (3) The sequences of the 7 S and 3 S rRNAs are homologous to the 5′ termini of prokaryotic and other chloroplast 23 S rRNAs, indicating that the C. reinhardii counterparts of 23 S rRNA have a composite structure. (4) The sequences of the 7 S and 3 S rRNAs are related to that of cytoplasmic 5.8 S rRNA, suggesting that these RNAs may perform similar functions in the ribosome. (5) Partial nucleotide sequence complementarity is observed between the 5′ ends of the 7 S and 3 S RNAs on one hand and the 23 S rRNA sequences which flank the ribosomal intron on the other. These data are compatible with the idea that these small rRNAs may play a role in the processing of the 23 S rRNA precursor.     

Nucleotide Sequence Homology Exists between the Chloroplast and Nuclear Ribosomal DNAs of Euglena gracilis

The nuclear and chloroplast ribosomal DNAs from Euglena were shown to have specific regions of nucleotide sequence homology. The regions of homology were identified by hybridization of restriction endonuclease DNA fragments of cloned chloroplast and nuclear ribosomal DNAs to one another. The regions of homology between these two ribosomal DNAs were in that part of the genes that code for the 3′ end of the small rRNAs (16S and 19S) and near or at the DNA sequences coding for the 5S RNAs. The nucleotide sequence homology between these regions was estimated to be approximately 94% by the melting point depression of a hybrid formed between the two ribosomal DNAs.     

RNR1, a 3'-5' exoribonuclease belonging to the RNR superfamily, catalyzes 3' maturation of chloroplast ribosomal RNAs in Arabidopsis thaliana

Arabidopsis thaliana chloroplasts contain at least two 3′ to 5′ exoribonucleases, polynucleotide phosphorylase (PNPase) and an RNase R homolog (RNR1). PNPase has been implicated in both mRNA and 23S rRNA 3′ processing. However, the observed maturation defects do not affect chloroplast translation, suggesting that the overall role of PNPase in maturation of chloroplast rRNA is not essential. Here, we show that this role can be largely ascribed to RNR1, for which homozygous mutants germinate only on sucrose-containing media, and have white cotyledons and pale green rosette leaves. Accumulation of chloroplast-encoded mRNAs and tRNAs is unaffected in such mutants, suggesting that RNR1 activity is either unnecessary or redundant for their processing and turnover. However, accumulation of several chloroplast rRNA species is severely affected. High-resolution RNA gel blot analysis, and mapping of 5′ and 3′ ends, revealed that RNR1 is involved in the maturation of 23S, 16S and 5S rRNAs. The 3′ extensions of the accumulating 5S rRNA precursors can be efficiently removed in vitro by purified RNR1, consistent with this view. Our data suggest that decreased accumulation of mature chloroplast ribosomal RNAs leads to a reduction in the number of translating ribosomes, ultimately compromising chloroplast protein abundance and thus plant growth and development.     

Generalized structures of the 5S ribosomal RNAs.

The sequences of 5S ribosomal RNAs from a wide-range of organisms have been compared. All sequences fit a generalized 5S RNA secondary structural model. Twenty-three nucleotide positions are found universally, i.e., in 5S RNAs of eukaryotes, prokaryotes, archaebacteria, chloroplasts and mitochondria. One major distinguishing feature between the prokaryotic and eukaryotic 5S RNAs is the number of nucleotide positions between certain universal positions, e.g., prokaryotic 5S RNAs have three positions between the universal positions PuU40 and G44 (using the E. coli numbering system) and eukaryotic 5S RNAs have two. The archaebacterial 5S RNAs appear to resemble the eukaryotic 5S RNAs to varying degrees depending on the species of archaebacteria although all the RNAs conform with the prokaryotic "rule" of chain length between PuU40 and G44. The green plant chloroplast and wheat mitochondrial 5S RNAs appear prokaryotic-like when comparing the number of positions between universal nucleotides. Nucleotide positions common to eukaryotic 5S RNAs have been mapped; in addition, nucleotide sequences, helix lengths and looped-out residues specific to phyla are proposed. Several of the common nucleotides found in the 5S RNAs of metazoan somatic tissue differ in the 5S RNAs of oocytes. These changes may indicate an important functional role of the 5S RNA during oocyte maturation.     

Comparative study on the evolution of chloroplast ribosomal 5S RNA of a living fossil plant, Cycas revoluta Thumb

The complete nucleotide sequence of Cycas revoluta Thunb chloroplast 5 S rRNA was determined. It consists of 122 nucleotides. This is the only known 5 S rRNA sequence in Gymnospermae. It is highly homologous with chloroplast 5 S rRNA of higher plants (92-97%), but less homologous (about 54%) with those of lower plants. There is however 67% homology between Cycas and a procaryote a. nidulans. The chloroplast 5 S rRNAs of Angiospermae are nearly identical with each other (95-97%). S. oligorhize and L. minor have 100% homology among themselves. We have constructed a phylogenic tree of 5 S rRNA sequences from fifteen plant chloroplasts. The result suggests that the emergence of algae occurred at an early stage of plant chloroplast evolution and that green plants originated from green algae. This is in agreement with the classical view and other theories of molecular evolution. However there is no common ancestor in the case of Bryophyta and ferns. Among the Angiospermae, a precise evolutionary process cannot be deduced because the Knuc values among the species are very close to each other.     

Nucleotide sequence and evolution of the 18S ribosomal RNA gene in maize mitochondria.

The nucleotide sequence of the gene coding for the 18S ribosomal RNA of maize mitochondria has been determined and a model for the secondary structure is proposed. Dot matrix analysis has been used to compare the extent and distribution of sequence similarities of the entire maize mitochondrial 18S rRNA sequence with that of 15 other small subunit rRNA sequences. The mitochondrial gene shows great similarity to the eubacterial sequences and to the maize chloroplast, and less similarity to mitochondrial rRNA genes in animals and fungi. We propose that this similarity is due to a slow rate of nucleotide divergence in plant mtDNA compared to the mtDNA of animals. Sequence comparisons indicate that the evolution of the maize mitochondrial 18S, chloroplast 16S and nuclear 17S ribosomal genes have been essentially independent, in spite of evidence for DNA transfer between organelles and the nucleus.     

Structure and evolution of the 4.5-5S ribosomal RNA intergenic region from Glycine max (soya bean).

The nucleotide sequence for the 4.5-5S ribosomal DNA region from the chloroplastids of soya beans was determined as the basis of further comparative studies on the structure and evolution of this intergenic region. Comparisons with other plant sequences as well as equivalent sequences in eubacteria suggest that the longer internal transcribed spacer regions of plants have evolved, at least in part, by DNA sequence duplications and that the presence of the 4.5S rRNA in chloroplast may result from the accidental acquisition of a RNA maturation site during the evolution of longer internal transcribed spacer regions. Estimates of the secondary structures also indicate only a very limited retention of structural features and suggest that the primary role of the intergenic sequences may be to bring processed sites into close proximity.