Activity of the replication terminus of plasmid R6K in hybrid replicons in Escherichia coli.

Hybrids between the antibiotic resistance plasmid R6K and RSF2124, a derivative of plasmid ColEl were constructed in vetro. These hybrids exhibit the replication properties of both parents in Escherichia coli, including the use of either the R6K or the ColEl origin of replication during logarithmic phase growth. Incompatibility properties of both parental plasmids also are expressed by the hybrid plasmids. Analysis of replicative intermediates showed that the asymmetric terminus of R6K was functional in the hybrids. In the absence of protein synthesis where replication of the hybrid plasmid is initiated only from the ColE1 origin, the R6K terminus either prevents or severely impedes the progress of the replication fork. The activity of the R6K terminus region is expressed independent of the direction of DNA replication and in the absence of the R6K replication origin.     

Replication of polyoma DNA in isolated nuclei: analysis of replication fork movement.

The movement of replication forks during polyoma DNA synthesis in isolated nuclei was analyzed by digesting newly synthesized DNA with the restriction endonuclease HpaII which cleaves polyoma DNA into eight unique fragments. The terminus of in vitro DNA synthesis was identified by cleaving newly completed molecules with HpaII. The distribution of label in the restriction fragments showed that the in vitro DNA synthesis was bidirectional and had the normal terminus of replication. Analysis of replicative intermediates pulse-labeled in vitro further suggested that DNA synthesis in isolated nuclei is an ordered process similar to replication in intact cells. Replication forks moved with a constant rate from the origin towards the terminus of replication. The nonlinear course of the DNA synthesis reaction in the isolated nuclei seems to result from the random inactivation of replication forks rather than a decrease in the rate of fork movement. During the in vitro synthesis a replication fork could maximally synthesize a DNA chain about 1,000 nucleotides long. The results suggest that some replication forks might be initiated in vitro at the origin of replication.     

Adenovirus deoxyribonucleic acid replication. II. Synthesis of viral deoxyribonucleic acid in vitro by a nuclear membrane fraction from infected KB cells.

A cell-free system for the study of viral DNA replications was developed by the isolation of a nuclear membrane fraction "DNA replication complex" from adenovirus 2-infected human KB cells late after infection. This complex which possesses both DNA polymerase activity and a virus-specific endonuclease synthesizes exclusively virus-specific DNA sequences in vitro by a semiconservative mechanism. Analysis by rate zonal sedimentation in alkaline sucrose gradients showed that the products of the reaction are small DNA chains approximately 6 to 9 S, presumably "Okazaki intermediates," that are not sealed under our in vitro conditions. Analysis by rate zonal sedimentation in neutral sucrose gradients showed that labeled viral DNA fragments are hydrogen bonded to viral 18 S DNA segments, 0.25 the size of the linear, viral 31 S DNA genome. The 18 S DNA is probably a specific cleavage product of the viral endonuclease found in the replication complex and could represent intermediates in viral DNA replication or degradation products.     

Mapping of the in vivo start site for leading strand DNA synthesis in plasmid R1.

We have previously constructed Escherichia coli strains in which an R1 plasmid is integrated into the origin of chromosome replication, oriC. In such intR1 strains, oriC is inactive and initiation of chromosome replication instead takes place at the integrated R1 origin. Due to the large size of the chromosome, replication intermediates generated at the R1 origin in these strains are considerably more long-lived than those in unintegrated R1 plasmids. We have taken advantage of this and performed primer extensions on total DNA isolated from intR1 strains, and mapped the free 5' DNA ends that were generated as replication intermediates during R1 replication in vivo. The sensitivity of the mapping was considerably improved by the use of a repeated primer extension method (RPE). The free DNA ends were assumed to represent normal in vivo start sites for leading strand DNA synthesis in plasmid R1. The ends were mapped to a short region approximately 380 bp away from the R1 minimal origin, and the positions agreed well with previous in vitro mappings. The same start positions were also utilized in the absence of the DnaA protein, indicating that DnaA is not required for determination of the position at which DNA synthesis starts during initiation of replication at the R1 origin.     

Position and orientation-dependent effects of a eukaryotic Z-triplex DNA motif on episomal DNA replication in COS-7 cells.

A cluster of simple repeated sequences composed of 5'-(GC)5(AC)18(AG)21(G)9(CAGA)4GAGGGAGAGAGGCAGAGAGGG(AG)27-3 ' located near the origin of replication associated with the Chinese hamster dhfr gene has been shown to adopt multiple Z-form and triplex DNA structures under various experimental conditions (Bianchi, A., Wells, R. D., Heintz, N. H., and Caddle, M. S. (1990) J. Biol. Chem. 265, 21789-21796). Thus, we refer to the cluster of alternating repeats as a Z-triplex DNA motif. Primer extension studies indicate that DNA polymerases traverse the Z-triplex sequence more readily in the Z to triplex direction than in the triplex to Z direction. To examine the effect of these sequences on replication fork travel in living cells, the Z-triplex motif was cloned in both orientations on the early and late side of the SV40 origin of replication in the vector pSV011. Test constructs were cotransfected along with pSV011 into COS-7 cells, and plasmid replication was monitored by the accumulation of DpnI-resistant replication products. A single copy of the Z-triplex motif reduced plasmid replication after 48 h by 20-50%, depending upon the position and orientation of the insert relative to the SV40 origin sequences. The replication of plasmids containing two copies of the Z-triplex motif, in different orientations on either side of the SV40 origin, was reduced by 85-95% as compared to the cotransfected control. Two-dimensional gel analysis of replication intermediates failed to show absolute termination of replication fork travel at the Z-triplex sequences, but rather indicated that the Z-triplex region causes replication intermediates to accumulate during the late phases of replication. These results indicate that the dhfr Z-triplex region has complex effects on both replication fork movement and the termination phases of episomal DNA synthesis in animal cells.     

Coordinated leading and lagging strand synthesis during SV40 DNA replication in vitro requires PCNA

Proliferating cell nuclear antigen (PCNA) is a cell cycle and growth regulated protein required for replication of SV40 DNA in vitro. Its function was investigated by comparison of the replication products synthesized in its presence or absence. In the completely reconstituted replication system that contains PCNA, DNA synthesis initiates at the origin and proceeds bidirectionally on both leading and lagging strands around the template DNA to yield duplex, circular daughter molecules. In contrast, in the absence of PCNA, early replicative intermediates containing short nascent strands accumulate. Replication forks continue bidirectionally from the origin, but surprisingly, only lagging strand products are synthesized. Thus two stages of DNA synthesis have been defined, with the second stage requiring PCNA for coordinated leading and lagging strand synthesis at the replication fork. We suggest that during eukaryotic chromosome replication there is a switch to a PCNA-dependent elongation stage that requires two distinct DNA polymerases.     

Chloroplast DNA replication in vitro: site-specific initiation from preferred templates.

An enzyme system prepared from maize chloroplasts catalyzes the synthesis of DNA from maize chloroplast DNA sequences cloned in bacterial plasmids. Cloned maize chloroplast DNA fragments Bam HI 17' (2470 bp) and Eco RI x (1368 bp) have been shown to be preferred templates for in vitro DNA synthesis catalyzed by pea chloroplast DNA polymerase preparations [Gold et al. (1987) Proc. Natl. Acad. Sci. USA 84, 194-198]. Analysis of replicative intermediates indicates that although the template activity of the recombinant plasmid pZmcBam 17' is substantially greater than that of the pZmcEco x, replication in both cases originates from within a 455 bp region which overlaps the two plasmids. The remaining approximately 1500 basepair portion of maize chloroplast BamHI fragment 17' is not more active because it contains additional origins for replication. The overlapping region shows sequence homology with a portion of the Chlamydomonas reinhardtii chloroplast chromosome that contains a replication origin. Replication is shown to proceed bidirectionally within the 455 bp origin region. Recombinant plasmid pZmc 427, which is also active in the in vitro DNA synthesis assay, promoted localized replication initiation within a 1 kbp Bg1II-Eco RI fragment of the chloroplast DNA insert, a region that includes the 3' terminal part of the psbA gene.     

A DNA replication origin and a replication fork barrier used in vivo in the circular plasmid pKD1

As in other yeasts, ARS-containing plasmids can be maintained extrachromosomally in Kluyveromyces lactis. Although some fragments of K. lactis DNA have ARS activity in both K. lactis and Saccharomyces cerevisiae, it appears that the sequences required for ARS activity in the two yeasts are different. As an approach to a better understanding of ARS structure and function in K. lactis, we analyzed the replication of the circular plasmid pKD1. We identified a 159-bp sequence able to promote autonomous replication of pKD1 in both yeasts; this fragments contains both a sequence related to the S. cerevisiae ARS consensus sequence and a region of 53% identity to the 40-bp sequence essential for K. lactis KARS101 function. By the analysis of in vivo replication intermediates we provide the first direct evidence that DNA replication initiates at or near the K. lactis ARS element. Replication terminates at the cisacting stability locus of pKD1, which functions as a replication fork barrier (RFB) and is necessary for proper plasmid segregation. RFB activity requires the pKDI gene products that are important for plasmid segregation, suggesting a link between DNA replication termination and plasmid segregation in a eukaryotic organism.     

DNA polymerases delta and epsilon are required for chromosomal replication in Saccharomyces cerevisiae.

Three DNA polymerases, alpha, delta, and epsilon are required for viability in Saccharomyces cerevisiae. We have investigated whether DNA polymerases epsilon and delta are required for DNA replication. Two temperature-sensitive mutations in the POL2 gene, encoding DNA polymerase epsilon, have been identified by using the plasmid shuffle technique. Alkaline sucrose gradient analysis of DNA synthesis products in the mutant strains shows that no chromosomal-size DNA is formed after shift of an asynchronous culture to the nonpermissive temperature. The only DNA synthesis observed is a reduced quantity of short DNA fragments. The DNA profiles of replication intermediates from these mutants are similar to those observed with DNA synthesized in mutants deficient in DNA polymerase alpha under the same conditions. The finding that DNA replication stops upon shift to the nonpermissive temperature in both DNA polymerase alpha- and DNA polymerase epsilon- deficient strains shows that both DNA polymerases are involved in elongation. By contrast, previous studies on pol3 mutants, deficient in DNA polymerase delta, suggested that there was considerable residual DNA synthesis at the nonpermissive temperature. We have reinvestigated the nature of DNA synthesis in pol3 mutants. We find that pol3 strains are defective in the synthesis of chromosomal-size DNA at the restrictive temperature after release from a hydroxyurea block. These results demonstrate that yeast DNA polymerase delta is also required at the replication fork.     

Replication of antibiotic resistance plasmid R6K DNA in vitro.

A soluble extract prepared from cells of an Escherichia coli strain carrying the antibiotic resistance plasmid R6K is capable of carrying out the complete process of R6K DNA replication. DNA synthesis in vitro is dependent on the four deoxyribo- and ribonucleotide triphosphates and is sensitive to rifampin and streptolydigin, inhibitors of DNA-dependent RNA polymerase. The incorporation of deoxyribonucleotides into R6K DNA also is sensitive to actinomycin D, novobiocin, arabinofuranosyl-CTP, and N-ethylmaleimide. Kinetics of synthesis are linear for 60 to 120 min. Replication proceeds semiconservatively and supercoiled closed-circular DNA molecules are synthesized. Analysis by alkaline sucrose gradient centrifugation indicated that the early R6K DNA products contain DNA fragments of approximately 18 S in size, corresponding to the length between the R6K alpha origin of replication and the terminus of replication observed in vivo. Addition of exogenous supercoiled R6K DNA is inhibitory to the in vitro system, whereas the addition of R6K DNA in the form of relaxation complex stimulates R6K DNA synthesis to a small extent.     

Dissecting the functional role of PriA protein-catalysed primosome assembly in Escherichia coli DNA replication

The multi-functional PriA protein of Escherichia coli (formerly replication factor Y or protein n') serves to guide the ordered assembly of the primosome, a mobile multiprotein replication priming/helicase complex. Primosome assembly is essential for bacteriophage OX174 complementary DNA strand synthesis and ColE1-type plasmid replication reconstituted in vitro with purified proteins. The biochemical activities of the primosome suggest that it can fulfill the primase/helicase requirement on the lagging-strand DNA template during cellular DNA replication. However, reconstruction in vitro of DNA replication of small plasmids containing the E. coli origin of DNA replication (oriC) does not require the complete complement of primosomal proteins. Thus, the extent to which PriA-catalysed primosome assembly participates in chromosomal replication has remained unclear. The recent isolation of the genes encoding PriA, PriB (protein n), PriC (protein n"), and DnaT (protein i) has provided the necessary tools for addressing this issue. The phenotype of mutations in these genes, and other results described in this review, suggest that assembly of the primosome catalysed by PriA does in fact contribute at some stage to normal cellular DNA replication. A model for primososme-catalysed reactivation of a dysfunctional replication fork is discussed.     

Leading strand synthesis of R1 plasmid replication in vitro is primed by primase alone at a specific site downstream of oriR

By using an in vitro system for R1 plasmid replication dependent on a plasmid-encoded repA protein and host dnaA protein, 5' ends of the nascent leading strand were located at positions 1986-1992, some 380 base pair downstream of oriR. Analyses of early replication intermediates generated in vitro in the presence of dideoxy TTP also indicated that replication initiates about 400 base pair downstream of oriR and proceeds unidirectionally. When a 418-base single-stranded DNA from position 1778 to 2195, derived from the leading strand template, was cloned onto an M13 vector, the chimeric single-stranded phage could be replicated in vitro with only single-stranded DNA binding protein, primase (dnaG gene product), and DNA polymerase III holoenzyme. Furthermore, the priming occurred at a site identical to leading strand initiation. These results strongly suggest that the leading strand synthesis is primed by primase alone. The lagging strand synthesis is specifically terminated at position 1515 or 1516 within oriR, preventing further leftward fork movement. Based on these results, a scheme of R1 plasmid replication is presented.     

Discontinuous replication of colicin E1 plasmid deoxyribonucleic acid.

The plasmid pML 21, which was found to contain approximately 49% of the Col E1 genome was used to determine the template origin of single-stranded deoxyribonucleic acid (DNA) fragments (4 to 32% of the Col E1 units length) associated with Col E1 dna replicative intermediates. The results of DNA hybridization competition experiments indicate that the single-stranded fragments derive from the full length of the Col E1 DNA template as expected for Okazaki fragments and the plasmid pML 21 contains the replication origin of Col E1 DNA.     

Primosome assembly site in Bacillus subtilis.

A single-strand initiation site was detected on the Enterococcus faecalis plasmid pAM beta 1 by its ability to prevent accumulation of single stranded DNA of a rolling circle plasmid, both in Bacillus subtilis and Staphylococcus aureus. This site, designated ssiA, is located on the lagging strand template, approximately 150 bp downstream from the replication origin. ssiA priming activity requires the DnaE primase, the DnaC replication fork helicase, as well as the products of the dnaB, dnaD and dnaI genes of B.subtilis, but not the RNA polymerase. The primase and the replication fork helicase requirements indicate that ssiA is a primosome assembly site. Interestingly, the pAM beta 1 lagging strand synthesis is inefficient when any of the proteins involved in ssiA activity is mutated, but occurs efficiently in the absence of ssiA. This suggests that normal plasmid replication requires primosome assembly and that the primosome can assemble not only at ssiA but also elsewhere on the plasmid. This work for the first time describes a primosome in a Gram-positive bacterium. Involvement of the B.subtilis proteins DnaB, DnaD and DnaI, which do not have any known analogue in Escherichia coli, raises the possibility that primosome assembly and/or function in B.subtilis differs from that in E.coli.     

PcrA is an essential DNA helicase of Bacillus subtilis fulfilling functions both in repair and rolling-circle replication

The only DNA helicase essential for Escherichia coli viability is DnaB, the chromosome replication fork helicase. In contrast, in Bacillus subtilis , in addition to the DnaB counterpart called DnaC, we have found a second essential DNA helicase, called PcrA. It is 40% identical to the Rep and UvrD DNA helicases of E. coli and 61% identical to the PcrA helicase of Staphylococcus aureus . This gene is located at 55° on the chromosome and belongs to a putative operon together with a ligase gene ( lig ) and two unknown genes named pcrB and yerH . As PcrA was essential for cell viability, conditional mutants were constructed. In such mutants, chromosomal DNA synthesis was slightly decreased upon PcrA depletion, and rolling-circle replication of the plasmid pT181 was inhibited. Analysis of the replication intermediates showed that leading-strand synthesis of pT181 was prevented upon PcrA depletion. To compare PcrA with Rep and UvrD directly, the protein was produced in rep and uvrD mutants of E. coli . PcrA suppressed the UV sensitivity defect of a uvrD mutant but not its mutator phenotype. Furthermore, it conferred a Rep⁻ phenotype on E. coli . Altogether, these results show that PcrA is an helicase used for plasmid rolling-circle replication and suggest that it is also involved in UV repair.     

Discriminatory function of ribonuclease H in the selective initiation of plasmid DNA replication.

The initiation stage of ColE1-type plasmid replication was reconstituted with purified protein fractions from Escherichia coli. The reconstituted system included DNA polymerase I, DNA ligase, RNA polymerase, DNA gyrase, and a discriminating activity copurifying with RNAase H (but free of RNAase III). Initiation of DNA synthesis in the absence of RNAase H did not occur at the normal replication origin and was non-selective with respect to the plasmid template. In the presence of RNAase H the system was selective for ColE1-type plasmids and could not accept the DNA of non-amplifiable plasmids. Electron microscopic analysis of the reaction product formed under discriminatory conditions indicated that origin usage and directionally of ColE1, RSF1030, and CloDF13 replication were consistent with the normal replication pattern of these plasmids. It is proposed that the initiation of ColE1-type replication depends on the formation of an extensive secondary structure in the origin primer RNA that prevents its degradation by RNAase H.     

Bi-directional replication and random termination

Two-dimensional (2D) agarose gel electrophoresis was used to study termination of DNA replication in a shuttle vector, YRp7′, when it replicated in Escherichia coli, Saccharomyces cerevisiae and Xenopus egg extracts. In E.coli, the 2D gel patterns obtained were consistent with uni-directional replication initiated at a specific site, the ColE1 origin. In consequence, termination also occurred precisely at the ColE1 origin. In Xenopus egg extracts, the particular shape of the bubble arc as well as the triangular smear detected to the left of the simple-Y pattern indicated random initiation and termination. In S.cerevisiae, initiation occurred at the ARS1 origin and replication proceeded in a bi-directional manner. However, termination did not always occur at a specific site 180° across from the origin, but almost all along the south hemisphere of the plasmid. Inversion, deletion or replacement of DNA sequences located throughout this hemisphere did not eliminate random termination. Analysis of the replication intermediates of another yeast plasmid bearing a different origin, ARS305, also exhibited random termination. We propose that the random termination events observed in S.cerevisiae could be due to an asynchronous departure of both forks from the bi-directional origin in addition to differences in the rate of fork progression. These observations could be extended to all bi-directional origins.     

In vitro polyoma DNA synthesis: discontinuous chain growth

Using an in vitro system for polyoma DNA synthesis from polyoma-infected mouse BALB/3T3 cells, we have shown that short pulses of radioactively labeled deoxynucleoside triphosphates are incorporated into viral replicative intermediates. Upon denaturation, the pulse-labeled replicative intermediates yield two size classes of growing DNA chains, namely a heterogeneous long class with S values up to unit viral DNA length (16 S) and a rather discrete short class of 5 S pieces. We have shown that these short fragments are involved as precursors in viral DNA chain elongation and that they can be chased into mature viral DNA. The fragments are found in replicative intermediates at all stages of replication and are therefore presumably not involved in specialized initiation or termination processes. Kinetic analysis of the appearance of radioactivity in short and long chains shows that initially approximately equal amounts are incorporated at a linear rate into the two classes. Subsequently, the rate of incorporation into long chains approximately doubles, while the amount of radioactivity in short chains reaches a plateau. This not only suggests that short chains are precursors to long chains, but that the synthesis of long chains occurs as a separate event and is not simply a result of joining of short fragments. Under the in vitro labeling conditions the time taken for radioactivity in short chains to reach a constant level can be used as a measure of the average lifetime of a 5 S piece. Our analysis indicates that there may be a considerable lag between the completion of a 5 S piece and its joining into longer DNA. Estimates of the self-annealing of the short chains showed approximately 20% self-complementarity. Thus, polyoma synthesis in vitro appears to proceed predominantly by a semi-discontinuous mechanism in which the nascent DNA on one side of the growing fork is elongated continuously, while on the other side of the fork DNA is synthesized discontinuously as 5 S fragments, which are subsequently joined. Both the short and the long chains are synthesized in the 5′ to 3′ direction.A fraction of the pulse-labeled material is found as free 3 to 5 S single-stranded DNA. These pieces are of both viral and cellular origin. A majority of them appear to be involved as precursors in DNA chain elongation.     

Unidirectional replication as visualized by two-dimensional agarose gel electrophoresis

Two-dimensional (2D) agarose gel electrophoresis is progressively replacing electron microscopy as the technique of choice to map the initiation and termination sites for DNA replication. Two different versions were originally developed to analyze the replication of the yeast 2 microns plasmid. Neutral/Neutral (N/N) 2D agarose gel electrophoresis has subsequently been used to study the replication of other eukaryotic plasmids, viruses and chromosomal DNAs. In some cases, however, the results do not conform to the expected 2D gel patterns. In order to better understand this technique, we employed it to study the replication of the colE1-like plasmid, pBR322. This was the first time replicative intermediates from a unidirectionally replicated plasmid have been analyzed by means of N/N 2D agarose gel electrophoresis. The patterns obtained were significantly different from those obtained in the case of bidirectional replication. We showed that identification of a complete are corresponding to molecules containing an internal bubble is not sufficient to distinguish a symmetrically located bidirectional origin from an asymmetrically located unidirectional origin. We also showed that unidirectionally replicated fragments containing a stalled fork can produce a pattern with an inflection point. Finally, replication appeared to initiate at only some of the potential origins in each multimer of pBR322 DNA.