Amsacta moorei Entomopoxvirus inhibitor of apoptosis suppresses cell death by binding Grim and Hid

Inhibitor of apoptosis (iap) genes have been identified in the genomes of two independent families of insect viruses, the Baculoviridae and the Entomopoxvirinae. In this report, we examined the functional attributes of the Amsacta moorei entomopoxvirus-encoded IAP protein (AMV-IAP). The binding specificity of the individual baculoviral IAP repeat (BIR) domains of AMV-IAP was investigated by using a random-peptide, phage display library, and sequences similar to the amino termini of proapoptotic Drosophila proteins in the Reaper/Hid/Grim family were identified. Furthermore, the BIR domains of AMV-IAP protein were demonstrated to bind the mammalian IAP inhibitor Smac through the AVPI tetrapeptide sequence, suggesting that the peptide binding pocket and groove found in the insect and mammalian IAPs is conserved in this viral protein. Interaction analysis implicated BIR1 as the high-affinity site for Grim, while BIR2 interacted more strongly with Hid. Both Grim and Hid were demonstrated to interact with AMV-IAP in vivo, and Grim- or Hid-induced cell death was suppressed when AMV-IAP was coexpressed.     

A dimeric Smac/diablo peptide directly relieves caspase-3 inhibition by XIAP. Dynamic and cooperative regulation of XIAP by Smac/Diablo

Caspase activation, the executing event of apoptosis, is under deliberate regulation. IAP proteins inhibit caspase activity, whereas Smac/Diablo antagonizes IAP. XIAP, a ubiquitous IAP, can inhibit both caspase-9, the initiator caspase of the mitochondrial apoptotic pathway, and the downstream effector caspases, caspase-3 and caspase-7. Smac neutralizes XIAP inhibition of caspase-9 by competing for binding of the BIR3 domain of XIAP with caspase-9, whereas how Smac liberates effector caspases from XIAP inhibition is not clear. It is generally believed that binding of Smac with IAP generates a steric hindrance that prevents XIAP from inhibiting effector caspases, and therefore small molecule mimics of Smac are not able to reverse inhibition of the effector caspases. Surprisingly, we show here that binding of a dimeric Smac N-terminal peptide with the BIR2 domain of XIAP effectively antagonizes inhibition of caspase-3 by XIAP. Further, we defined the dynamic and cooperative interaction of Smac with XIAP: binding of Smac with the BIR3 domain anchors the subsequent binding of Smac with the BIR2 domain, which in turn attenuates the caspase-3 inhibitory function of XIAP. We also show that XIAP homotrimerizes via its C-terminal Ring domain, making its inhibitory activity toward caspase-3 more susceptible to Smac.     

Sequence requirements for binding of Rep68 to the adeno-associated virus terminal repeats.

We have used reciprocal competition binding experiments with mutant substrates and chemical modification interference assays to precisely define the sequences within the adeno-associated virus (AAV) terminal repeat (TR) that are involved in site-specific binding to the AAV Rep protein. Mutagenesis experiments were done with a 43-bp oligonucleotide which contained the Rep binding element (RBE) within the A stem of the TR. Experiments in which two adjacent base pairs of the RBE were substituted simultaneously with nucleotides that produced transversions identified a 22-bp sequence (CAGTGAGCGAGCGAGCGCGCAG) in which substitutions measurably affected the binding affinity. Although the 22-bp RBE contains the GAGC motifs that have been found in all known Rep binding sites, our results suggest that the GAGC motifs alone are not the only sequences specifically recognized by Rep. The effects of substitutions within the 22-bp sequence were relatively symmetrical, with nucleotides at the periphery of the RBE having the least effect on binding affinity and those in the middle having the greatest effect. Dinucleotide mutations within 18 (GTGAGCGAGCGAGC) of the 22 bp were found to decrease the binding affinity by at least threefold. Dinucleotide mutations within a 10-bp core sequence (GCGAGCGAGC) were found to decrease binding affinity by more than 10-fold. Single-base substitutions within the 10-bp core sequence lowered the binding affinity by variable amounts (up to fivefold). The results of the mutagenesis analysis suggested that the A-stem RBE contains only a single Rep binding site rather than two or more independent sites. To confirm the results of the mutant analysis and to determine the relative contribution of each base to binding, chemical modification experiments using dimethyl sulfate and hydrazine were performed on both the linear A-stem sequence and the entire AAV TR in both the flip and flop hairpinned configurations. Interference assays on the linear A stem identified the 18-bp sequence described above as essential for binding. G, C, and T residues on both strands contributed to binding, and the interference pattern correlated well with the results of the mutagenesis experiments. Interference assays with complete hairpinned TR substrates also identified the 18-bp sequence as important for binding. However, the interference patterns on the two strands within the RBE and the relative contributions of the individual bases to binding were clearly different between the hairpinned substrates and the linear A-stem binding element. Interference assays also allowed us to search for residues within the small internal palindromes of the TR (B and C) that contribute to binding. The largest effect was seen by modification of two T residues within the sequence CTTTG. This sequence was present in the same position relative to the terminal resolution site (trs) in both the flip and flop orientations of the TR. In addition, the interference pattern suggested that the remaining bases within the CTTTG motif as well as other bases within the B and C palindromes make contacts with the Rep protein, albeit with lower affinities. Regardless of whether the TR was in the flip or flop orientation, most of the contact points were clustered in the small internal palindrome furthest away from the trs. We also determined the relative binding affinity of linear substrates containing a complete RBE with hairpinned substrates and found that linear substrates bound Rep less efficiently. Our results were consistent with our previous model that there are three distinct elements within the hairpinned AAV TR that contribute to binding affinity or to efficient nicking at the trs: the A-stem RBE, the secondary structure element which consists of the B and C palindromes, and the trs.     

Resveratrol binds to the sulfonylurea receptor (SUR) and induces apoptosis in a SUR subtype-specific manner

Sulfonylurea receptors (SURs) constitute the regulatory subunits of ATP-sensitive K+ channels (K(ATP) channels). SUR binds nucleotides and synthetic K(ATP) channel modulators, e.g. the antidiabetic sulfonylurea glibenclamide, which acts as a channel blocker. However, knowledge about naturally occurring ligands of SUR is very limited. In this study, we show that the plant phenolic compound trans-resveratrol can bind to SUR and displace binding of glibenclamide. Electrophysiological measurements revealed that resveratrol is a blocker of pancreatic SUR1/K(IR)6.2 K(ATP) channels. We further demonstrate that, like glibenclamide, resveratrol induces enhanced apoptosis. This was shown by analyzing different apoptotic parameters (cell detachment, nuclear condensation and fragmentation, and activities of different caspase enzymes). The observed apoptotic effect was specific to cells expressing the SUR1 isoform and was not mediated by the electrical activity of K(ATP) channels, as it was observed in human embryonic kidney 293 cells expressing SUR1 alone. Enhanced susceptibility to resveratrol was not observed in pancreatic beta-cells from SUR1 knock-out mice or in cells expressing the isoform SUR2A or SUR2B or the mutant SUR1(M1289T). Resveratrol was much more potent than glibenclamide in inducing SUR1-specific apoptosis. Treatment with etoposide, a classical inducer of apoptosis, did not result in SUR isoform-specific apoptosis. In conclusion, resveratrol is a natural SUR ligand that can induce apoptosis in a SUR isoform-specific manner. Considering the tissue-specific expression patterns of SUR isoforms and the possible effects of SUR mutations on susceptibility to apoptosis, these observations could be important for diabetes and/or cancer research.     

Requirement of both the second and third BIR domains for the relief of X-linked inhibitor of apoptosis protein (XIAP)-mediated caspase inhibition by Smac

The inhibitor of apoptosis proteins (IAP) are endogenous caspase inhibitors in the metazoan and characterized by the presence of baculoviral IAP repeats (BIR). X-linked IAP (XIAP) contains three BIR domains and directly inhibits effector caspases such as caspase-7 via a linker_BIR2 fragment and initiator caspases such as caspase-9 via the BIR3 domain. A mitochondrial protein Smac/DIABLO, which is released during apoptosis, antagonizes XIAP-mediated caspase inhibition by interacting directly with XIAP. Here, using glutathione S-transferase pulldown and caspase activity assay, we show that Smac is ineffective in relieving either caspase-7 or caspase-9 inhibition by XIAP domain fragments. In addition, Smac forms a ternary complex with caspase-7 and linker_BIR2, suggesting that Smac/linker_BIR2 interaction does not sterically exclude linker_BIR2/caspase-7 interaction. However, Smac is effective in removing caspase-7 and caspase-9 inhibition by XIAP fragments containing both the BIR2 and BIR3 domains. Surface plasmon resonance measurements show that Smac interacts with the BIR2 or BIR3 domain in micromolar dissociation constants. On the other hand, Smac interacts with an XIAP construct containing both BIR2 and BIR3 domains in a subnanomolar dissociation constant by the simultaneous interaction of the Smac dimer with the BIR2 and BIR3 domains of a single XIAP molecule. This 2:1 Smac/XIAP interaction not only possesses enhanced affinity but also sterically excludes XIAP/caspase-7 interaction, demonstrating the requirement of both BIR2 and BIR3 domains for Smac to relieve XIAP-mediated caspase inhibition.     

The anaphase inhibitor Pds1 binds to the APC/C-associated protein Cdc20 in a destruction box-dependent manner.

An essential aspect of progression through mitosis is the sequential degradation of key mitotic regulators in a process that is mediated by the anaphase promoting complex/cyclosome (APC/C) ubiquitin ligase [1]. In mitotic cells, two forms of the APC/C exist, APC/C(Cdc20) and APC/C(Cdh1), which differ in their associated WD-repeat proteins (Cdc20 and Cdh1, respectively), time of activation, and substrate specificity [2, 3]. How the WD-repeat proteins contribute to APC/C's activation and substrate specificity is not clear. Many APC/C substrates contain a destruction box element that is necessary for their ubiquitination [4-6]. One such APC/C substrate, the budding yeast anaphase inhibitor Pds1 (securin), is degraded prior to anaphase initiation in a destruction box and APC/C(Cdc20)-dependent manner [3, 7]. Here we find that Pds1 interacts directly with Cdc20 and that this interaction requires Pds1's destruction box. Our results suggest that Cdc20 provides a link between the substrate and the core APC/C and that the destruction box is essential for efficient Cdc20-substrate interaction. We also find that Pds1 does not interact with Cdh1. Finally, the effect of spindle assembly checkpoint activation, known to inhibit APC/C function [8], on the Pds1-Cdc20 interaction is examined.     

Cellular inhibitor of apoptosis 1 and 2 are ubiquitin ligases for the apoptosis inducer Smac/DIABLO

Inhibitors of apoptosis (IAPs) are crucial regulators of programmed cell death. The mechanism by which IAPs prevent apoptosis has previously been attributed to the direct inhibition of caspases. The function of mammalian IAPs is counteracted by cell death inducer second mitochondria-derived activator of caspases (Smac)/DIABLO during apoptosis. Here we show that cIAP1 and cIAP2 are E3 ubiquitin-protein isopeptide ligases (ubiquitin ligases) for Smac. cIAPs stimulate Smac ubiquitination both in vivo and in vitro, leading to Smac degradation. cIAP1 and cIAP2 associate with overlapping but distinct subsets of E2 (ubiquitin carrier protein) ubiquitin-conjugating enzymes. The substrate-dependent E3 activity of cIAPs is mediated by their RING domains and is dependent on the specific interactions between cIAPs and Smac. Similarly, Drosophila IAP1 also possesses ubiquitin ligase activity that mediates the degradation of the Drosophila apoptosis inducers Grim and HID. These results suggest a novel and conserved mechanism by which IAPs block apoptosis through the degradation of death inducers.     

Inhibiting apoptosis in mammalian cell culture using the caspase inhibitor XIAP and deletion mutants.

Lower yields and poorer quality of biopharmaceutical products result from cell death in bioreactors. Such cell death may occur from necrosis but is more commonly associated with apoptosis. During the process of programmed cell death or apoptosis, caspases become activated and cause a cascade of events that eventually destroy the cell. XIAP is the most potent caspase inhibitor encoded in the mammalian genome. The effectiveness of XIAP and its deletion mutants was examined in two cell lines commonly utilized in commercial bioreactors: Chinese hamster ovary (CHO) and 293 human embryonic kidney (293 HEK) cells. CHO cells undergo apoptosis as a result of various insults, including Sindbis virus infection and serum deprivation. In this study, we demonstrate that 293 HEK cells undergo apoptosis during Sindbis virus infection and exposure to the toxins, etoposide and cisplatin. Two deletion mutants of XIAP were created; one containing three tandem baculovirus iap repeat (BIR) domains and the other containing only the C-terminal RING domain, lacking the BIRs. Viability studies were performed for cells expressing each mutant and the wild-type protein on transiently transfected cells, as stable pools, or as stable clonal cell populations after induction of apoptosis by serum deprivation, Sindbis virus infection, etoposide, and cisplatin treatment. Expression of the wild-type XIAP inhibited apoptosis significantly; however, the XIAP mutant containing the three BIRs provided equivalent or improved levels of apoptosis inhibition in all cases. Expression of the RING domain offered no protection and was pro-apoptotic in transient expression experiments. With the aid of an N-terminal YFP fusion to each protein, distribution within the cell was visualized, and the wild-type and mutants showed differing intracellular accumulation patterns. While the wild-type XIAP protein accumulated primarily in aggregates in the cytosol, the RING mutant was enriched in the nucleus. In contrast, the deletion mutant containing the three BIRs was distributed evenly throughout the cytosol. Thus, protein engineering of the XIAP protein can be used to alter the intracellular distribution pattern and improve the ability of this caspase inhibitor to protect against apoptosis for two mammalian cell lines.     

Caspase inhibitor P35 and inhibitor of apoptosis Op-IAP block in vivo proteolytic activation of an effector caspase at different steps

Signal-induced activation of caspases, the critical protease effectors of apoptosis, requires proteolytic processing of their inactive proenzymes. Consequently, regulation of procaspase processing is critical to apoptotic execution. We report here that baculovirus pancaspase inhibitor P35 and inhibitor of apoptosis Op-IAP prevent caspase activation in vivo, but at different steps. By monitoring proteolytic processing of endogenous Sf-caspase-1, an insect group II effector caspase, we show that Op-IAP blocked the first activation cleavage at TETD downward arrowG between the large and small caspase subunits. In contrast, P35 failed to affect this cleavage, but functioned downstream to block maturation cleavages (DXXD downward arrow(G/A)) of the large subunit. Substitution of P35's reactive site residues with TETDG failed to increase its effectiveness for blocking TETD downward arrowG processing of pro-Sf-caspase-1, despite wild-type function for suppressing apoptosis. These data are consistent with the involvement of a novel initiator caspase that is resistant to P35, but directly or indirectly inhibitable by Op-IAP. The conservation of TETD downward arrowG processing sites among insect effector caspases, including Drosophila drICE and DCP-1, suggests that in vivo activation of these group II caspases involves a P35-insensitive caspase and supports a model wherein apical and effector caspases function through a proteolytic cascade to execute apoptosis in insects.     

Elucidation of structural requirements on plasminogen activator inhibitor 1 for binding to heparin.

Plasminogen activator inhibitor 1 (PAI-1), a member of the serpin superfamily of proteins, has been demonstrated previously to interact functionally with the glycosaminoglycan heparin (Ehrlich, H.J., Keijer, J., Preissner, K. T., Klein Gebbink, R., and Pannekoek, H. (1991) Biochemistry 30, 1021-1028). Heparin specifically enhances the rate of association between PAI-1 and thrombin about 2 orders of magnitude, whereas no effect is detected with other serine proteases (e.g. factor Xa). For the heparin-dependent serpins antithrombin III and heparin cofactor II, basic amino acid residues in and around the helix D subdomain were proposed to be involved in the binding of glycosaminoglycans. Here we employed site-directed mutagenesis of full-length PAI-1 cDNA to identify the amino acid residues that mediate heparin binding. To that end, 15 single-point mutants of PAI-1, each having individual arginyl, lysyl, or histidyl residues replaced by a neutral (alanyl) residue ("ala-scan"), and one double mutant were constructed, expressed in Escherichia coli, and purified to apparent homogeneity. The purified biologically active proteins were subjected to the following analyses: (i) heparin-dependent inhibition of thrombin; (ii) heparin-dependent formation of sodium dodecyl sulfate-stable complexes with thrombin; and (iii) binding to and elution from heparin-Sepharose. Based on the data presented, we propose that the amino acid residues Lys65, Lys69, Arg76, Lys80, and Lys88 constitute major determinants for heparin binding of PAI-1. These residues are located in and around the helix D domain and are conserved in the other heparin-dependent thrombin inhibitors, antithrombin III and heparin cofactor II.     

Doom, a product of the Drosophila mod(mdg4) gene, induces apoptosis and binds to baculovirus inhibitor-of-apoptosis proteins.

A family of baculovirus inhibitor-of-apoptosis (IAP) genes is present in mammals, insects, and baculoviruses, but the mechanism by which they block apoptosis is unknown. We have identified a protein encoded by the Drosophila mod(mdg4) gene which bound to the baculovirus IAPs. This protein induced rapid apoptosis in insect cells, and consequently we have named it Doom. Baculovirus IAPs and P35, an inhibitor of aspartate-specific cysteine proteases, blocked Doom-induced apoptosis. The carboxyl terminus encoded by the 3' exon of the doom cDNA, which distinguishes it from other mod(mdg4) cDNAs, was responsible for induction of apoptosis and engagement of the IAPs. Doom localized to the nucleus, while the IAPs localized to the cytoplasm, but when expressed together, Doom and the IAPs both localized in the nucleus. Thus, IAPs might block apoptosis by interacting with and modifying the behavior of Doom-like proteins that reside in cellular apoptotic pathways.     

Synthetic Smac/DIABLO peptides enhance the effects of chemotherapeutic agents by binding XIAP and cIAP1 in situ

Inhibitor of apoptosis proteins (IAPs) interact with and inhibit caspases-3, -7, and -9. This interaction can be inhibited by Smac/DIABLO, a polypeptide released from mitochondria upon initiation of the apoptotic signaling process. Here we demonstrate that the first 4-8 N-terminal amino acids of Smac/DIABLO fused to the Drosophila antennapaedia penetratin sequence, a carrier peptide, enhance the induction of apoptosis and long term antiproliferative effects of diverse antineoplastic agents including paclitaxel, etoposide, 7-ethyl-10-hydroxycamptothecin (SN-38), and doxorubicin in MCF-7 breast cancer cells. Similar effects were observed in additional breast cancer and immortalized cholangiocyte cell lines. Further analysis demonstrated that the Smac-penetratin fusion peptide crossed the cellular membrane, bound XIAP and cIAP1, displaced caspase-3 from cytoplasmic aggregates, and enhanced drug-induced caspase action in situ. These studies demonstrate that inhibition of IAP proteins can modulate the efficacy of antineoplastic agents.     

Intramitochondrial recruitment of endolysosomes mediates Smac degradation and constitutes a novel intrinsic apoptosis antagonizing function of XIAP E3 ligase

Intrinsic apoptosis involves BH3-only protein activation of Bax/Bak-mediated mitochondrial outer membrane permeabilization (MOMP). Consequently, cytochrome c is released from the mitochondria to activate caspases, and Smac (second mitochondria-derived activator of caspases) to inhibit XIAP-mediated caspase suppression. Dysfunctional mitochondria can be targeted for lysosomal degradation via autophagy (mitophagy), or directly through mitochondria-derived vesicle transport. However, the extent of autophagy and lysosomal interactions with apoptotic mitochondria remains largely unknown. We describe here a novel pathway of endolysosomal processing of mitochondria, activated in response to canonical BH3-only proteins and mitochondrial depolarization. We report that expression of canonical BH3-only proteins, tBid, Bim_EL, Bik, Bad, and mitophagy receptor mutants of atypical BH3-only proteins, Bnip3 and Bnip3L/Nix, leads to prominent relocalization of endolysosomes into inner mitochondrial compartments, in a manner independent of mitophagy. As an upstream regulator, we identified the XIAP E3 ligase. In response to mitochondrial depolarization, XIAP actuates Bax-mediated MOMP, even in the absence of BH3-only protein signaling. Subsequently, in an E3 ligase-dependent manner, XIAP rapidly localizes inside all the mitochondria, and XIAP-mediated mitochondrial ubiquitylation catalyses interactions of Rab membrane targeting components Rabex-5 and Rep-1 (RFP-tagged Rab escort protein-1), and Rab5- and Rab7-positive endolysosomes, at and within mitochondrial membrane compartments. While XIAP-mediated MOMP permits delayed cytochrome c release, within the mitochondria XIAP selectively signals lysosome- and proteasome-associated degradation of its inhibitor Smac. These findings suggest a general mechanism to lower the mitochondrial apoptotic potential via intramitochondrial degradation of Smac.The intrinsic mitochondrial apoptotic pathway is required for efficient chemotherapeutic killing of cancer cells,¹ and is initiated through BH3-only protein activation of Bax/Bak-mediated mitochondrial outer membrane permeabilization (MOMP). MOMP releases cytochrome c to activate effector caspases.² Conversely, inhibitor of apoptosis protein (IAP) family members suppress initiator and effector caspases via direct binding and E3 ligase activities.^{3, 4, 5} Consequently, MOMP-induced release of Smac (second mitochondria-derived activator of caspases) from the mitochondria, to inhibit XIAP (X-chromosome-linked IAP)-mediated caspase suppression, can be required for apoptosis.⁶Autophagy, a lysosomal degradative mechanism undergoing extensive crosstalk with cell death and survival pathways,⁷ degrades damaged mitochondria in a process termed mitophagy.^{8, 9} Damaged mitochondria are targeted by lysosomal degradation through the recruitment of autophagy receptors to the outer mitochondrial membrane (OMM),⁸ or via delivery of mitochondrial-derived vesicles (MDVs) directly to the lysosome.¹⁰ The E3 ubiquitin ligase Parkin targets and ubiquitylates mitochondria, mediating both MDV degradation¹¹ and autophagy receptor-dependent mitophagy.^{12, 13} Alternatively, Fundc1¹⁴ and atypical BH3-only Nip family proteins Bnip3 and Bnip3L/Nix localize to the OMM and act as mitophagy receptors via their LC3-interacting region (LIR).^{15, 16, 17, 18} While targeting of damaged mitochondria suggests that mitophagy may counter apoptotic mitochondria, mitophagy occurs progressively over days,^{12, 14, 16, 17, 19} a rate that is likely insufficient to alter intracellular propagation of mitochondrial apoptosis, which can occur within minutes.^{20, 21} Indeed, Bnip3- and Fundc1-induced mitophagy have no direct effect on apoptosis,^{14, 18} and we determined that Bnip3-mediated mitophagy was cytoprotective if activated before apoptosis.¹⁷ While MDV delivery of mitochondria to lysosomes operates at a higher rate, minutes to hours,¹⁰ this process is regulated by Parkin and restricted to specific mitochondrial components.¹¹ Overall, for most intrinsic apoptosis scenarios it remains unknown whether lysosomal processing of mitochondria influences their capacity to activate or enhance apoptosis.Here, we used high-resolution imaging to evaluate the behavior of apoptosis, autophagy, lysosomal and ubiquitylation pathways in response to canonical (tBid, Bim_EL, Bik, Bad) and atypical (Bnip3, Bnip3L/Nix) BH3-only protein expression. We report that, in parallel to intrinsic apoptosis signaling, canonical BH3-only proteins induce the recruitment of endolysosomal machinery, in the absence of mitophagy. We determined that mitochondrial depolarization rapidly translocates the caspase inhibitor XIAP to the mitochondria. There, XIAP actuates MOMP within all mitochondria, concomitant with ubiquitylation at the OMM and inside OMM-bound regions, and triggers ubiquitin-dependent recruitment of Rab5 and its binding partners, as well as late endosomes into the mitochondria. Consequently, in a manner dependent on lysosome- and proteasome-activities, XIAP degrades its inhibitor Smac. We propose that in response to bioenergetic stress, the functional integration between lysosomes and mitochondria, mediated by XIAP and independent of autophagy, offers a novel mechanism to modulate mitochondrial apoptosis.     

Cleavage of human inhibitor of apoptosis protein XIAP results in fragments with distinct specificities for caspases.

Several human inhibitor of apoptosis (IAP) family proteins function by directly inhibiting specific caspases in a mechanism that does not require IAP cleavage. In this study, however, we demonstrate that endogenous XIAP is cleaved into two fragments during apoptosis induced by the tumor necrosis factor family member Fas (CD95). The two fragments produced comprise the baculoviral inhibitory repeat (BIR) 1 and 2 domains (BIR1-2) and the BIR3 and RING (BIR3-Ring) domains of XIAP. Overexpression of the BIR1-2 fragment inhibits Fas-induced apoptosis, albeit at significantly reduced efficiency compared with full-length XIAP. In contrast, overexpression of the BIR3-Ring fragment results in a slight enhancement of Fas-directed apoptosis. Thus, cleavage of XIAP may be one mechanism by which cell death programs circumvent the anti-apoptotic barrier posed by XIAP. Interestingly, ectopic expression of the BIR3-Ring fragment resulted in nearly complete protection from Bax-induced apoptosis. Use of purified recombinant proteins revealed that BIR3-Ring is a specific inhibitor of caspase-9 whereas BIR1-2 is specific for caspases 3 and 7. Therefore XIAP possesses two different caspase inhibitory activities which can be attributed to distinct domains within XIAP. These data may provide an explanation for why IAPs have evolved with multiple BIR domains.     

Smac3, a novel Smac/DIABLO splicing variant, attenuates the stability and apoptosis-inhibiting activity of X-linked inhibitor of apoptosis protein

X-linked inhibitor of apoptosis protein (XIAP), the most potent member of the inhibitor of apoptosis protein (IAP) family, plays a crucial role in the regulation of apoptosis. XIAP is structurally characterized by three baculovirus IAP repeat (BIR) domains that mediate binding to and inhibition of caspases and a RING domain that confers ubiquitin ligase activity. The caspase inhibitory activity of XIAP can be eliminated by the second mitochondria-derived activator of caspases (Smac)/direct IAP-binding protein with low pI (DIABLO) during apoptosis. Here we report the identification and characterization of a novel isoform of Smac/DIABLO named Smac3, which is generated by alternative splicing of exon 4. Smac3 contains an NH2-terminal mitochondrial targeting sequence required for mitochondrial targeting of Smac3 and an IAP-binding motif essential for Smac3 binding to XIAP. Smac3 is released from mitochondria into the cytosol in response to apoptotic stimuli, where it interacts with the second and third BIR domains of XIAP. Smac3 disrupts processed caspase-9 binding to XIAP, promotes caspase-3 activation, and potentiates apoptosis. Strikingly, Smac3, but not Smac/DIABLO, accelerates XIAP auto-ubiquitination and destruction. Smac3-stimulated XIAP ubiquitination is contingent upon the physical association of XIAP with Smac3 and an intact RING domain of XIAP. Smac3-accelerated XIAP destabilization is, at least in part, attributed to its ability to enhance XIAP ubiquitination. Our study demonstrates that Smac3 is functionally additive to, but independent of, Smac/DIABLO.     

Xin-repeats and nebulin-like repeats bind to F-actin in a similar manner

Xin and nebulette are striated muscle-specific actin-binding proteins that both contain multiple actin-binding repeats. The nature of these repeats is different: nebulette has nebulin-like repeats, while Xin contains its own unique repeats. However, the suggestion was made from biochemical data that the Xin-repeats may bind to multiple sites on the actin molecule as was found for nebulin. We have used electron microscopy and the iterative helical real space reconstruction to visualize complexes of F-actin with Xin fragments containing either three or six Xin-repeats, and with the CN5-nebulette fragment, containing five nebulin-like repeats. Our results indicate that Xin and nebulette fragments bind to F-actin in a similar manner and in two distinct modes: in one mode actin subdomain 1 is bound, while in the second mode the binding bridges between a different site on actin subdomains 1/2 of one protomer and subdomains 3/4 of an adjacent actin protomer. Taken together with published data about nebulin, tropomyosin and ADF/cofilin, our results suggest that the ability to bind in multiple modes to the actin protomer is a general property of many actin-binding proteins.     

Sequence and structural requirements for high-affinity DNA binding by the WT1 gene product.

The Wilms' tumor suppressor gene, WT1, encodes a zinc finger polypeptide which plays a key role regulating cell growth and differentiation in the urogenital system. Using the whole-genome PCR approach, we searched murine genomic DNA for high-affinity WT1 binding sites and identified a 10-bp motif 5'GCGTGGGAGT3' which we term WTE). The WTE motif is similar to the consensus binding sequence 5'GCG(G/T)GGGCG3' recognized by EGR-1 and is also suggested to function as a binding site for WT1, setting up a competitive regulatory loop. To evaluate the underlying biochemical basis for such competition, we compared the binding affinities of WT1 and EGR1 for both sequences. WT1 shows a 20- to 30-fold-higher affinity for the WTE sequence compared with that of the EGR-1 binding motif. Mutational analysis of the WTE motif revealed a significant contribution to binding affinity by the adenine nucleotide at the eighth position (5'GCGTGGGAGT3') as well as by the 3'-most thymine (5'GCGTGGGAGT3'), whereas mutations in either flanking nucleotides or other nucleotides in the core sequence did not significantly affect the specific binding affinity. Mutations within WT1 zinc fingers II to IV abolished the sequence-specific binding of WT1 to WTE, whereas alterations within the first WT1 zinc finger reduced the binding affinity approximately 10-fold but did not abolish sequence recognition. We have thus identified a WT1 target, which, although similar in sequence to the EGR-1 motif, shows a 20- to 30-fold-higher affinity for WT1. These results suggest that physiological action of WT1 is mediated by binding sites of significantly higher affinity than the 9-bp EGR-1 binding motif. The role of the thymine base in contributing to binding affinity is discussed in the context of recent structural analysis.