The zab domain of the human RNA editing enzyme ADAR1 recognizes Z-DNA when surrounded by B-DNA

The Zab domain of the editing enzyme ADAR1 binds tightly and specifically to Z-DNA stabilized by bromination or supercoiling. A stoichiometric amount of protein has been shown to convert a substrate of suitable sequence to the Z form, as demonstrated by a characteristic change in the CD spectrum of the DNA. Now we show that Zab can bind not only to isolated Z-forming d(CG)(n) sequences but also to d(CG)(n) embedded in B-DNA. The binding of Zab to such sequences results in a complex including Z-DNA, B-DNA, and two B-Z junctions. In this complex, the d(CG)(n) sequence, but not the flanking region, is in the Z conformation. The presence of Z-DNA was detected by cleavage with a Z-DNA specific nuclease, by undermethylation using Z-DNA sensitive SssI methylase, and by circular dichroism. It is possible that Zab binds to B-DNA with low affinity and flips any favorable sequence into Z-DNA, resulting in a high affinity complex. Alternatively, Zab may capture Z-DNA that exists transiently in solution. The binding of Zab to potential as well as established Z-DNA segments suggests that the range of biological substrates might be wider than previously thought.     

Reduced 4,5',8-trimethylpsoralen cross-linking of left-handed Z-DNA stabilized by DNA supercoiling

Z-DNA-forming sequences, (GT)21, (GT)12ATGT, and (CG)6TA(CG)6, were cloned into plasmids. These sequences formed left-handed Z-DNA conformations under torsional tension from negative supercoiling of DNA. 4,5',8-Trimethylpsoralen, on absorption of 360-nm light, forms monoadducts and interstrand cross-links in DNA that exists in the B-helical conformation. Trimethylpsoralen cross-links were introduced into the potential Z-DNA-forming sequences in relaxed DNA when these sequences existed as B-form DNA. In supercoiled DNA when these sequences existed in the Z conformation, the rate of cross-linking was greatly reduced, and trimethylpsoralen did not form monoadducts appreciably to Z-DNA. As an internal control in these experiments, the rates of cross-linking of the Z-DNA-forming sequences were measured relative to that of an adjacent, cloned sequence that could not adopt a Z conformation. The initial relative rates of cross-linking to Z-DNA-forming sequences were dependent on the superhelical density of the DNA, and the rates were ultimately reduced by factors of 10-15 for Z-DNA in highly supercoiled plasmids. This differential rate of cross-linking provides a novel assay for Z-DNA. Initial application of this assay in vivo suggests that a substantial fraction of (CG)6TA(CG)6, which existed as Z-DNA in plasmid molecules purified from cells, existed in the B conformation in vivo.     

Unpaired structures in SCA10 (ATTCT)n.(AGAAT)n repeats

A number of human hereditary diseases have been associated with the instability of DNA repeats in the genome. Recently, spinocerebellar ataxia type 10 has been associated with expansion of the pentanucleotide repeat (ATTCT)(n).(AGAAT)(n) from a normal range of ten to 22 to as many as 4500 copies. The structural properties of this repeat cloned in circular plasmids were studied by a variety of methods. Two-dimensional gel electrophoresis and atomic force microscopy detected local DNA unpairing in supercoiled plasmids. Chemical probing analysis indicated that, at moderate superhelical densities, the (ATTCT)(n).(AGAAT)(n) repeat forms an unpaired region, which further extends into adjacent A+T-rich flanking sequences at higher superhelical densities. The superhelical energy required to initiate duplex unpairing is essentially length-independent from eight to 46 repeats. In plasmids containing five repeats, minimal unpairing of (ATTCT)(5).(AGAAT)(5) occurred while 2D gel analysis and chemical probing indicate greater unpairing in A+T-rich sequences in other regions of the plasmid. The observed experimental results are consistent with a statistical mechanical, computational analysis of these supercoiled plasmids. For plasmids containing 29 repeats, which is just above the normal human size range, flanked by an A+T-rich sequence, atomic force microscopy detected the formation of a locally condensed structure at high superhelical densities. However, even at high superhelical densities, DNA strands within the presumably compact A+T-rich region were accessible to small chemicals and oligonucleotide hybridization. Thus, DNA strands in this "collapsed structure" remain unpaired and accessible for interaction with other molecules. The unpaired DNA structure functioned as an aberrant replication origin, in that it supported complete plasmid replication in a HeLa cell extract. A model is proposed in which unscheduled or aberrant DNA replication is a critical step in the expansion mutation.     

Length-dependent cruciform extrusion in d(GTAC)n sequences

pBR322-derived plasmids have been constructed carrying d(GTAC)n.d(GTAC)n inserts of different lengths, in order to investigate the effect of insert size on cruciform extrusion and/or the B-Z transition. Plasmids with n ranging from 4 to 12 are hypersensitive to cleavage by the single-strand specific nucleases, S1 nuclease and Bal31 nuclease. Hypersensitive sites associated with the smaller alternating purine-pyrimidine tracts, however, coexist with the major pBR322 sites. Site-selective cleavage of these plasmids with the resolvase, T7 endonuclease I, demonstrates that all the inserts form cruciform structures when stably integrated into negatively supercoiled plasmids. An increase in the negative superhelical density of the DNA's induces cruciform formation within the insert region, resulting in a reduction in torsional stress consistent with the size of the insert. Moreover, as n decreases, the superhelical density required to stabilise the cruciform state increases. Therefore, the cruciform geometry is the favoured conformation of these d(GTAC)n.d(GTAC)n sequences under torsional stress. The stability of these cruciforms increases as n increases, with cruciformation occurring at lower superhelical densities and to the exclusion of the other pBR322 cruciforms.     

Isolation and characterization of Z-DNA binding proteins from wheat germ

The preparation of a heterogeneous non-histone protein extract from wheat germ utilizing Br-poly(dG-dC).poly(dG-dC) (Z-DNA) affinity chromatography is described. The binding characteristics of antibodies against Z-DNA are used as a model system to define important criteria that the DNA binding behavior of a Z-DNA binding protein should display. We show that the wheat germ extract contains DNA binding proteins specific for left-handed Z-DNA by these criteria. The affinity of the proteins measured by competition experiments was approximately 10(5) greater for Br-poly(dG-dC).poly(dG-dC) (Z-DNA) than for poly(dG-dC).poly(dG-dC) (B-DNA). The affinity of the proteins for plasmid DNA increases with increasing negative superhelicity which is known to stabilize Z-DNA. The proteins are shown to compete with Z-DNA antibodies for binding to supercoiled plasmids. Finally, the affinity for two plasmids at a given superhelical density is greater for the plasmid containing an insert known to form Z-DNA than for a plasmid without the insert. The proteins exhibit a 2-3-fold greater affinity for stretches of (dC-dA)n.(dT-dG)n over stretches of (dG-dC)n.(dG-dC)n when both sequences are induced to form Z-DNA by supercoiling.     

The Zβ domain of human DAI binds to Z-DNA via a novel B-Z transition pathway

The human DNA-dependent activator of IFN-regulatory factor (DAI) protein, which activates the innate immune response in response to DNA, contains two tandem Z-DNA binding domains (Zα and Zβ) at the NH(2) terminus. The hZβ(DAI) structure is similar to other Z-DNA binding proteins, although it demonstrates an unusual Z-DNA recognition. We performed NMR experiments on complexes of hZβ(DAI) with DNA duplex, d(CGCGCG)(2), at a variety of protein-to-DNA molar ratios. The results suggest that hZβ(DAI) binds to Z-DNA via an active-di B-Z transition mechanism, where two hZβ(DAI) proteins bind to B-DNA to form the hZβ(DAI)-B-DNA complex; the B-DNA is subsequently converted to left-handed Z-DNA. This novel mechanism of DNA binding and B-Z conversion is distinct from Z-DNA binding of the human ADAR1 protein.     

Interaction between the Z-type DNA duplex and 1,3-propanediamine: crystal structure of d(CACGTG)2 at 1.2 A resolution

The crystal structure of a hexamer duplex d(CACGTG)(2) has been determined and refined to an R-factor of 18.3% using X-ray data up to 1.2 A resolution. The sequence crystallizes as a left-handed Z-form double helix with Watson-Crick base pairing. There is one hexamer duplex, a spermine molecule, 71 water molecules, and an unexpected diamine (Z-5, 1,3-propanediamine, C(3)H(10)N(2)) in the asymmetric unit. This is the high-resolution non-disordered structure of a Z-DNA hexamer containing two AT base pairs in the interior of a duplex with no modifications such as bromination or methylation on cytosine bases. This structure does not possess multivalent cations such as cobalt hexaammine that are known to stabilize Z-DNA. The overall duplex structure and its crystal interactions are similar to those of the pure-spermine form of the d(CGCGCG)(2) structure. The spine of hydration in the minor groove is intact except in the vicinity of the T5A8 base pair. The binding of the Z-5 molecule in the minor grove of the d(CACGTG)(2) duplex appears to have a profound effect in conferring stability to a Z-DNA conformation via electrostatic complementarity and hydrogen bonding interactions. The successive base stacking geometry in d(CACGTG)(2) is similar to the corresponding steps in d(CG)(3). These results suggest that specific polyamines such as Z-5 could serve as powerful inducers of Z-type conformation in unmodified DNA sequences with AT base pairs. This structure provides a molecular basis for stabilizing AT base pairs incorporated into an alternating d(CG) sequence.     

Anti-Z-DNA antibody binding can stabilize Z-DNA in relaxed and linear plasmids under physiological conditions.

It is shown that anti-Z-DNA antibody binding can stabilize sequences of d(CG/GC)n and d(CA/GT)n in the Z-DNA conformation in a plasmid in the complete absence of supercoiling. This effect is quantitated by using antibody preparations of different affinities and varying concentrations. The d(CG/GC)n sequence can be stabilized under physiological conditions. This is the first demonstration that a region of Z-DNA can be stabilized by protein binding in a completely relaxed plasmid under physiological conditions. The antibody-Z-DNA complex in the relaxed plasmid is shown to be an equilibrium state and not a long-lived kinetic intermediate since specific binding of the antibody to linearized plasmids containing Z-forming sequences is observed.     

Hyperreactivity of B-Z junctions to 4,5',8-trimethylpsoralen photobinding assayed by an exonuclease III/photoreversal mapping procedure

We have developed an exonuclease III/photoreversal procedure to map, with base-pair resolution, the bases that have photoreacted with 4,5',8-trimethylpsoralen (Me3-psoralen) forming either monoadducts or interstrand crosslinks in DNA. This assay allows quantification of relative rates of Me3-psoralen photobinding to bases in DNA at levels less than one crosslink per 8000 base-pairs. We demonstrate the applicability of the Me3-psoralen mapping procedure on the Z-forming sequence GAATT(CG)6-TA(CG)6AATTC. The results confirm our previous findings that Me3-psoralen forms crosslinks in the 5'TA within the (CG)6TA(CG)6 sequence when it exists in the B conformation but not when it exists in the Z conformation. In addition, with increasing superhelical density we observe at least a hundred-fold increased Me3-psoralen presumably represent B-Z junctions. The two presumed junctions respond differently with increasing negative superhelical tension, however, suggesting that the structures of these negative superhelical tension, however, suggesting that the structures of these junctions differ. This increased Me3-psoralen photoreactivity provides a positive signal for the presence of Z-DNA. The sequence and assay described here provide a "torsionally tuned probe" for determining the effective superhelical density of DNA in vivo.     

Competing B-Z and helix-coil conformational transitions in supercoiled plasmid DNA.

The formation of melted regions from A + T-rich sequences and left-handed Z-DNA by alternating purine-pyrimidine sequences will both be facilitated by negative supercoiling, and thus if the sequences are present within the same plasmid molecule they will compete for the free energy of supercoiling. We have studied a series of plasmids that contain either (CG)8 or (TG)12 sequences in either G + C or A + T-rich contexts, by means of two-dimensional gel electrophoresis and chemical modification. We observe both B-Z and helix-coil transitions in all plasmids at elevated temperatures and low ionic strength. The plasmids fall into a number of different classes, in terms of the conformational behavior. As the superhelix density is increased, pCG8/vec ((CG)8 in G + C-rich context) undergoes an initial B-Z transition, followed by melting transitions in sequences remote from the (CG)8 sequence. The two transitions are coupled through the topology of the molecule but are otherwise independent. When the (CG)8 sequence was placed in an A + T-rich context (pCG8/col), the helix-coil transition was perturbed by the presence of the Z-DNA segment. Replacement of the (CG)8 tracts by (TG)12 sequences resulted in a further level of interaction between the transitions. Statistical mechanical modeling of the transitions suggested that at intermediate levels of negative supercoiling the Z-DNA formed by the (TG)12 sequence has a lowered probability due to the helix-coil transition in the A + T-rich sequences. These studies illustrate the complexities of competing conformational equilibria in supercoiled DNA molecules.     

Stochastic distribution of a short region of Z-DNA within a long repeated sequence in negatively supercoiled plasmids

We have analyzed, at nucleotide resolution, the progress of the B-to-Z transition as a function of superhelical density in a 2.2-kilobase plasmid containing the sequence d(C-A)31.d(T-G)31. The transition was monitored by means of reactivity to two chemical probes: diethyl pyrocarbonate, which is sensitive to the presence of Z-DNA, and hydroxylamine, which detects B-Z junctions. At a threshold negative superhelical density between about 0.048 and 0.056, hyper-reactivity to diethyl pyrocarbonate appears throughout the CA/TG repeat and remains as the superhelical density is further increased. However, there is no reactivity characteristic of B-Z junctions until the superhelical density reaches 0.084, when single cytosines at each end of the repeat become hyper-reactive to hydroxylamine. A two-dimensional gel analysis of this system by others (Haniford, D. B., and Pulleyblank, D. E. (1983) Nature 302, 632-634) indicates that only about half of the 62 base pairs of the CA/TG repeat undergo the initial transition at omega = 0.056. Our results indicate that this region of Z-DNA is free to exist anywhere along the CA/TG repeat and is probably constantly in motion. Well defined B-Z junctions are seen only when there is sufficient supercoiling to convert the entire CA/TG sequence to Z-DNA. The implications for possible B-Z transitions in chromosomal domains of different sizes are discussed.     

Analysis of trimethylpsoralen photoreactivity to Z-DNA provides a general in vivo assay for Z-DNA: analysis of the hypersensitivity of (GT)n B-Z junctions

We have described an exonuclease III/photoreversal procedure to map, with base pair resolution, the bases which have photoreacted with 4,5',8-trimethylpsoralen (Me3-psoralen) forming either monoadducts or interstrand cross-links in DNA (20). This assay allows quantitation of relative rates of Me3-psoralen photobinding to bases in DNA at levels as low as one cross-link per 8,000 base pairs. This assay should be useful for a wide variety of applications of Me3-psoralen photobinding to DNA. Here, we demonstrate the applicability of the Me3-psoralen exo III assay for analysis of the conformation of the Z forming sequences (GT)12ATGT and GAATTC(TG)6TA(TG)6. We have shown previously that Me3-psoralen forms crosslinks in the 5'TA within the (CG)6TA(CG)6 sequence when it exists in the B conformation but not when it exists in the Z conformation (34). More recently we have confirmed this result with the exo III assay and have shown at least a hundred fold increase in Me3-psoralen photoreactivity at the 5'AT sequence within the EcoR I sites (GAATTC) which presumably represent B-Z junctions flanking (CG)6TA(CG)6 (20). Here we demonstrate both the characteristic decrease in psoralen photobinding to 5'TAs within (GT)12ATGT and (TG)6TA(TG)6 and the hyperreactivity of B-Z junctions. These characteristic properties of Me3-psoralen photobinding provide an assay for Z-DNA that is applicable in vivo. The general applicability of this approach for assaying Z-DNA in vivo is discussed.     

In vivo assessment of the Z-DNA-forming potential of d(CA.GT)n and d(CG.GC)n sequences cloned into SV40 minichromosomes

Alternating repeated d(CA.GT)n and d(CG.GC)n sequences constitute a significant proportion of the simple repeating elements found in eukaryotic genomic DNA. These sequences are known to form left-handed Z-DNA in vitro. In this paper, we have addressed the question of the in vivo determination of the Z-DNA-forming potential of such sequences in eukaryotic chromatin. For this purpose, we have investigated the ability of a d(CA.GT)30 sequence and a d(CG.GC)5 sequence to form left-handed Z-DNA when cloned into simian virus 40 (SV40) minichromosomes at two different positions: the TaqI site, which occurs in the intron of the T-antigen gene, and the HpaII site, which is located in the late promoter region within the SV40 control region. Formation of Z-DNA at the inserted repeated sequences was analyzed through the change in DNA linkage associated with the B to Z transition. Our results indicate that regardless of: (1) the site of insertion (either TaqI or HpaII), (2) the precise moment of the viral lytic cycle (from 12 h to 48 h postinfection) and (3) the condition of incorporation of the SV40 recombinants to the host cells (either as minichromosomes or as naked DNA, relaxed or negatively supercoiled), neither the d(CA.GT)30 nor the d(CG.GC)5 sequence are stable in the left-handed Z-DNA conformation in the SV40 minichromosome. The biological relevance of these results is discussed.     

Length-Dependent Cruciform Extrusion in d(GTAC)n Sequences

Abstract

pBR322-derived plasmids have been constructed carrying d(GTAC)_n·d(GTAC)_n inserts of different lengths, in order to investigate the effect of insert size on cruciform extrusion and/or the B-Z transition. Plasmids with n ranging from 4 to 12 are hypersensitive to cleavage by the single-strand specific nucleases, S1 nuclease and Bal31 nuclease. Hypersensitive sites associated with the smaller alternating purine-pyrimidine tracts, however, coexist with the major pBR322 sites. Site-selective cleavage of these plasmids with the resolvase, T7 endonuclease I, demonstrates that all the inserts form cruciform structures when stably integrated into negatively supercoiled plasmids. An increase in the negative superhelical density of the DNA's induces cruciform formation within the insert region, resulting in a reduction in torsional stress consistent with the size of the insert. Moreover, as n decreases, the superhelical density required to stabilise the cruciform state increases. Therefore, the cruciform geometry is the favoured conformation of these d(GTAC)_n·d(GTAC)_n sequences under torsional stress. The stability of these cruciforms increases as n increases, with cruciformation occurring at lower superhelical densities and to the exclusion of the other pBR322 cruciforms.     

Sequences near the origin of replication of the DHFR locus of Chinese hamster ovary cells adopt left-handed Z-DNA and triplex structures

The earliest replicating portion of the Chinese hamster dihydrofolate reductase domain contains a cluster of simple repeated sequences 180 base pairs long composed of 5'-(GC)5(AC)18(AG)21(G)9(CAGA)4GAGGGAGAGAGGCAGAGAGGG(AG)27-3 '. Previous nuclease sensitivity and intermolecular hybridization studies suggested that the two long (AG) repeats in this tract formed intramolecular DNA triplexes in negatively supercoiled plasmids at pH 5.2 (Caddle, M. S., Lussier, R. L., and Heintz, N. H. (1990) J. Mol. Biol. 211, 19-33). To further characterize the structural organization, supercoiled plasmids containing this region were analyzed in vitro with OsO4 and diethyl pyrocarbonate probes as well as with two-dimensional gel electrophoresis under different conditions. In pMCG, which contains the sequence in a 1.6-kilobase pair insert, the preferred conformation at neutral pH and at the native superhelical density is a Z-DNA structure for the (GC)5(AC)18 tract. Under mildly acidic conditions and at the native superhelical density, both (AG) tracts form intramolecular triplexes to the exclusion of the Z-DNA structure. Chemical probing of topoisomers of pMCG indicates that the (AG)27 tract forms a triplex more readily than the (AG)21 motif. Also, analysis of the reactivity obtained on a larger plasmid, pMCD, which contains the cluster of repeated sequences in a 4.75-kilobase pair insert, shows that at the native superhelical density the formation of intramolecular triplexes is limited to the (AG)27 tract. Finally, experiments conducted on different populations of topoisomers of pMCG show the existence, at pH 5.0 and highly negative superhelical density (greater than or equal to 0.080), of both the left-handed and the two triple-stranded structures in the same DNA. Therefore, one triplex is located immediately adjacent to the Z helix. Companion studies revealed that this region of the DHFR replicon modulates fork translocation during the replication of recombinant plasmids in mammalian cells.