Comparison of Bombyx mori and Helicoverpa armigera cytoplasmic actin genes provides clues to the evolution of actin genes in insects

The cytoplasmic actin genes BmA3 and BmA4 of Bombyx mori were found clustered in a single genomic clone in the same orientation. As a similar clustering of the two cytoplasmic actin genes Ha3a and Ha3b also occurs in another lepidopteran, Helicoverpa armigera, we analyzed the sequence of the pair of genes from each species. Due to the high conservation of cytoplasmic actins, the coding sequence of the four genes was easily aligned, allowing the detection of similarities in noncoding exon and intron sequences as well as in flanking sequences. All four genes exhibited a conserved intron inserted in codon 117, an original position not encountered in other species. It can thus be postulated that all of these genes derived from a common ancestral gene carrying this intron after a single event of insertion. The comparison of the four genes revealed that the genes of B. mori and H. armigera are related in two different ways: the coding sequence and the intron that interrupts it are more similar between paralogous genes within each species than between orthologous genes of the two species. In contrast, the other (noncoding) regions exhibited the greatest similarity between a gene of one species and a gene of the other species, defining two pairs of orthologous genes, BmA3 and HaA3a on one hand and BmA4 and HaA3b on the other. However, in each species, the very high similarities of the coding sequence and of the single intron that interrupts it strongly suggest that gene conversion events have homogenized this part of the sequence. As the divergence of the B. mori genes was higher than that of the H. armigera genes, we postulated that the gene conversion occurred earlier in the B. mori lineage. This leads us to hypothesize that gene conversion could also be responsible for the original transfer of the common intron to the second gene copy before the divergence of the B. mori and H. armigera lineages.     

Two drosophila melanogaster tRNAGly genes are contained in a direct duplication at chromosomal locus 56F.

One Drosophila melanogaster tRNAGly gene occurs on each 1.1-2.0 kb unit of a direct duplication at chromosomal region 56F. The nucleotide sequence of the gene and the 5' flanking region has been determined. The non-transcribed strand sequence of the tRNA gene is: 5' GCATCGGTGGTTCAGTGGTAGAATGCTCGCCTGCCACGCGGGCGGCCCGGGTTCGATTCCCGGCCGATGCA 3'. This nucleotide sequence is identical to that of the major glycine tRNA in Bombyx mori posterior silk gland. Within the 22 kb region mapped, additional tRNA genes are found, an observation consistent with reports that genes for other isoacceptors are present at this locus.     

Cloning and characterization of the highly polymorphic Ser2 gene of Bombyx mori

Three alleles of the sericin (Ser) 2-encoding gene (Ser2), called L, C and mC, were isolated from a Bombyx mori genomic library, and two related ones, called mCL and Cv, were also characterized in B. mori European strains. The Ser2 gene gives rise to two middle silk gland mRNAs by differential splicing. The size of a short mRNA (3.1 kb) is constant, but the length of a longer one ranges from 5 to 6.4 kb depending on the Ser2 allele. These length variations probably result from unequal recombinations in a region which contains about 30 well conserved 45-bp repeats coding for a Ser-like peptide. Furthermore, the L allele (and probably the mCL one) contains a 4.4-kb retrotransposon, resembling the copia-like ones of Drosophila.     

Sequence Identity in an Early Chorion Multigene Family Is the Result of Localized Gene Conversion

The multigene families that encode the chorion (eggshell) of the silk moth, Bombyx mori, are closely linked on one chromosome. We report here the isolation and characterization of two segments, totaling 102 kb of genomic DNA, containing the genes expressed during the early period of choriogenesis. Most of these early genes can be divided into two multigene families, ErA and ErB, organized into five divergently transcribed ErA/ErB gene pairs. Nucleotide sequence identity in the major coding regions of the ErA genes was 96%, while nucleotide sequence identity for the ErB major coding regions was only 63%. Selection pressure on the encoded proteins cannot explain this difference in the level of sequence conservation between the ErA and ErB gene families, since when only fourfold redundant codon positions are considered, the divergence within the ErA genes is 8%, while the divergence within the ErB genes (corrected for multiple substitutions at the same site) is 110%. The high sequence identity of the ErA major exons can be explained by sequence exchange events similar to gene conversion localized to the major exon of the ErA genes. These gene conversions are correlated with the presence of clustered copies of the nucleotide sequence GGXGGX, encoding paired glycine residues. This sequence has previously been correlated with gradients of gene conversion that extend throughout the coding and noncoding regions of the High-cysteine (Hc) chorion genes of B. mori. We suggest that the difference in the extent of the conversion tracts in these gene families reflects a tendency for these recombination events to become localized over time to the protein encoding regions of the major exons.     

Identification and characterization of a novel sericin gene expressed in the anterior middle silk gland of the silkworm Bombyx mori

Sericin is a group of proteins expressed in the middle silk gland that covers the surface of fibroin in the cocoon filament of Bombyx mori. Sericin consists of several serine-rich proteins with different molecular masses. Sericin A is one of the proteins and is produced in the anterior portion of the middle silk gland. To identify the gene coding for the protein, we determined the primary structures of its partial peptides, and the gene was searched using the silkworm genomic databases. Three contigs containing the corresponding nucleotide sequences were identified and categorized as one group. The gene structure covering the 5' flanking and the 3' end was determined by PCR fragments from genomic DNA, RT-PCR, and 5' and 3' RACE. The amino acid sequence deduced from the nucleotide sequence mainly consists of two serine-rich regions of 86-amino acid motif and 8-amino acid repeated sequence. The expression of the gene is limited to the anterior and middle parts of the middle silk gland. In addition, because the sericin gene appeared different from the sericin 1 and 2 genes reported earlier, we designated the newly discovered gene as sericin 3.     

Cytochrome P450 and actin genes expressed in Helicoverpa zea and Helicoverpa armigera: paralogy/orthology identification, gene conversion and evolution.

Molecular phylogenetic analysis was conducted using conserved cytoplasmic actin and diversified cytochrome P450 (P450) sequences isolated from Helicoverpa zea and Helicoverpa armigera, two species thought to be closely related based on allozyme analyses. These sequences were compared in turn with published sequences from other insects to gain insight into how different gene families evolve. In Bombyx mori and these Helicoverpa species, cytoplasmic actin genes are present as a pair of tandemly duplicated paralogs with coding sequence identities as high as 95.5% (B. mori), 98.9% (H. zea) and 98.5% (H. armigera) due to recent 5'-polar gene conversions. Phylogeny and interspecies comparisons assign the six actin genes into two orthologous groups: HaA3a/HzA3a/BmA3 and HaA3b/HzA3b/BmA4, which exhibit more similarities between H. zea and H. armigera than between Helicoverpa species and B. mori. Like the actin genes in H. zea, four CYP6B genes exist as two pairs of duplicated paralogs with recent 5'-polar gene conversions. Interspecific comparisons and phylogeny analysis identified three groups of orthologous CYP6B genes: H. zea CYP6B8 or CYP6B28/H. armigera CYP6B7, H. zea CYP6B27/H. armigera CYP6B6, and H. zea CYP6B9/H. armigera CYP6B2/Heliothis virescens CYP6B10. The low degree of divergence in the first two of these groups is comparable to allelic variation within a single species. These orthologous relationships and the high degrees of similarity in both actin and P450 genes strongly indicate that these Helicoverpa species are extremely closely related.     

Homeodomain binding sites in the 5' flanking region of the Bombyx mori silk fibroin light-chain gene

Multiple A + T-rich stretches in the 5' flanking region of the Bombyx mori fibroin light-chain gene have been shown to bind two Drosophila homeodomain proteins, EVE (even-skipped) and ZEN (zerknüllt), with high affinities. Some of these sites fall into a class that has the established consensus sequence of the binding sites (TCAATTAAAT) for a diverse group of Drosophila homeodomain proteins, while others are quite heterogenous except that they all possess a core TAAT motif. Since clusters of homeodomain binding sites can also be found in the promoters of other silk protein genes, the fibroin gene and the sericin-1 gene, these observations suggest a possible involvement of some homeobox genes in the regulation of a group of silk protein genes.     

Human cytoplasmic actin proteins are encoded by a multigene family

We characterized nine human actin genes that we isolated (Engel et al., Proc. Natl. Acad. Sci. U.S.A. 78:4674-4678, 1981) from a library of cloned human DNA. Measurements of the thermal stability of hybrids formed between each cloned actin gene and alpha-, beta-, and gamma-actin mRNA demonstrated that only one of the clones is most homologous to sarcomeric actin mRNA, whereas the remaining eight clones are most homologous to cytoplasmic actin mRNA. By the following criteria we show that these nine clones represent nine different actin gene loci rather than different alleles or different parts of a single gene: (i) the restriction enzyme maps of the coding regions are dissimilar; (ii) each clone contains sufficient coding region to encode all or most of an entire actin gene; and (iii) each clone contains sequences homologous to both the 5' and 3' ends of the coding region of a cloned chicken beta-actin cDNA. We conclude, therefore, that the human cytoplasmic actin proteins are encoded by a multigene family.     

Tissue- and Stage-Specific Expression of Sericin Genes in the Middle Silk Gland of Bombyx mori

Sericin gene expression in the middle silk glands during Bombyx mori larval development was analyzed using probes from a genomic DNA clone for 10.5 kb sericin mRNA. The 10.5 kb mRNA, the most abundant in the fifth instar, is not detected in the third feeding, fourth feeding and fourth moulting stages. It becomes detectable at 2 days of the fifth instar, and accumulates rapidly. The second major mRNA in the late fifth instar, a 9.0 kb component having a similar sequence to the 10.5 kb mRNA, becomes detectable only at 6 and 7 days of the instar by use of the repetitious coding sequence probe of the sericin clone. Using the same probe about 20 kb RNAs with a fainter intensity than that of the major mRNAs are detected. They are present extremely faintly in the third and fourth feeding stages, disappear in the fourth moulting stage, and increase in the fifth instar. Two other faint poly(A)⁺ RNA components are detected by a DNA probe containing the 5' end sequence of the sericin clone. One is 4.3 kb, and appears in the third, fourth and fifth feeding stages but not in the fourth moulting stage. The other is 3.0 kb, and it becomes detectable after 1 day of the fifth instar.     

The actin genes of Drosophila: protein coding regions are highly conserved but intron positions are not

The entire set of six closely related Drosophila actin genes was isolated using recombinant DNA methodology, and the structures of the respective coding regions were characterized by gene mapping techniques and by nucleotide sequencing of selected portions. Structural comparisons of these genes have resulted in several unexpected findings. Most striking is the nonconservation of the positions of intervening sequences within the protein-encoding regions of these genes. One of the Drosophila actin genes, DmA4, is split within a glycine codon at position 13; none of the remaining five genes is interrupted in the analogous position. Another gene, DmA6, is split within a glycine codon at position 307; at least two of the Drosophila actin genes are not split in the analogous position. Additionally, none of the Drosophila actin genes is split within codon four, where the yeast actin gene is interrupted. The six Drosophila actin genes encode several different proteins, but the amino acid sequence of each is similar to that of vertebrate cytoplasmic actins. None of the genes encodes a protein comparable in primary sequence to vertebrate skeletal muscle actin. Surprisingly, in each of these derived actin amino acid sequences in the initiator methionine is directly followed by a cysteine residue, which in turn precedes the string of three acidic amino acids characteristic of the amino termini of mature vertebrate cytoplasmic actins. We discuss these findings in the context of actin gene evolution and function.