共查询到20条相似文献,搜索用时 31 毫秒
1.
Koyu Hon-nami Michael P. Coughlan Hiromi Hon-nami Lars G. Ljungdahl 《Archives of microbiology》1986,145(1):13-19
Clostridium thermocellum, strain JW20 (ATCC 31449) when growing in cellulose produces a cellulolytic enzyme system, that at the early stage of the fermentation is largely bound to the substrate. As cellulose is consumed the bound enzyme is released as free enzyme to the culture fluid. The bound enzyme fraction extracted with distilled water from the cellulose contains two major components, a large complex (Mr100×106) and a small complex Mr4.5×106) which were separated by gel filtration and sucrose solved by affinity chromatography into a complex that binds to the column and into a non-bindable mixture of proteins. All four fractions have endo--glucanase activity but only the two bound complexes and the free bindable complex hydrolyze crystalline cellulose with cellobiose as the main product. These three complexes are qualitatively similar in that they each contain about 20 different polypeptides (Mr values from 45,000 to 200,000) of which about ten are major components. However, the relative amounts of some of the peptides in the complexes differ. At least four polypeptides of the complexes have endo--glucanase activity.Abbreviations CM
cellulose, carboxymethyl cellulose
- CMCase
carboxymethyl cellulase cosidered endo--1,4-glucanase
- SDS
sodium dodecyl sulfate
- YAS
yellow affinity substance
- YAS-cellulose
yellow affinity substance-cellulose complex 相似文献
2.
M Hillar V Rangayya B B Jafar D Chambers M Vitzu L E Wyborny 《Archives internationales de physiologie et de biochimie》1979,87(1):29-49
Mitochondrial membrane-bound DNA complex from bovine heart mitochondria lysed in the presence of Triton X-100 was isolated by differential centrifugation. The yield of "nucleoid" is about 30 microgram protein/mg mitochondrial protein. It contains about 3-5 microgram DNA/mg protein and varying amounts of RNA. The heart mitochondrial nucleoid actively synthesizes RNA. The nucleoid fraction contains about sixteen different proteins as evidenced by urea-SDS gel electrophoresis and about twenty-one proteins as evidenced by acid-urea gel electrophoresis. It appears that the nucleoid is attached to the inner membrane since it does contain cytochromes. 相似文献
3.
The sequence and secondary structure of the 3′-UTR affect 3′-end maturation,RNA accumulation,and translation in tobacco chloroplasts 总被引:6,自引:0,他引:6
RNA maturation and modulation of RNA stability play important roles in chloroplast gene expression. In vitro and in vivo studies have shown that both the 5- and 3-untranslated regions (UTRs) contain sequence and structural elements that guide these processes, and interact with specific proteins. We have previously characterized the spinach chloroplast petD 3-UTR in detail by in vitro approaches. This stem-loop forming sequence is a weak terminator but is required for RNA maturation and also exhibits sequence-specific protein binding. To test petD 3-UTR function in vivo, tobacco chloroplast transformants were generated containing uidA reporter genes flanked by variants of the petD 3-UTR, including one which does not form an RNA-protein complex in vitro, and one which lacks a stem-loop structure. Analysis of uidA mRNA indicated that a stable secondary structure is required to accumulate a discrete mRNA, and that changes in the 3-UTR sequence which affect protein binding in vitro can also affect RNA metabolism in vivo. The 3-UTR also influenced -glucuronidase protein accumulation, but not in proportion to RNA levels. These results raise the possibility that in tobacco chloroplasts, the 3-UTR may influence translational yield. 相似文献
4.
H. H. Kirch H. Uhrig F. Lottspeich F. Salamini R. D. Thompson 《TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik》1989,78(4):581-588
Summary The gametophytic self-incompatibility system of Solarium tuberosum is controlled by a single locus, designated as the S-locus. Protein extracts from potato styles of defined S-genotypes have been analysed by two-dimensional gel electrophoresis, and found to contain a group of basic glycoproteins. Each genetically determined allele S
1 to S
4 was associated with the presence of one of a number of these polypeptides differing slightly in isoelectric points (in the range 8.3–>9.1) and/or apparent molecular weight (ranging from 23,000 to 29,000). Two abundant basic polypeptides, one of which is apparently not glycosylated, were present in all genotypes examined. Amino-terminal protein sequence determinations revealed homologies of the S. tuberosum stylar proteins S2, S3 and S4 with SI-associated polypeptides from Nicotiana alata and Lycopersicon peruvianum. With an oligonucleotide generated to the potato-S2 N-terminal protein sequence, it was possible to detect a style-specific RNA species of 920 nucleotides. The oligonucleotide also behaved as an allele-specific probe when hybridized to total RNA of different S-genotypes. 相似文献
5.
The size, frequency and distribution of the nucleoids of chloroplasts (cl-nucleoids) and chromoplasts (cr-nucleoids) of the daffodil have been investigated in situ using the DNA-specific fluorochrome 46-diamidino-2-phenylindole. Chromoplasts contain fewer nucleoids (approx. 4) than chloroplasts (> 10), and larger chromoplasts (cultivated form, approx. 4) contain more than smaller ones (wild type, approx. 2). During chromoplast development the nucleoid number decreases in parallel with the chlorophyll content. Each nucleoid contains 2–3 plastome copies on average. In chloroplasts the nucleoids are evenly distributed, whereas they are peripherally located in chromoplasts. The fine structure of isolated cl-and cr-nucleoids, purified either by Sepharose 4B-CL columns or by metrizamide gradients, was investigated electron microscopically. The cl-nucleoids consist of a central protein-rich core with naked DNA-loops protruding from it. In cr-nucleoids, on the other hand, the total DNA is tightly packed within the proteinaceous core. The protein-containing core region of the nucleoids is made up of knotty and fibrillar sub-structures with diameters of 18 and 37 nm, respectively. After proteinase treatment, or incressing ion concentration, most of the proteins are removed and the DNA is exposed even in the case of cr-nucleoids, the stability of which proved to be greater than that of cl-nucleoids. The chemical composition of isolated plastid nucleoids has been determined qualitatively and quantitatively. Chromoplast-nucleoids contain, relative to the same DNA quantity, about six times as much protein as cl-nucleoids. Accordingly the buoyant density of cr-nucleoids in metrizamide gradients is higher than that of cl-nucleoids. In addition to DNA and protein, RNA could be found in the nucleoid fraction. No pigments were present. The cr-and cl-nucleoids have many identical proteins. There are, however, also characteristic differences in their protein pattern which are possibly related to the different expression of the genomes of chloroplasts and chromoplasts. Nucleoids of both plastid types contain some proteins which also occur in isolated envelope membranes (probably partly in the outer membrane) and thus possibly take part in binding the DNA to membranes.Abbreviations cl-
chloroplast
- cr-
chromoplast
- DAPI
46-diamidino-2-phenylindole
- DNase
deoxyribonuclease
- kDa
kilodaltons
- MG
purified by metrizamide gradients
- SC
purified by Sepharose CL-4B column gel filtration
- SDS-PAGE
sodium dodecylsulfate-polyacrylamide gel electrophoresis 相似文献
6.
The major albumin, a polypeptide of 21 kilodaltons (kDa), from the seeds of cocoa (Theobroma cacao L.), has been identified and partially purified by preparative gel electrophoresis. Some N-terminal sequence was obtained, permitting the construction of an oligonucleotide probe. This probe was used to isolate the corresponding copy DNA (cDNA) clone from a library made from poly(A)+ RNA from immature cocoa beans. The cDNA sequence has a single major open reading frame, that translates to give a 221-amino-acid polypeptide of Mr 24003. The existence of a precursor to the 21-kDa polypeptide of this size was confirmed by immunoprecipitation from total poly(A)+ RNA translation products. The polypeptide has a hydrophobic signal sequence of 26 amino acids before the mature start, and the mature polypeptide would have an Mr of 21223. The protein sequence is homologous with sequences of the Kunitz protease and -amylase inhibitor family, and the protein probably functions to defend the seed's protein reserves from the digestive enzymes of invading pests. However because the protein comprises 25–30% of the total seed protein it may itself also function as a storage protein. Electron micrographs of immunogold-labelled embryo sections show that the protein is located in membrane-enclosed organelles.Abbreviations cDNA
copy DNA
- IgG
immunoglobulin G
- kb
kilobase pairs
- kDa
kilodaltons
- Mr
relative molecular mass
- SDS-PAGE
sodium dodecyl sulphate-polyacylamide gel electrophoresis
The authors are very grateful to Dr R. Jennings of the Virology Department, Sheffield University Medical School, for help in raising antibodies, and to Dr G. Cope, of the Biological Sciences Electron Microscopy Unit, Sheffield University, for taking the electron micrographs.To whom correspondence should be addressed. 相似文献
7.
Summary A simple and efficient procedure suitable for extraction of high-quality RNA from cultured conifer tissues, somatic embryos, zygotic embryos, needles, stem and root tissues was developed. It produced from 100 g up to 700 g total RNA per gram tissue dependent on the types of tissues used. RNA quality was estimated by spectrophotometry, agarose gel electrophoresis, in vitro translation of mRNA, cDNA synthesis and Northern blot analysis. The method also worked well with Arabidopsis thaliana and tobacco tissues.Abbreviations CTAB
cetyltrimethylammonium bromide
- DEPC
diethylpyrocarbonate
- PVP
polyvinylpyrrolidone
- SDS-PAGE
sodium dodecyl sulphate-polyacrylamide gel electrophoresis 相似文献
8.
The obligate aerobic bacteria Roseococcus thiosulfatophilus RB3 and Erythromicrobium ramosum E5 contain numerous polar carotenoids. The major carotenoid of the strain RB3 was the C30 carotene-dioate (4,4-diapocarotene-4,4-dioate) and the respective diglycosyl ester which have never been isolated before from a bacteriochlorophyll containing bacterium. Strain E5 contains the very polar erythroxanthin sulphate. The major carotenoid bound to reaction center and light-harvesting complexes is bacteriorubixanthinal. Most of the carotenoids of both strains are not bound to the pigment-protein complexes of the photosynthetic apparatus but to the envelope fraction (cytoplasmic membrane and cell wall).Abbreviations Bchl
bacteriochlorophyll
- MeOH
methanol 相似文献
9.
Takashi Horiuchi Masumi Hidaka Masahiro Akiyama Hideo Nishitani Mutsuo Sekiguchi 《Molecular & general genetics : MGG》1987,210(3):394-398
Summary A 4.32 kb DNA fragment, on which the DNA replication terminus (terR) site of plasmid R 6K was located, was inserted into the unique EcoRI site of plasmid pUC9. To detect replication intermediate molecules with a replication fork halted at the terR site, a cell DNA extract was digested with EcoRI, electrophoresed through an agarose gel and stained with ethidium bromide. In addition to two major bands, one derived from vector DNA and the other from the ter insert fragment, two extra minor bands were detected. Following DNA-DNA hybridization and electron microscopic observation we concluded that the two minor bands corresponded to the two Y-shaped molecules, produced from the -shaped intermediate molecules by EcoRI digestion.Abbreviations Ap
ampicillin
- kb
kilobase pair(s)
- EtBr
ethidium bromide 相似文献
10.
Hans-Peter Braun Michael Emmermann Volker Kruft Martin Bödicker Udo K. Schmitz 《Planta》1995,195(3):396-402
The bc
1-complex (EC 1.10.2.2.) from Triticum aestivum L. was purified by cytochrome-c affinity chromatography and gel filtration using either etiolated seedlings or wheat-germ extract as starting material. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis of the isolated enzyme revealed ten bands, which were analysed by immunoblotting and direct amino-acid sequencing. The enzyme from wheat is the first bc
1-complex that is reported to contain four core proteins (55.5, 55.0, 51.5 and 51.0 kDa). In addition, the wheat bc
1-complex comprises cytochrome b (35 kDa), cytochrome c
1 (33 kDa) the Rieske iron-sulphur protein (25 kDa) and three small subunits < 15 kDa. This composition differs from the one reported in fungi, mammals and potato. Partial sequence determination of the large subunits suggests that the 55.5 and 55.0-kDa-proteins represent the -subunit of the general mitochondrial processing peptidase, and the 51.5 and 51.0-kDa proteins the -subunit of this enzyme. The bc
1-complex from wheat efficiently processes mitochondrial precursor proteins as shown in an in-vitro processing assay. In control experiments the isolated bc
1-complexes from potato, yeast, Neurospora and beef, all purified by the same isolation procedure, were also tested for processing activity. Only the protein complexes from plants contain the general mitochondrial processing peptidase. The composition of the wheat bc
1-complex sheds new light on the co-evolution of the processing peptidase and the middle segment of the respiratory chain.Abbreviations MPP
mitochondrial processing peptidase
We wish to thank Prof. G. Schatz, Biozentrum Basel, Switzerland and Prof. H. Weiss, Universität Düsseldorf, Germany for providing antibodies against the repiratory subunits of the bc
1-complex from yeast and Neurospora and to H. Mentzel, A. Leisse, R. Breitfeld and B. Hidde for excellent technical assistance. Thanks are also due to Prof. M. Boutry, Université de Louvaine-la-Neuve, Belgium for providing a plasmid containing the -subunit of ATPase from tobacco. This research was supported by the Deutsche Forschungsgemeinschalft and the Bundesministerium für Forschung und Technologie. 相似文献
11.
Paul J. Rushton Heather Macdonald Alison K. Huttly Colin M. Lazarus Richard Hooley 《Plant molecular biology》1995,29(4):691-702
The promoters of wheat, barley and wild oat -Amy2 genes contain a number of conserved cis-acting elements that bind nuclear protein, we report here the isolation of two cDNAs encoding proteins (ABF1 and ABF2) that bind specifically to one of these elements, Box 2 (ATTGACTTGACCGTCATCGG). The two proteins are unrelated to each other except for a conserved region of 56–58 amino acids that consists of 25 highly conserved amino acids followed by a putative zinc finger motif, C-X4–5-C-X22–23-H-X1-H. ABF1 contains two such conserved regions, whereas ABF2 possesses only one but also contains a potential leucine zipper motif, suggesting that it could form homo- or heterodimers. ABF1 and ABF2 expressed in Escherichia coli bound specifically to Box 2 probes in gel retardation experiments; this binding was abolished by the transition-metal-chelating agent, 1,10-o-phenanthroline and by EDTA. We propose that ABF1 and ABF2 are representatives of two classes of a new family of plant sequence-specific DNA-binding proteins. 相似文献
12.
Photoaffinity labeling and partial purification of the putative plant receptor for the fungal wilt-inducing toxin,fusicoccin 总被引:1,自引:0,他引:1
The high-affinity fusicoccin-binding protein (FCBP) was solubilized from plasma-membrane vesicles prepared from leaves of Vicia faba L. by aqueous two-phase partitioning. Conditions for the solubilization of intact FCBP-radioligand complexes were worked out. About 60–70% of the complexes can be solubilized with 50–60 mM nonanoyl-N-methylglucamide in the presence of 1 mg· ml-1 soybean phosphatidylcholine, type IV S, and 20% (v/v) glycerol at pH 5.5. The slow dissociation of the radioligand, 9-nor-fusicoccin-8-alcohol-[3H] from the FCBP at low temperatures permits the purification of FCBP-radioligand complexes at 4–10° C by fast protein liquid chromatography on anion-exchange and gel permeation columns. The FCBP, extracted from plasma membranes with cholate and chromatographed in the presence of this detergent, gave an apparent molecular mass (Mr) of 80±20 kDa on gel permeation columns under the conditions used. By comparison of the elution profiles of the fraction most enriched in FCBP-radioligand complexes with polypeptide patterns obtained on sodium dodecyl sulfate-polyacrylamide gels, a polypeptide with an Mr of approx. 34kDa co-separated with the radioactivity profile. A second, faint band of approx. 31 kDa was sometimes also observed co-electrophoresing. Photoaffinity labeling of plasma-membrane vesicles with the new compound 9-nor-8[(3,5-[3H]-4-azidobenzoy)ethylenediamine]-fusicoccin ([3H]ABE-FC) and subsequent separation by sodium dodecyl sulfate-polyacrylamide gel electrophoresis labeled a single band with an Mr of 35±1 kDa. Labeling in this band was strongly reduced when the membranes were incubated with [3H]ABE-FC in the presence of 0.1–1 M fusicoccin. From our data, we conclude (i) that the 34-35-kDa polypeptide represents the FCBP and (ii) that in detergent extracts of plasma membranes this polypeptide is probably present as a di- or trimeric structure.Abbreviations ABE-FC
[(4-azidobenzoyl)-ethylenediamine]-fusicoccin
- ABE-NHS
(4-azidobenzoyl)-N-hydroxysuccinimide ester
- FC
fusicoccin
- FCBP
fusicoccin-binding protein
- FCol
9-norfusicoccin-8-alcohol
- MAB
monoclonal antibody
- Mega-9(10)
nonanoyl(decanoyl)-N-methylglucamide
- Mr
apparent molecular mass
- PMSF
phenylmethyl-sulfonyl fluoride
- SDS-PAGE
sodium dodecyl sulfate-polyacrylamide gel electrophoresis
- TCA
trichloroacetic acid
- Tris
2-amino-2-(hydroxymethyl)-1,3-propanediol 相似文献
13.
Glyoxysomal citrate synthase (gCS) was purified from crude extracts of watermelon (Citrullus vulgaris Schrad.) cotyledons, yielding a homogenous protein with a subunit MW of 48 kDa. The enzyme was selectively inhibited by 5,5-dithiobis-(2-nitrobenzoic acid), allowing quantification in the presence of the mitochondrial isoenzyme (mCS). Differences were also observed with respect to inhibition by ATP (k
i=2.6 mmol · l-1 for gCS, k
i=0.33 mmol · l-1 for mCS). The antibodies prepared against gCS did not cross-react with mCS. The immunocytochemical localization of gCS by the indirect protein A-gold procedure was restricted to the glyoxysomal membrane or the peripheral matrix of glyoxysomes. Other compartments, e.g. the endoplasmic reticulum, were not labeled. Xenopus oocytes were used for the translation of watermelon polyadenylated RNA (poly(A)+RNA). A translation product with a MW of 51 kDa was immunoprecipitated by the anti-gCS antibodies. It was absent in controls without poly(A)+RNA or with preimmune serum. A similar translation product was also immunoprecipitated after cell-free synthesis of watermelon poly(A)+RNA in a reticulocyte system, in contrast to the in-vivo labeled gCS (48 kDa). It was concluded that gCS is synthesized as a higher-molecular-weight precursor.Abbreviations DTNB
5,5-dithiobis-(2-nitrobenzoic acid)
- gCS
glyoxysomal citrate synthase
- gMDH
glyoxysomal malate dehydrogenase
-
k
i
inhibitor constant
- mCS
mitochondrial citrate synthase
- OAA
oxaloacetate
- poly(A)+RNA
polyadenylated RNA
- SDS-PAGE
sodium dodecyl sulfate-polyacrylamide gel electrophoresis 相似文献
14.
Søren K. Rasmussen Søren W. Dahl Anette Nørgård Jørn Hejgaard 《Plant molecular biology》1996,30(3):673-677
A full-length clone encoding the wheat (Triticum aestivum L.) serpin WSZ1 was isolated from a cDNA library based on mRNA from immature grain. The 398 amino acid sequence deduced from the cDNA was corroborated by sequencing CNBr peptides of WSZ1 purified from resting grain. WSZ1 belongs to the subfamily of protein Z-type serpins and the amino acid sequence is 70% identical with the barley serpins BSZ4 and BSZx and 27–33% identical with human serpins such as 1-proteinase inhibitor, antithrombin III, and plasminogen activator inhibitor. The cDNA was subcloned in the pET3d expression vector, equipped with a histidine affinity tag at the N-terminus and expressed in Escherichia coli BL(21) DE3 pLysS. Recombinant WSZ1 from the soluble fraction was partially purified on Ni-NTA agarose and MonoQ columns and shown to form SDS-stable complexes with -chymotrypsin. Southern blots and amino acid sequencing indicated that only few serpins are encoded by wheat, but at least three distinct genes are expressed in the grain. Cleavage experiments on a chymotrypsin column suggested a Gln-Gln reactive site bond not previously observed in inhibitory serpins. 相似文献
15.
Rhodopseudomonas palustris cells, characterized by a lamellar type intracytoplasmic chromatophore membrane system after phototrophic growth, yielded a crude supernatant cell-free fraction (S-144) after ultracentrifugation which retained the contents of both the cell compartments. After thiosulfate-dependent growth, a protein system was isolated from S-144 which catalyzed the thiosulfate-linked reduction of an endogenous c-type cytochrome. — The colorless oxidoreductase protein, after purification to homogeneity, revealed a molecular weight of 93,000 and, after SDS treatment, a particle weight of 48,000. It was focused at an average pI of 5.45. Apparent K
m values for several substrates were in the M range. The electron acceptor for thiosulfate oxidation was found to be a cytochrome c from S-144. The homogeneous acceptor protein, at liquid nitrogen temperature, exhibited absorption maxima at 549.0, 518.5 and 418.0 nm, and shoulders at 525.5, 512.0 and 508.0 nm. Its molecular weight was found to be 17,000 (gel filtration) and 16,000 (SDS gel electrophoresis). It was characterized by a pI of 10.0. Its midpoint redox potential of E
m,7.0=+228 mV was determined by redox titrations and the value of +205 mV by spectrophotometric calculations.Abbreviations BSA
bovine serum albumin
- HiPIP
high potential nonheme iron protein
- IEF
isoclectric focusing
- SDS
dodecylsulfate, sodium salt
- Temed
N,N,N,N-tetramethylethylenediamine 相似文献
16.
BHK cell proteins that bind to the 3' stem-loop structure of the West Nile virus genome RNA. 总被引:9,自引:6,他引:3
下载免费PDF全文
![点击此处可从《Journal of virology》网站下载免费的PDF全文](/ch/ext_images/free.gif)
The first 83 3' nucleotides of the genome RNA of the flavivirus West Nile encephalitis virus (WNV) form a stable stem-loop (SL) structure which is followed in the genome by a smaller SL. These 3' structures are highly conserved among divergent flaviviruses, suggesting that they may function as cis-acting signals for RNA replication and as such might specifically bind to cellular or viral proteins. Cellular proteins from uninfected and WNV-infected BHK-21 S100 cytoplasmic extracts formed three distinct complexes with the WNV plus-strand 3' SL [(+)3'SL] RNA in a gel mobility shift assay. Subsequent competitor gel shift analyses showed that two of these RNA-protein complexes, complexes 1 and 2, contained cell proteins that specifically bound to the WNV (+)3'SL RNA. UV-induced cross-linking and Northwestern blotting analyses detected WNV (+)3'SL RNA-binding proteins of 56, 84, and 105 kDa. When the S100 cytoplasmic extracts were partially purified by ion-exchange chromatography, a complex that comigrated with complex 1 was detected in fraction 19, while a complex that comigrated with complex 2 was detected in fraction 17. UV-induced cross-linking experiments indicated that an 84-kDa cell protein in fraction 17 and a 105-kDa protein in fraction 19 bound specifically to the WNV (+)3'SL RNA. In addition to binding to the (+)3'SL RNA, the 105-kDa protein bound to the SL structure located at the 3' end of the WNV minus-strand RNA. Initial mapping studies indicated that the 84- and 105-kDa proteins bind to different regions of the (+)3'SL RNA. The 3'-terminal SL RNA of another flavivirus, dengue virus type 3, specifically competed with the WNV (+)3'SL RNA in gel shift assays, suggesting that the host proteins identified in this study are flavivirus specific. 相似文献
17.
Erhard Stupperich Andreas Juza Christoph Eckerskorn Lillian Edelmann 《Archives of microbiology》1990,155(1):28-34
The hypothesis of common epitopes in corrinoid-dependent enzymes was tested by a monospecific polyclonal antiserum against the 33 kDa corrinoid-containing membrane protein from Methanobacterium thermoautotrophicum Marburg. Cross-reaction was detected with the 33 kDa and the 31 kDa subunits of the corrinoid-containing enriched 5-methyl-H4MPT: 5-hydroxybenzimidazolyl cobamide methyltransferase from the cytoplasmic fraction and a 33 kDa protein from the membrane fraction of Methanobacterium thermoauto-trophicum H. This indicates that both proteins have similar antigenic determinants and that they may have similar function as methyltransfer proteins. Also a soluble 20 kDa protein of yet unknown function from Clostridium barkeri cross-reacted with the antiserum. No cross-reactions were observed with the purified corrinoid-containing 2-methyleneglutarate mutase from C. barkeri, the corrinoid/iron-sulfur protein from C. thermoaceticum, the carbon monoxide dehydrogenases from C. thermoaceticum and Methanothrix soehngenii, and the corrinoid-binding protein intrinsic factor from porcine gastric mucosa. Also cell extracts from the corrinoid-rich bacteria Sporomusa ovata, Methanolobus tindarius, Chloroflexus aurantiacus, Propionibacterium shermanii, the membrane fraction and the cytoplasmic fraction of Methanococcus voltae or extracts from human liver, contained no antibody combining sites others than with the preimmunological serum. These findings indicate, that many corrinoid-containing proteins from bacteria have no common antigenic determinants.Abbreviations CH3-H4MPT
N
5-methyl-tetrahydromethanopterin
- SDS-PAGE
sodium dodecyl sulfate polyacrylamide gel electrophoresis
- ELISA
enzyme linked immunosorbent assay
- DSM
Deutsche Sammlung von Mikroorganismen 相似文献
18.
Chromatium vinosum cells form a vesicular type intracytoplasmic membrane system during phototrophic growth on thiosulfate.—An enzyme protein transferring electrons from thiosulfate to cytochromes of type c was enriched from S-144. The colorless thiosulfate: cytochrome c oxidoreductase was characterized by a molecular weight of 36,000 (after dodecylsulfate treatment) and 35,000 (by gel filtration). Isoelectric focusing revealed a pI range of 4.4 to 4.7. Apparent K
m values for the cytochromes tested were in the M range. — The endogenous electron acceptor compound, isolated from the chromatophore fraction P-144, was found to be a membrane-bound cytochrome c-552. The homogeneous cytochrome protein had an average pI value of 4.65 and a molecular weight of 71,500 determined by gel filtration. By dodecylsulfate electrophoresis it was cleaved into two proteins representing particle weights of 45,000 and 20,000.Abbreviations HiPIP
high potential nonheme iron protein
- IEF
isoelectric focusing
- SDS
dodecylsulfate, sodium salt
- Temed
N,N,N,N-tetramethylethylenediamine 相似文献
19.
Soluble proteins extracted with Tris-buffer pH 8.8 from both differentiation stages of the protonema of Funaria hygrometrica (chloronema and caulonema) were separated by microgel electrophoresis. 4x10-3 mg protein/gel was applied. The caulonema, which is the only part of the protonema able to form buds following cytokinin treatment, contained 3 protein bands, which were absent in chloronema. We designate them as caulonema specific proteins (CSP, approximate molecular weight 500,000). The CSP disappear when the caulonema is isolated and its cells regenerate to chloronema. The CSP bind kinetin (6 Furfurylamino [8-14C]purine) or BAP (6-benzylamino[8-14C]purine) about 10 times stronger than the remaining protein bands in the gel. The greatest part of the cytokinin is metabolized in a short time and consequently a part of the activity in the gel is incorporated into RNA and removable with RNase. Simultaneous application of adenosine and cytokinin reduced the incorporation of radioactivity into RNA and enhanced the specific activity in one of the CSP bands. In all other bands it remained unchanged.From the results it can be suggested that the CSP are probably involved in the early reactions to cytokinin of the target cells.Abbreviations CSP
Caulonema specific proteins
- BAP
6-benzylaminopurine
- GA1
gibberellin A1 相似文献
20.
The excessive expression of catalase protein and its activity in cultured skin fibroblast from Zellweger Syndrome (ZS), a disorder of peroxisomal biogenesis, was found to be regulated at the translational level (J. Neurochem. 67: 2373-2378, 1996). Overall there is a considerable increase in the association of catalase mRNA with polysomes in ZS cell lines as compared to control indicating translational upregulation. To investigate the possibility that RNA-protein interactions are involved in the mediation of this increase in translation, the interaction between 3 untranslated region of human catalase mRNA and human fibroblast cytoplasmic proteins were investigated by RNA gel shift assay technique. Competition experiments demonstrated that all the 600 bases of 3 UTR (of human catalase gene) was required for efficient binding. Catalase RNA- protein interaction was sensitive to the altered redox state in these in vitro assays and this RNA-protein interaction could be enhanced by the addition of -mercaptoethanol in cytoplasm from control fibroblast but not in cytoplasm from ZS fibroblast. UV cross linked RNA-protein complexes on SDS polyacrylamide gel electrophoresis revealed the presence of at least four protein bands with approximate molecular masses of 38 kDa, 50 kDa, 66 kDa and 80 kDa. The potential role of these mRNA binding proteins in the regulation of catalase gene expression is discussed. 相似文献