Dramatic effect of single-base mutation on the conformational dynamics of human telomeric G-quadruplex

Guanine-rich DNA sequences can form G-quadruplexes. These four-stranded structures are known to form in several genomic regions and to influence certain biological activities. Sometimes, the instability of G-quadruplexes causes the abnormal biological processes. Mutation is a culprit for the destabilization of G-quadruplexes, but the details of mutated G-quadruplexes are poorly understood. In this article, we investigated the conformational dynamics of single-base mutated human telomeric G-quadruplexes in the presence of K⁺ with single-molecule FRET spectroscopy. We observed that the replacement of single guanine by thymine in a G-track induces various folded structures, i.e. structural polymorphism. Moreover, direct observation of their dynamics revealed that a single-base mutation causes fast unfolding of folded states under physiological conditions. Furthermore, we found that the degree of destabilization varies according to mutation positions. When the central guanine of a G-track is replaced, the G-quadruplexes unfold quickly at any K⁺ concentrations and temperature. Meanwhile, outer-quartet mutated G-quadruplexes have heterogeneous dynamics at intermediate K⁺ concentrations and longstanding folded states at high K⁺ concentrations. Several factors such as base-stacking interaction and K⁺ coordination are responsible for the different dynamics according to the mutation position.     

Structure of the Hybrid-2 type intramolecular human telomeric G-quadruplex in K+ solution: insights into structure polymorphism of the human telomeric sequence

Formation of the G-quadruplex in the human telomeric sequence can inhibit the activity of telomerase, thus the intramolecular telomeric G-quadruplexes have been considered as an attractive anticancer target. Information of intramolecular telomeric G-quadruplex structures formed under physiological conditions is important for structure-based drug design. Here, we report the first structure of the major intramolecular G-quadruplex formed in a native, non-modified human telomeric sequence in K⁺ solution. This is a hybrid-type mixed parallel/antiparallel-G-stranded G-quadruplex, one end of which is covered by a novel T:A:T triple capping structure. This structure (Hybrid-2) and the previously reported Hybrid-1 structure differ in their loop arrangements, strand orientations and capping structures. The distinct capping structures appear to be crucial for the favored formation of the specific hybrid-type intramolecular telomeric G-quadruplexes, and may provide specific binding sites for drug targeting. Our study also shows that while the hybrid-type G-quadruplexes appear to be the major conformations in K⁺ solution, human telomeric sequences are always in equilibrium between Hybrid-1 and Hybrid-2 structures, which is largely determined by the 3′-flanking sequence. Furthermore, both hybrid-type G-quadruplexes suggest a straightforward means for multimer formation with effective packing in the human telomeric sequence and provide important implications for drug targeting of G-quadruplexes in human telomeres.     

Recognition of human telomeric G‐quadruplex DNA by berberine analogs: effect of substitution at the 9 and 13 positions of the isoquinoline moiety

G‐quadruplex forming sequences are widely distributed in human genome and serve as novel targets for regulating gene expression and chromosomal maintenance. They offer unique targets for anticancer drug development. Here, the interaction of berberine (BC) and two of its analogs bearing substitution at 9 and 13‐position with human telomeric G‐quadruplex DNA sequence has been investigated by biophysical techniques. Both the analogs exhibited several‐fold higher binding affinity than berberine. The Scatchard binding isotherms revealed non‐cooperative binding. 9‐ω‐amino hexyl ether analog (BC1) showed highest affinity (1.8 × 10⁶ M^?1) while the affinity of the 13‐phenylpropyl analog (BC2) was 1.09 × 10⁶ M^?1. Comparative fluorescence quenching and polarization anisotropy of the emission spectra gave evidence for a stronger stacking interaction of the analogs compared to berberine. The thiazole orange displacement assay has clearly established that the analogs were more effective in displacing the end stacked dye in comparison to berberine. However, the binding of the analogs did not induce any major structural perturbation in the G‐quadruplex structure, but led to higher thermal stability. Energetics of the binding indicated that the association of the analogs was exothermic and predominantly entropy driven phenomenon. Increasing the temperature resulted in weaker binding; the enthalpic contribution increased and the entropic contribution decreased. A small negative heat capacity change with significant enthalpy–entropy compensation established the involvement of multiple weak noncovalent interactions in the binding process. The 9‐ω‐amino hexyl ether analog stabilized the G‐quadruplex structure better than the 13‐phenyl alkyl analog. Copyright © 2015 John Wiley & Sons, Ltd.     

Spectral properties and DNA targeting features of a thiazole orange-peptide bioconjugate

The molecular recognition features of a DNA-sensitive fluorescent bioconjugate capable of targeting a specific DNA sequence with high efficiency are described. The bioconjugate combines a polypeptide from the Tc3 transposase DNA-binding domain with the dsDNA-sensitive fluorophore thiazole orange. Fluorescence spectroscopy and circular dichroism reveal that the polypeptide moiety determines the DNA sequence specificity as the intercalating dye makes nonspecific contributions to binding affinity. The conjugated thiazole orange is able to intercalate and fluoresce when the peptide binds at concentrations where little fluorescence is observed from either the bioconjugate alone or the bioconjugate mixed with DNA lacking the target sequence. Fluorescence studies indicate this molecular probe is sequence specific, binds the native Tc3 DNA target sequence with nanomolar affinity (KD approximately 15 nM), and is able to discriminate multiple point mutations in the cognate DNA site. The attachment of a sequence-specific binding peptide onto a functional probe provides a viable strategy for construction of synthetic enzymes and repressors, and facilitates dynamic studies of protein-DNA interactions.     

Aminoglycoside binding to Oxytricha nova telomeric DNA

Telomeric DNA sequences have been at the center stage of drug design for cancer treatment in recent years. The ability of these DNA structures to form four-stranded nucleic acid structures, called G-quadruplexes, has been perceived as target for inhibiting telomerase activity vital for the longevity of cancer cells. Being highly diverse in structural forms, these G-quadruplexes are subjects of detailed studies of ligand-DNA interactions of different classes, which will pave the way for logical design of more potent ligands in future. The binding of aminoglycosides was investigated with Oxytricha nova quadruplex forming DNA sequence (GGGGTTTTGGGG)(2). Isothermal titration calorimetry (ITC) determined ligand to quadruplex binding ratio shows 1:1 neomycin:quadruplex binding with association constants (K(a)) ～ 10(5) M(-1) while paromomycin was found to have a 2-fold weaker affinity than neomycin. The CD titration experiments with neomycin resulted in minimal changes in the CD signal. FID assays, performed to determine the minimum concentration required to displace half of the fluorescent probe bound, showed neomycin as the best of the all aminoglycosides studied for quadruplex binding. Initial NMR footprint suggests that ligand-DNA interactions occur in the wide groove of the quadruplex. Computational docking studies also indicate that aminoglycosides bind in the wide groove of the quadruplex.     

Thiazole orange as the fluorescent intercalator in a high resolution fid assay for determining DNA binding affinity and sequence selectivity of small molecules.

The viability of using thiazole orange as an alternative to ethidium bromide in a fluorescent intercalator displacement (FID) assay is explored by profiling the DNA binding affinity and sequence selectivity of netropsin. Utilizing a library of hairpin deoxyoligonucleotides containing all possible four base-pair sequences, the method provides a high resolution profile of the DNA binding properties of small molecules in a high throughput format.     

A Phenazine based colorimetric and fluorescent chemosensor for sequential detection of Ag+ and I− in aqueous media

A new colorimetric and fluorescent probe MNTPZ based on 1H‐imidazo[4,5‐b]phenazine derivative has been designed and synthesized for successive detection of Ag⁺ and I^?. The probe MNTPZ shows selective colorimetric response by a change in color from yellow to orange and “turn‐off” fluorometric response upon binding with Ag⁺ in DMSO: Water (pH = 7, 1:1, v/v) over other cations. The binding mode of probe MNTPZ to Ag⁺ was studied by Job's plot, ¹H NMR studies, FT‐IR spectroscopy and DFT calculations. Moreover, the situ generated probe MNTPZ + Ag⁺ complex acted as an efficient fluorometric “turn‐on” probe for I^? via Ag⁺ displacement approach. The detection limit of probe MNTPZ for Ag⁺ and the resultant complex probe MNTPZ + Ag⁺ for I^? were determined to be 1.36 μmol/L and 1.03 μmol/L respectively. Notably, the developed probe was successfully used for quantitative determination of I^? in real samples with satisfactory results.     

(Na+,K+)-ATPase of mammalian brain: Effects of temperature on cation and ATP interactions regulating phosphatase activity

The effects of temperature on interactions between univalent cations or ATP and the p-nitrophenylphosphatase activity associated with brain (Na⁺,K⁺)-ATPase were examined. The apparent affinity for K⁺ activation under conditions favoring the moderate affinity site was temperature dependent, increasing with decreasing temperature. A comparison of univalent cations showed that the negative apparent ΔH and ΔS for cation binding increased with increasing apparent cation affinity. In contrast to the case with the moderate affinity sites, apparent affinity for the high affinity K⁺ site was independent of temperature. As temperature decreased, properties of moderate affinity site binding approached those of the high affinity site. The temperature dependence of ATP inhibition was opposite to that for K⁺ activation, with positive apparent ΔH and ΔS. The apparent ΔH and ΔS for cation binding approached those for the overall conformational change to K⁺-sensitive enzyme as cation affinity increased. These data suggest that E2, the K⁺-sensitive form of (Na⁺,K⁺)-ATPase, is stabilized by forces that require a decrease in entropy, explaining the predominant existence of E1 at physiologic temperatures. A conformational change leading to stabilization of E2 at higher temperatures can be produced by binding of univalent cations to a moderate affinity, presumably intracellular, site. This effect is counteracted by ATP. ATP also appears to alter the selectivity of this site to favor Na⁺ over K⁺ binding.     

Emulsified BMVC derivative induced filtration for G-quadruplex DNA structural separation

A novel method based on emulsion/filtration is introduced for G-quadruplex DNA structural separation. We first synthesized a lipophilic analogue of BMVC, 3,6-Bis(1-methyl-4-vinylpyridinium)-9-(12′-bromododecyl) carbazole diiodide (BMVC-12C-Br), which can form an oil-in-water (o/w) phase emulsion. Due to the binding preferences of BMVC-12C-Br emulsion to some specific DNA structures, the large emulsion (∼2 µm) bound DNA was separated from the small free DNA in the filtrate by a 0.22 µm pore size MCE membrane. This method is able to isolate the non-parallel G-quadruplexes from the parallel G-quadruplexes and the linear duplexes from both G-quadruplexes. In addition, this method allows us not only to determine the absence of the parallel G-quadruplexes of d(T₂AG₃)₄ and the presence of the parallel G-quadruplexes of d(T₂AG₃)₂ in K⁺ solution, but also to verify structural conversion from antiparallel to parallel G-quadruplexes of d[AG₃(T₂AG₃)₃] in K⁺ solution under molecular PEG condition. Moreover, this emulsion can separate the non-parallel G-quadruplexes of d(G₃CGCG₃AGGAAG₅CG₃) monomer from the parallel G-quadruplexes of its dimer in K⁺ solution. Together with NMR spectra, one can simplify the spectra for both the free DNA and the bound DNA to establish a spectrum-structure correlation for further structural analysis.     

The binding of phloridzin to the isolated luminal membrane of the renal proximal tubule

The binding of [³H]ploridzin by isolated luminal membranes of the rabbit proximal tubule and by slices of rabbit kidney cortex was studied.Kinetic analyses of the relationship between the concentration of phloridizin in the incubation medium and the binding of phloridzin to the membrane indicated two distinct classes of receptors sites. One class, comprising high affinity sites, reached saturation at 20–25 μM phloridzin, had a K(phloridzin) of 8 μM, and 8·10⁺² nmoles interacted with 1 mg of brush border protein. The other class, comprising low affinity sites, had a K(phloridzin) of 2.5 mM, and the number of binding sites was 1.25 nmoles/mg Na⁺ was required for the binding of phloridzin at the high affinity sites. Na⁺ decreased the apparent K_i for phloridzin; the apparent V of binding was not altered. Binding at the low affinity sites was independent of Na⁺. Ca²⁺ was necessary for maximal binding at the high affinity sites. Binding of phloridzin at high affinity sites was more sensitive to N-ethylmalcimide and mersalyl than was binding at low affinity sites. Binding at high affinity sites, but not at low affinity sites, was temperature dependent.d-Glucose was a competitive inhibitor of the high affinity binding of phloridzin. The apparent K₁ was 1 mM. D-Glucoe inhibited non-competitively at the low affinity sites. l-Glucose had no influence on phloridzin binding. Phloretin was a competitive inhibitor of high affinity phloridzin binding with an apparent K_i of 16 μM. Phloretin inhibited low affinity bindings of phloridizin non-competitively. Binding of phloridzin at high affinity sites was completely reversible. Binding at low affinity sites was only partially reversed. Phloridzin bound at high affinity sites on the brush border was displaced by phloridzin and phloretin but not by d-glucose.The mechanism of the high affinity binding of phloridzin was distinguished from that of the initial interaction of d-glucose with the membrane. Binding of phloridzin required Na⁺, whereas the interaction of d-glucose with the membranes had a prominent Na⁺-independent component.Intact renal cells in cortical slices accumulated phloridzin. The uptake did not saturate, was Na⁺ independent, and was not competitively inhibited by sugars. These characteristics resemble those for the low affinity binding of phloridzin by isolated membranes. It is suggested that low affinity binding may represent an initial binding followed by uptake of the glycoside into membrane vesicles.     

2E8 Binds to the High Affinity I-domain in a Metal Ion-dependent Manner: A SECOND GENERATION MONOCLONAL ANTIBODY SELECTIVELY TARGETING ACTIVATED LFA-1*

The activation of leukocyte function-associated antigen-1 (LFA-1) plays a critical role in regulating immune responses. The metal ion-dependent adhesion site on the I-domain of LFA-1 α_L subunit is the key recognition site for ligand binding. Upon activation, conformation changes in the I-domain can lead LFA-1 from the low affinity state to the high affinity (HA) state. Using the purified HA I-domain locked by disulfide bonds for immunization, we developed an mAb, 2E8, that specifically binds to cells expressing the HA LFA-1. The surface plasmon resonance analysis has shown that 2E8 only binds to the HA I-domain and that the dissociation constant (K_D) for HA I-domain is 197 nm. The binding of 2E8 to the HA I-domain is metal ion-dependent, and the affinity decreased as Mn²⁺ was replaced sequentially by Mg²⁺ and Ca²⁺. Surface plasmon resonance analysis demonstrates that 2E8 inhibits the interaction of HA I-domain and ICAM-1. Furthermore, we found that 2E8 can detect activated LFA-1 on both JY and Jurkat cells using flow cytometry and parallel plate adhesion assay. In addition, 2E8 inhibits JY cell adhesion to human umbilical vein endothelial cells and homotypic aggregation. 2E8 treatment reduces the proliferation of both human CD4⁺ and CD8⁺ T cells upon OKT3 stimulation without the impairment of their cytolytic function. Taken together, these data demonstrate that 2E8 is specific for the high affinity form of LFA-1 and that 2E8 inhibits LFA-1/ICAM-1 interactions. As a novel activation-specific monoclonal antibody, 2E8 is a potentially useful reagent for blocking high affinity LFA-1 and modulating T cell activation in research and therapeutics.     

Calorimetric and spectroscopic studies of aminoglycoside binding to AT-rich DNA triple helices

Calorimetric and fluorescence techniques were used to characterize the binding of aminoglycosides-neomycin, paromomycin, and ribostamycin, with 5′-dA₁₂-x-dT₁₂-x-dT₁₂-3′ intramolecular DNA triplex (x = hexaethylene glycol) and poly(dA)·2poly(dT) triplex. Our results demonstrate the following features: (1) UV thermal analysis reveals that the T_m for triplex decreases with increasing pH value in the presence of neomycin, while the T_m for the duplex remains unchanged. (2) The binding affinity of neomycin decreases with increased pH, although there is an increase in observed binding enthalpy. (3) ITC studies conducted in two buffers (sodium cacodylate and MOPS) yield the number of protonated drug amino groups (Δn) as 0.29 and 0.40 for neomycin and paromomycin interaction with 5′-dA₁₂-x-dT₁₂-x-dT₁₂-3′, respectively. (4) The specific heat capacity change (ΔC_p) determined by ITC studies is negative, with more negative values at lower salt concentrations. From 100 mM to 250 mM KCl, the ΔC_p ranges from −402 to −60 cal/(mol K) for neomycin. At pH 5.5, a more positive ΔC_p is observed, with a value of −98 cal/(mol K) at 100 mM KCl. ΔC_p is not significantly affected by ionic strength. (5) Salt dependence studies reveal that there are at least three amino groups of neomycin participating in the electrostatic interactions with the triplex. (6) FID studies using thiazole orange were used to derive the AC₅₀ (aminoglycoside concentration needed to displace 50% of the dye from the triplex) values. Neomycin shows a seven fold higher affinity than paromomycin and eleven fold higher affinity than ribostamycin at pH 6.8. (7) Modeling studies, consistent with UV and ITC results, show the importance of an additional positive charge in triplex recognition by neomycin. The modeling and thermodynamic studies indicate that neomycin binding to the DNA triplex depends upon significant contributions from charge as well as shape complementarity of the drug to the DNA triplex Watson–Hoogsteen groove.     

Direct visualization of nucleolar G-quadruplexes in live cells by using a fluorescent light-up probe

Background

Direct detection of G-quadruplexes in human cells has become an important issue due to the vital role of G-quadruplex related to biological functions. Despite several probes have been developed for detection of the G-quadruplexes in cytoplasm or whole cells, the probe being used to monitor the nucleolar G-quadruplexes is still lacking.

Dominant Driving Forces in Human Telomere Quadruplex Binding-Induced Structural Alterations

Recently various pathways of human telomere (ht) DNA folding into G-quadruplexes and of ligand binding to these structures have been proposed. However, the key issue as to the nature of forces driving the folding and recognition processes remains unanswered. In this study, structural changes of 22-mer ht-DNA fragment (Tel22), induced by binding of ions (K⁺, Na⁺) and specific bisquinolinium ligands, were monitored by calorimetric and spectroscopic methods and by gel electrophoresis. Using the global model analysis of a wide variety of experimental data, we were able to characterize the thermodynamic forces that govern the formation of stable Tel22 G-quadruplexes, folding intermediates, and ligand-quadruplex complexes, and then predict Tel22 behavior in aqueous solutions as a function of temperature, salt concentration, and ligand concentration. On the basis of the above, we believe that our work sets the framework for better understanding the heterogeneity of ht-DNA folding and binding pathways, and its structural polymorphism.     

Interaction of [Ru(bpy)2(dppz)] with human telomeric DNA: Preferential binding to G-quadruplexes over i-motif

Inspired by the enormous importance attributed to the structure and function of human telomeric DNA, we focus our attention on the interaction of [Ru(bpy)₂(dppz)]²⁺ with the guanine-rich single-strand oligomer 5′-AGGGTTAGGGTTAGGGTTAGGG-3′ (22AG) and the complementary cytosine-rich strand (22CT). In Na⁺ buffer, 22AG may adopt an antiparallel basket quadruplex, whereas, it favours a mixed parallel/antiparallel structure in K⁺ buffer. 22CT may self-associate at acidic pH into an i-motif. In this paper, the interaction between [Ru(bpy)₂(dppz)]²⁺ and each unusual DNA was evaluated. It was interesting that [Ru(bpy)₂(dppz)]²⁺ could promote the human telomeric repeat 22AG to fold into intramolecular antiparallel G-quadruplex without any other cations. What's more, [Ru(bpy)₂(dppz)]²⁺ was found to have a strong preference for binding to G-quadruplexes that were induced through either Na⁺ or K⁺, while weak binding to i-motif was observed. The results also indicated that [Ru(bpy)₂(dppz)]²⁺ could serve as a prominent molecular “light switch” for both G-quadruplexes, revealing a potential application of the title complex in luminescent signaling of G-quadruplex DNA.     

Benzo(h)quinoline derivatives as G-quadruplex binding agents

G-quadruplexes are unusual structures formed from guanine-rich sequences of nucleic acids. G-quadruplexes have been postulated to play important roles in a number of biological systems including gene regulation and the inhibition of enzyme function. Recently, our laboratory reported on the synthesis and evaluation of a triaza-cyclopentaphenanthrene compound which bound to G-quadruplexes with good affinity and selectivity. This compound contains a 4-pyridone group which has not been previously utilized in other quadruplex binding agents. In this Letter, we describe the synthesis and evaluation of 4-pyridone containing 2- and 3-carboxy-benzoquinolines as G-quadruplex binding agents. We find that these compounds are capable of binding G-quadruplexes with a K_a in the range of 3 × 10⁵ M^?1 and with a 10-fold selectivity for quadruplex over duplex DNA.     

Two‐channel near‐infrared fluorescence Ag+ ion sensing of a new star‐shaped dendrimer

A new near‐infrared fluorescence sensor PDI‐PD for Ag⁺ ions was successfully prepared and its structure characterized by ¹H nuclear magnetic resonance (NMR), ¹³C NMR and high‐resolution mass spectrometry; matrix‐assisted laser desorption/ionization time‐of‐flight mass spectrometry (HRMS MALDI‐TOF). The probe exhibited rapid, sensitive, and selective two‐channel fluorescence responses towards Ag⁺ ions and protons. The probe has a marked high binding affinity and high sensitivity for Ag⁺, with a detection limit of 1.4 × 10^?6 M. An approximately five‐fold enhanced core emission at 784 nm was attributed to fluorescence resonance energy transfer (FRET). The enhanced core emission of the probe with Ag⁺ ions based on photo‐induced electron transfer and FRET is discussed. In addition, the probe presented a visible colour change. All experimental results demonstrated that PDI‐PD is an efficient tool for the selective, sensitive and rapid detection of Ag⁺ ions and protons using two‐channel fluorescence responses.     

Targeting human telomeric DNA quadruplex with novel berberrubine derivatives: insights from spectroscopic and docking studies

Study on bioactive molecules, capable of stabilizing G-Quadruplex structures is considered to be a potential strategy for anticancer drug development. Berberrubine (BER) and two of its analogs bearing alkyl phenyl and biphenyl substitutions at 13-position were studied for targeting human telomeric G-quadruplex DNA sequence. The structures of berberrubine and analogs were optimized by density functional theory (DFT) calculations. Time-dependent DFT (B3LYP) calculations were used to establish and understand the nature of the electronic transitions observed in UV–vis spectra of the alkaloid. The interaction of berberrubine and its analogs with human telomeric G-quadruplex DNA sequence 5′-(GGGTTAGGGTTAGGGTTAGGG)-3′ was investigated by biophysical techniques and molecular docking study. Both the analogs were found to exhibit higher binding affinity than natural precursor berberrrubine. 13-phenylpropyl analog (BER1) showed highest affinity [(1.45 ± 0.03) × 10⁵ M^?1], while the affinity of the 13-diphenyl analog (BER2) was lower at (1.03 ± 0.05) × 10⁵ M^?1, and that of BER was (0.98 ± 0.03) × 10⁵ M^?1. Comparative fluorescence quenching studies gave evidence for a stronger stacking interaction of the analog compared to berberrubine. The thiazole orange displacement assay has clearly established that the analogs were more effective in displacing the end stacked dye in comparison to berberrubine. Molecular docking study showed that each alkaloid ligand binds primarily at the G rich regions of hTelo G4 DNA which makes them G specific binder towards hTelo G4 DNA. Isothermal titration calorimetry studies of quadruplex–berberrubine analog interaction revealed an exothermic binding that was favored by both enthalpy and entropy changes in BER in contrast to the analogs where the binding was majorly enthalpy dominated. A 1:1 binding stoichiometry was revealed in all the systems. This study establishes the potentiality of berberrubine analogs as a promising natural product based compounds as G-quadruplex-specific ligands.     

Localization of the Na+-sugar cotransport system in a kidney epithelial cell line (LLC PK1)

Studies of the localization of the Na⁺-dependent sugar transport in monolayers of LLC PK₁ cells show that the uptake of a methyl α-d-glucoside, a nonmetabolizable sugar which shares the glucose-galactose transport system, occurs mainly from the apical side of the monolayer. Kinetics of [³H]phlorizin binding to monolayers of LLC PK₁ cells were also measured. These studies demonstrate the presence of two distinct classes of receptor sites. The class comprising high affinity binding sites had a dissociation constant ($\text{K}{}_{\mathrm{<mtext>d</mtext>}}$) of 1.2 μM and a concentration of high affinity receptors of 0.30 μmol binding sites per g DNA. The other class involving low affinity sites had a $\text{K}{}_{\mathrm{<mtext>d</mtext>}}$ of 240 μM with the number of binding sites equal to 12 μmol/g DNA. Phlorizin binding at high affinity binding sites is a Na⁺-dependent process. Binding at the low affinity sites on the contrary is Na⁺-independent. The mode of action of Na⁺ on the high affinity binding sites was to increase the dissociation constant without modifying the number of binding sites. The Na⁺ dependence and the matching of $\text{K}{}_{\mathrm{<mtext>d</mtext>}}$ for high affinity binding sites with the $\text{K}{}_{\mathrm{<mtext>i</mtext>}}$ of phlorizin for the inhibition of methyl α-d-glucoside strongly suggest that the high affinity phlorizin binding site is, or is part of the methyl α-d-glucoside transport system. Binding studies from either side of the monolayer also show that the binding of phlorizin at the Na⁺ dependent high affinity binding sites occurs mainly from the apical rather than the basolateral side. The specific location of the Na⁺-dependent sugar transport system in the apical membrane of LLC PK₁ cells is, therefore, another expression of the functional polarization of epithelial cells that is retained under tissue culture condition. In addition, since this sugar transport almost disappears after the cells are brought into suspension, it can be used as a marker to study the development of the apical membrane in this cell line.