Structural competition involving G-quadruplex DNA and its complement

Structural competition between the G-quadruplex, the I-motif, and the Watson-Crick duplex has been implicated for repetitive DNA sequences, but the competitive mechanism of these multistranded structures still needs to be elucidated. We investigated the effects of sequence context, cation species, and pH on duplex formation by the G-quadruplex of dG(3)(T(2)AG(3))(3) and its complement the I-motif of d(C(3)TA(2))(3)C(3), using ITC, DSC, PAGE, CD, UV, and CD stopped-flow kinetic techniques. ITC and PAGE experiments confirmed Watson-Crick duplex formation by the complementary strands. The binding constant of the two DNA strands in the presence of 10 mM Mg(2+) at pH 7.0 was shown to be 5.28 x 10(7) M(-1) at 20 degrees C, about 400 times larger than that in the presence of 100 mM Na(+) at pH 5.5. The dynamic transition traces of the duplex formation from the equimolar mixture of G-/C-rich complementary sequences were obtained at both pH 7.0 and pH 5.5. Fitting to a single-exponential function gave an observed rate of 8.06 x 10(-3) s(-1) at 20 degrees C in 10 mM Mg(2+) buffer at pH 7.0, which was about 10 times the observed rate at pH 5.5 under the same conditions. Both of the observed rates increased as temperature rose, implying that the dissociation of the single-stranded structured DNAs is the rate-limiting step for the WC duplex formation. The difference between the apparent activation energy at pH 7.0 and that at pH 5.5 reflects the fact that pH significantly influences the structural competition between the G-quadruplex, the I-motif, and the Watson-Crick duplex, which also implies a possible biological role for I-motifs in biological regulation.     

Spectroscopic probing of recognition of the G-quadruplex in c-kit promoter by small-molecule natural products

The c-kit oncogene plays important roles in cell growth and proliferation which is associated with many human tumors. In this study, electrospray ionization mass spectrometry (ESI-MS) and circular dichroism (CD) spectroscopy were used to evaluate the formation and recognition of the G-quadruplex by d(AGGGAGGGCGCTGGGAGGAGGG) in the promoter region of the c-kit oncogene. Among the twelve small natural molecules studied, three crescent-shaped small molecules (chelerythrine, jatrorrhizine and berberine, named as P1-P3) and one flexible cyclic small molecule (fangchinoline, named as P4) were found to bind to the G-quadruplex with high affinities. The melting experiments demonstrate that P1-P4 can significantly enhance the stability of the G-quadruplex with the ordering of P1≈P4>P3>P2. Further insight into the binding mode of small molecules with the G-quadruplex by Autodock3 analysis reveals that P1-P3 prefer the end-stacking mode with the G-quadruplex through π-π interaction and P4 prefers to insert into the groove outside the G-tetrads. Thus, our research finds that four ligands (P1-P4) from small natural molecules have high affinity to, and can significantly enhance the stability of the G-quadruplex in the promoter region of the c-kit oncogene.     

Resolution of a structural competition involving dimeric G-quadruplex and its C-rich complementary strand

The resolution of the dimeric intermolecular G-quadruplex/duplex competition of the telomeric DNA sequence 5′-TAG GGT TAG GGT-3′ and of its complementary 5′ ACC CTA ACC CTA-3′ is reported. To achieve this goal, melting experiments of both sequences and of the mixtures of these sequences were monitored by molecular absorption, molecular fluorescence and circular dichroism spectroscopies. Molecular fluorescence measurements were carried out using molecular beacons technology, in which the 5′-TAG GGT TAG GGT-3′ sequence was labelled with a fluorophore and a quencher at the ends of the strand. Mathematical analysis of experimental spectroscopic data was performed by means of multivariate curve resolution, allowing the calculation of concentration profiles and pure spectra of all resolved structures (dimeric antiparallel and parallel G-quadruplexes, Watson–Crick duplex and single strands) present in solution. Our results show that parallel G-quadruplex is more stable than antiparallel G-quadruplex. When the complementary C-rich strand is present, a mixture of both G-quadruplex structures and Watson–Crick duplex is observed, the duplex being the major species. In addition to melting temperatures, equilibrium constants for the parallel/antiparallel G-quadruplex equilibrium and for the G-quadruplex/duplex equilibrium were determined from the concentration profiles.     

Structural insights into the anti-cancer activity of quercetin on G-tetrad,mixed G-tetrad,and G-quadruplex DNA using quantum chemical and molecular dynamics simulations

Abstract

Human telomerase referred as ‘terminal transferase’ is a nucleoprotein enzyme which inhibits the disintegration of telomere length and act as a drug target for the anticancer therapy. The tandem repeating structure of telomere sequence forms the guanine-rich quadruplex structures that stabilize stacked tetrads. In our present work, we have investigated the interaction of quercetin with DNA tetrads using DFT. Geometrical analysis revealed that the influence of quercetin drug induces the structural changes into the DNA tetrads. Among DNA tetrads, the quercetin stacked with GCGC tetrad has the highest interaction energy of ?88.08?kcal/mol. The binding mode and the structural stability are verified by the absorption spectroscopy method. The longer wavelength was found at 380?nm and it exhibits bathochromic shift. The findings help us to understand the binding nature of quercetin drug with DNA tetrads and it also inhibits the telomerase activity. Further, the quercetin drug interacted with G-quadruplex DNA by using molecular dynamics (MD) simulation studies for 100?ns simulation at different temperatures and different pH levels (T?=?298 K, 320?K and pH = 7.4, 5.4). The structural stability of the quercetin with G-quadruplex structure is confirmed by RMSD. For the acidic condition (pH = 5.4), the binding affinity is higher toward G-quadruplex DNA, this result resembles that the quercetin drug is well interacted with G-quadruplex DNA at acidic condition (pH = 7.4) than the neutral condition. The obtained results show that quercetin drug stabilizes the G-quadruplex DNA, which regulates telomerase enzyme and it potentially acts as a novel anti-cancer agent.

Communicated by Ramaswamy H. Sarma     

Effect of competition intensity on recruitment of palatable and unpalatable grasses

In this study, we made an attempt to reveal how competition intensity from established plants impacts on palatable and unpalatable grass seedlings recruitment, in a natural mesic grassland of central Argentina. Our objective was to assess the seedling recruitment of a palatable species (Chascolytrum subaristatum) and an unpalatable species (Nassella trichotoma) in microsites differing in competition intensity from established plants. Identity (C. subaristatum and N. trichotoma) and defoliation severity were used as surrogate for competition intensity. In March 2017, we permanently marked established individuals of N. trichotoma and C. subaristatum and placed two circular plots adjacent to each individual. In one plot we added seeds of N. trichotoma and in the other seeds of C. subaristatum. After seeding, established plants were randomly assigned to one of three level of defoliation: without defoliation, low defoliation severity and high defoliation severity. From April to November 2017 (i.e. over a complete annual growing cycle), we measured seedling density, recruitment and growth. Our results supported the hypothesis that seedlings of palatable grasses are more competitive than seedlings of unpalatable grasses. Seedling of the palatable grass C. subaristatum recruited successfully regardless the intensity of competition from established plants, whereas seedlings of the unpalatable grass N. trichotoma recruited better under low competitive pressure from established plants. Our results suggest that the availability of microsites with low competitive pressure from the established vegetation, created by selective grazing of palatable grasses, promotes the recruitment of unpalatable grass seedlings. This mechanism may contribute to the species replacement process commonly observed in heavy grazed grasslands.     

G-quadruplex DNA cleavage preference and identification of a perylene diimide G-quadruplex photocleavage agent using a rapid fluorescent assay

A rapid fluorescence assay for G-quadruplex DNA cleavage was used to investigate the preference of TMPyP4 photochemical and Mn·TMPyP4 oxidative cleavage. Both agents most efficiently cleave the c-Myc promoter G-quadruplex. Direct PAGE analysis of selected assay samples showed that for a given cleavage agent, different cleavage products are formed from different G-quadruplex structures. Cleavage assays carried out in the presence of excess competitor nucleic acid structures revealed the binding selectivity of cleavage agents, while comparisons with duplex cleavage efficiency employing a dual-labeled hairpin oligonucleotide revealed neither agent prefers G-quadruplex over duplex substrates. Finally, this assay was used to identify the perylene diimide Tel11 as a photocleavage agent for the c-Myc G-quadruplex.     

Follicular dynamics around the recruitment of the first follicular wave in the cow

The present study aimed to test the generally accepted view that a follicular wave starts with follicles newly recruited from the population smaller than 3 mm, which later compete for dominance. According to this view, subordinate follicles are expected to be too atretic to join the next follicular wave. Ten cows were ovariectomized shortly prior to the LH surge, thus around the start of the first follicular wave of the cycle. Per cow, on average, 14.4 follicles of >/=3 mm were dissected. Follicular health was determined on the basis of four parameters: 1) judgment of the degree of atresia by stereomicroscope, 2) incidence of apoptotic nuclei among the granulosa cells, 3) estradiol and progesterone concentrations, and 4) insulin-like growth factor-I (IGF-I) binding proteins (IGFBPs)-2, -4, and -5 concentrations in the follicular fluid. In addition to the preovulatory follicle, 3.1 other follicles, mainly sized 3-4.5 mm, were found to be healthy based on the proportion of apoptotic nuclei, and concentrations of estradiol/progesterone, and IGFBPs. The ability of these follicles to respond with growth on the preovulatory and periovulatory FSH surges was supported by a comparison to the follicular population of four cows 31-68 h after the LH surge. The present results point to an alteration of the view on the follicular wave. The larger follicles during the first days of the follicular wave are, in general, derived from follicles that also joined the previous wave. A portion of these growing follicles are estradiol active and compete for dominance. Other growing follicles lack estradiol production and are probably derived from rather atretic follicles. The first newly recruited follicles do not reach the size of 3 mm before 31 h after the preovulatory FSH surge. At that time, the larger follicles are already competing for dominance.     

Probe development for detection of TERRA 1 intramolecular G-quadruplex formation using a fluorescent adenosine derivative

We developed a probing system to detect the intramolecular G-quadruplex of telomeric repeat-containing RNA (TERRA 1). We used a fluorescent adenosine derivative rA^py as a fluorophore and incorporated it into the dangling position of the parallel-type G-quadruplex sequence of TERRA 1. The rA^py-modified G-quadruplex structure exhibited a strong fluorescence emission signal, while the emission signals of the single-strand and duplex structures were much lower.     

Dissipative particle dynamics simulations for biological tissues: rheology and competition

In this work, we model biological tissues using a simple, mechanistic simulation based on dissipative particle dynamics. We investigate the continuum behavior of the simulated tissue and determine its dependence on the properties of the individual cell. Cells in our simulation adhere to each other, expand in volume, divide after reaching a specific size checkpoint and undergo apoptosis at a constant rate, leading to a steady-state homeostatic pressure in the tissue. We measure the dependence of the homeostatic state on the microscopic parameters of our model and show that homeostatic pressure, rather than the unconfined rate of cell division, determines the outcome of tissue competitions. Simulated cell aggregates are cohesive and round up due to the effect of tissue surface tension, which we measure for different tissues. Furthermore, mixtures of different cells unmix according to their adhesive properties. Using a variety of shear and creep simulations, we study tissue rheology by measuring yield stresses, shear viscosities, complex viscosities as well as the loss tangents as a function of model parameters. We find that cell division and apoptosis lead to a vanishing yield stress and fluid-like tissues. The effects of different adhesion strengths and levels of noise on the rheology of the tissue are also measured. In addition, we find that the level of cell division and apoptosis drives the diffusion of cells in the tissue. Finally, we present a method for measuring the compressibility of the tissue and its response to external stress via cell division and apoptosis.     

Single strand DNA catenane synthesis using the formation of G-quadruplex structure

DNA is a good material for constructing nanostructures such as DNA origami. One of the challenges in this field is constructing a topologically complex structure. Here, we synthesized a DNA catenane through the formation of a G-quadruplex structure. The formation of the DNA catenane was investigated by gel electrophoresis. Interestingly, the synthesized DNA catenane was destroyed by heat treatment. Because conventional methods to construct DNA catenane include enzymatic ligation or chemical reactions, DNA is cyclized by covalent bond connection and never destroyed by heat treatment. To our knowledge, this is the first report of the synthesis of DNA catenane without using covalent bonds. Our novel way of synthesizing DNA catenane may be of use in easily recoverable DNA topological labeling.     

Binding to G-quadruplex RNA activates the mitochondrial GTPase NOA1

NOA1 is an evolutionary conserved, nuclear encoded GTPase essential for mitochondrial function and cellular survival. The function of NOA1 for assembly of mitochondrial ribosomes and regulation of OXPHOS activity depends on its GTPase activity, but so far no ligands have been identified that regulate the GTPase activity of NOA1. To identify nucleic acids that bind to the RNA-binding domain of NOA1 we employed SELEX (Systemic Evolution of Ligands by EXponential Enrichment) using recombinant mouse wildtype NOA1 and the GTPase mutant NOA1-K353R. We found that NOA1 binds specifically to oligonucleotides that fold into guanine tetrads (G-quadruplexes). Binding of G-quadruplex oligonucleotides stimulated the GTPase activity of NOA1 suggesting a regulatory link between G-quadruplex containing RNAs, NOA1 function and assembly of mitochondrial ribosomes.     

Leukocytes rolling and recruitment by endothelial cells: hemorheological experiments and numerical simulations

The recruitment of leukocytes from the blood stream and their subsequent adhesion to endothelial walls are essential stages to the immune response system during inflammation. The precise dynamic mechanisms by which molecular mediators facilitate leukocyte arrests are still unknown. In this study combined experimental results and computer simulations are used to investigate localized hydrodynamics of individual and collective behavior of clusters of leukocytes. Leukocyte-endothelial cell interactions in post-capillary venules of Wistar rats cremaster muscle were monitored by intravital microscopy. From these experiments the hemorheologic and hemodynamical measured parameters were used in time dependent three-dimensional computer simulations, using a mesoscopic lattice Boltzmann flow solver for shear thinning fluids. The dynamics of leukocyte clusters under generalized Newtonian blood flow with shear thinning viscosity was computed and discussed. In this paper we present quantified distributions of velocity and shear stress on the surface of leukocytes and near vessel wall attachment points. We have observed one region of maximum shear stress and two regions of minimum shear stress on the surface of leukocytes close to the endothelial wall. We verified that the collective hydrodynamic behavior of the cluster of recruited leukocytes establishes a strong motive for additional leukocyte recruitment. It was found that the lattice Boltzmann solver used here is fully adaptive to the measured experimental parameters. This study suggests that the influence of the leukocytes rolling on the increase of the endothelial wall shear stress may support the activation of more signalling mediators during inflammation.     

Computer-assisted simulations of phosphofructokinase-1 kinetics using simplified velocity equations

Equations useful for simulating the kinetic behavior of phosphofructokinase are presented. The equations, which are based on the concerted transition (symmetry) model for allosteric enzymes, account for substrate inhibition by MgATP, cooperative binding by F-6-P, activation by F-2,6-P₂, and deinhibition by AMP. Velocity calculations can be performed using either a spreadsheet program (e.g., MS Excel) or a web-based program (e.g., Authorware). Both approaches are illustrated.     

Thermodynamic characterization of OsGID1-gibberellin binding using calorimetry and docking simulations

Gibberellins (GAs) are phytohormones regulating various developmental processes in plants. In rice, the initial GA-signaling events involve the binding of a GA to the soluble GA receptor protein, GID1. Although X-ray structures for certain GID1/GA complexes have recently been determined, an examination of the complexes does not fully clarify how GID1s discriminate among different GAs. Herein, we present a study aimed at defining the types of forces important to binding via a combination of isothermal titration calorimetry (ITC) and computational docking studies that employed rice GID1 (OsGID1), OsGID1 mutants, which were designed to have a decreased possible number of hydrogen bonds with bound GA, and GA variants. We find that, in general, GA binding is enthalpically driven and that a hydrogen bond between the phenolic hydroxyl of OsGID1 Tyr134 and the C-3 hydroxyl of a GA is a defining structural element. A hydrogen-bond network that involves the C-6 carboxyl of a GA that directly hydrogen bonds the hydroxyl of Ser198 and indirectly, via a two-water-molecule network, the phenolic hydroxyl of Tyr329 and the NH of the amide side-chain of Asn255 is also important for GA binding. The binding of OsGID1 by GA(1) is the most enthalpically driven association found for the biologically active GAs evaluated in this study. This observation might be a consequence of a hydrogen bond formed between the hydroxyl at the C-13 position of GA(1) and the main chain carbonyl of OsGID1 Phe245. Our results demonstrate that by combining ITC experiments and computational methods much can be learned about the thermodynamics of ligand/protein binding.     

The ionic atmosphere around A-RNA: Poisson-Boltzmann and molecular dynamics simulations

The distributions of different cations around A-RNA are computed by Poisson-Boltzmann (PB) equation and replica exchange molecular dynamics (MD). Both the nonlinear PB and size-modified PB theories are considered. The number of ions bound to A-RNA, which can be measured experimentally, is well reproduced in all methods. On the other hand, the radial ion distribution profiles show differences between MD and PB. We showed that PB results are sensitive to ion size and functional form of the solvent dielectric region but not the solvent dielectric boundary definition. Size-modified PB agrees with replica exchange molecular dynamics much better than nonlinear PB when the ion sizes are chosen from atomistic simulations. The distribution of ions 14 Å away from the RNA central axis are reasonably well reproduced by size-modified PB for all ion types with a uniform solvent dielectric model and a sharp dielectric boundary between solvent and RNA. However, this model does not agree with MD for shorter distances from the A-RNA. A distance-dependent solvent dielectric function proposed by another research group improves the agreement for sodium and strontium ions, even for shorter distances from the A-RNA. However, Mg²⁺ distributions are still at significant variances for shorter distances.     

c-MYC promoter G-quadruplex formed at the 5'-end of NHE III1 element: insights into biological relevance and parallel-stranded G-quadruplex stability

We studied the structures and stabilities of G-quadruplexes formed in Myc1234, the region containing the four consecutive 5' runs of guanines of c-MYC promoter NHE III(1,) which have recently been shown to form in a supercoiled plasmid system in aqueous solution. We determined the NMR solution structure of the 1:2:1 parallel-stranded loop isomer, one of the two major loop isomers formed in Myc1234 in K(+) solution. This major loop isomer, although sharing the same folding structure, appears to be markedly less stable than the major loop isomer formed in the single-stranded c-MYC NHE III(1) oligonucleotide, the Myc2345 G-quadruplex. Our NMR structures indicated that the different thermostabilities of the two 1:2:1 parallel c-MYC G-quadruplexes are likely caused by the different base conformations of the single nucleotide loops. The observation of the formation of the Myc1234 G-quadruplex in the supercoiled plasmid thus points to the potential role of supercoiling in the G-quadruplex formation in promoter sequences. We also performed a systematic thermodynamic analysis of modified c-MYC NHE III(1) sequences, which provided quantitative measure of the contributions of various loop sequences to the thermostabilities of parallel-stranded G-quadruplexes. This information is important for understanding the equilibrium of promoter G-quadruplex loop isomers and for their drug targeting.