Environmentally directed mutations in the dehalogenase system of Pseudomonas putida strain PP3

Favourable mutations involving the two dehalogenases (DehI and DehII) of Pseudomonas putida PP3 and derivative strains containing the cloned gene for DehI (dehI) occurred in response to specific environmental conditions, namely: starvation conditions; the presence of dehalogenase substrates (halogenated alkanoic acids — HAAs) which were toxic to P. putida; and/or the presence of a potential growth substrate. Fluctuation tests showed that these mutations were environmentally directed by the presence of HAAs. the mutations were associated with complex DNA rearrangements involving the movement of dehI located on a transposon DEH. Some mutations resulted in switching off the expression of either one or both of the dehalogenases, events which were effective in protecting P. putida from toxic compounds in its growth environment. Other mutations partially restored P. putida's dehalogenating capability under conditions where toxic substrates were absent. Restoration of the capability to untilize HAAs was favoured when normal growth substrates were present in the environment.     

Transposition of DEH,a broad-host-range transposon flanked by ISPpu12, in Pseudomonas putida is associated with genomic rearrangements and dehalogenase gene silencing

Pseudomonas putida strain PP3 produces two hydrolytic dehalogenases encoded by dehI and dehII, which are members of different deh gene families. The 9.74-kb DEH transposon containing dehI and its cognate regulatory gene, dehR(I), was isolated from strain PP3 by using the TOL plasmid pWW0. DEH was fully sequenced and shown to have a composite transposon structure, within which dehI and dehR(I) were divergently transcribed and were flanked on either side by 3.73-kb identical direct repeats. The flanking repeat unit, designated ISPpu12, had the structure of an insertion sequence in that it was bordered by 24-bp near-perfect inverted repeats and contained four open reading frames (ORFs), one of which was identified as tnpA, putatively encoding an ISL3 family transposase. A putative lipoprotein signal peptidase was encoded by an adjacent ORF, lspA, and the others, ISPpu12 orf1 and orf2, were tentatively identified as a truncated cation efflux transporter gene and a PbrR family regulator gene, respectively. The orf1-orf2 intergenic region contained an exact match with a previously described active, outward-orientated promoter, Pout. Transposition of DEH-ISPpu12 was investigated by cloning the whole transposon into a suicide plasmid donor, pAWT34, and transferring the construct to various recipients. In this way DEH-ISPpu12 was shown to transpose in a broad range of Proteobacteria. Transposition of ISPpu12 independently from DEH, and inverse transposition, whereby the vector DNA and ISPpu12 inserted into the target genome without the deh genes, were also observed to occur at high frequencies in P. putida PaW340. Transposition of a second DEH-ISPpu12 derivative introduced exogenously into P. putida PP3 via the suicide donor pAWT50 resulted in silencing of resident dehI and dehII genes in about 10% of transposition transconjugants and provided a genetic link between transposition of ISPpu12 and dehalogenase gene silencing. Database searches identified ISPpu12-related sequences in several bacterial species, predominantly associated with plasmids and xenobiotic degradative genes. The potential role of ISPpu12 in gene silencing and activation, as well as the adaptation of bacteria to degrade xenobiotic compounds, is discussed.     

Characterization of the Pseudomonas putida mobile genetic element ISPpu10: an occupant of repetitive extragenic palindromic sequences

We have characterized the Pseudomonas putida KT2440 insertion element ISPpu10. This insertion sequence encodes a transposase which exhibits homology to the transposases and specific recombinases of the Piv/Moov family, and no inverted repeats are present at the borders of its left and right ends, thus constituting a new member of the atypical IS110/IS492 family. ISPpu10 was found in at least seven identical loci in the KT2440 genome, and variants were identified having an extra insertion at distinct loci. ISPpu10 always appeared within the core of specific repetitive extragenic palindromic (REP) sequences TCGCGGGTAAACCCGCTCCTAC, exhibiting high target stringency. One intragenic target was found associated with the truncation of a GGDEF/EAL domain protein. After active in vitro transposition to a plasmid-borne target, a duplication of the CT (underlined above) at the junction as a consequence of the ISPpu10 insertion was experimentally demonstrated for the first time in the IS110/IS492 family. The same duplication was observed after transposition of ISPpu10 from a plasmid to the chromosome of P. putida DOT-T1E, an ISPpu10-free strain with REPs similar to those of strain KT2440. Plasmid ISPpu10-mediated rearrangements were observed in vivo under laboratory conditions and in the plant rhizosphere.     

Genetic analysis of an incomplete mutS gene from Pseudomonas putida

We genetically characterized the Pseudomonas putida mutS gene and found that it encodes a smaller MutS protein than do the genes of other bacteria. This gene is able to function in the mutS mutants of Escherichia coli and Bacillus subtilis. A P. putida mutS mutant has a mutation frequency 1,000-fold greater than that of the wild-type strain.     

L-(+)-Tartrate dehydratase from Pseudomonas putida is an iron-sulphur enzyme

The enzyme L-(+)-tartrate dehydratase has been isolated from extracts of Pseudomonas putida by a one-step procedure involving dye-ligand chromatography. The enzyme loses activity rapidly in the absence of Fe²⁺; concentrated solutions have a brown colour typical of iron-sulphur proteins. Analysis of iron and acid-labile sulphide indicated 3–5 atoms of each per molecule of 100 kDa. The enzyme's structure consists of four subunits, two each of 23 and 27 kDa.     

Complete nucleotide sequence of an unusual mobile element from trypanosoma brucei

The complete nucleotide sequence of a mobile element from Trypanosoma brucei is presented along with the sequence of its target site, which shows that the insertion has generated a 7 base pair direct repeat. The cloned copy of the element is a dimeric structure, one end of each monomer consisting of a stretch of 14 A residues preceded by a putative trypanosome polyadenylation signal. Six base pairs of DNA of unknown origin are found in the dimer between the two copies of the element. Evidence suggests that the element is present in the genome mainly as a monomer whose sequence is conserved across several species of trypanosome. The element contains an open reading frame encoding the same 160 amino acid protein in both sequenced copies and is extensively transcribed from both strands.     

Cloning of a creatinase gene from Pseudomonas putida in Escherichia coli by using an indicator plate.

A genomic library of Pseudomonas putida DNA was constructed by using plasmid pBR322. Transformants of Escherichia coli in combination with Proteus mirabilis cells grown on creatinase test plates were screened for creatinase activity; transformants were considered positive for creatinase activity if a red-pink zone appeared around the colonies. One creatinase-positive clone was further analyzed, and the gene was reduced to a 2.7-kb DNA fragment. A unique protein band (with a molecular weight of approximately 50,000) was observed in recombinant E. coli by minicell analysis.     

Cloning of a creatinase gene from Pseudomonas putida in Escherichia coli by using an indicator plate.

A genomic library of Pseudomonas putida DNA was constructed by using plasmid pBR322. Transformants of Escherichia coli in combination with Proteus mirabilis cells grown on creatinase test plates were screened for creatinase activity; transformants were considered positive for creatinase activity if a red-pink zone appeared around the colonies. One creatinase-positive clone was further analyzed, and the gene was reduced to a 2.7-kb DNA fragment. A unique protein band (with a molecular weight of approximately 50,000) was observed in recombinant E. coli by minicell analysis.     

N-methyl-L-amino acid dehydrogenase from Pseudomonas putida. A novel member of an unusual NAD(P)-dependent oxidoreductase superfamily

We found N-methyl-L-amino acid dehydrogenase activity in various bacterial strains, such as Pseudomonas putida and Bacillus alvei, and cloned the gene from P. putida ATCC12633 into Escherichia coli. The enzyme purified to homogeneity from recombinant E. coli catalyzed the NADPH-dependent formation of N-alkyl-L-amino acids from the corresponding alpha-oxo acids (e.g. pyruvate, phenylpyruvate, and hydroxypyruvate) and alkylamines (e.g. methylamine, ethylamine, and propylamine). Ammonia was inert as a substrate, and the enzyme was clearly distinct from conventional NAD(P)-dependent amino acid dehydrogenases, such as alanine dehydrogenase (EC 1.4.1.1). NADPH was more than 300 times more efficient than NADH as a hydrogen donor in the enzymatic reductive amination. Primary structure analysis revealed that the enzyme belongs to a new NAD(P)-dependent oxidoreductase superfamily, the members of which show no sequence homology to conventional NAD(P)-dependent amino acid dehydrogenases and opine dehydrogenases.     

Inhibition of catechol 2,3-dioxygenase from Pseudomonas putida by 3-chlorocatechol.

Partially purified preparations of catechol 2,3-dioxygenase from toluene-grown cells of Pseudomonas putida catalyzed the stoichiometric oxidation of 3-methylcatechol to 2-hydroxy-6-oxohepta-2,4-dienoate. Other substrates oxidized by the enzyme preparation were catechol, 4-methylcatechol, and 4-fluorocatechol. The apparent Michaelis constants for 3-methylcatechol and catechol were 10.6 and 22.0 muM, respectively. Substitution at the 4-position decreases the affinity and activity of the enzyme for the substrate. Catechol 2,3-dioxygenase preparations did not oxidize 3-chlorocatechol. In addition, incubation of the enzyme with 3-chlorocatechol led to inactivation of the enzyme. Kinetic analyses revealed that both 3-chlorocatechol and 4-chlorocatechol were noncompetitive or mixed-type inhibitors of the enzyme. 3-Chlorocatechol (Ki = 0.14 muM) was a more potent inhibitor than 4-chlorocatechol (Ki = 50 muM). The effect of the ion-chelating agents Tiron and o-phenanthrolene were compared with that of 3-chlorocatechol on the inactivation of the enzyme. Each inhibitor appeared to remove iron from the enzyme, since inactive enzyme preparations could be fully reactivated by treatment with ferrous iron and a reducing agent.     

Purification and characterization of 2-halocarboxylic acid dehalogenase II from Pseudomonas spec. CBS 3.

2-Halocarboxylic acid dehalogenase II from Pseudomonas spec. CBS 3 (EC 3.8.1.2), which had been cloned in E. coli Hb 101 was purified to electrophoretic homogeneity from crude extracts of E. coli Hb 101 clone 1164. Ammonium sulfate fractionation and three subsequent chromatographic purification steps yielded a pure enzyme in a 230-fold enrichment. The relative molecular masses as determined by gelfiltration on Superose 12 and SDS-polyacrylamide gel electrophoresis were 64,000 Da for the holoenzyme and 29,000 Da for the subunit. The isoelectric point, determined by isoelectric focusing, was at pH 6.2. Substrate specificity towards chlorinated and brominated substrates was limited to short chain monosubstituted 2-halocarboxylic acids. Fluorocompounds were not converted. The reaction proceeded best at a pH above 9.5 and at a reaction temperature of 40-45 degrees C.     

Resolution of 4-chlorobenzoate dehalogenase from Pseudomonas sp. strain CBS3 into three components

Extracts of Pseudomonas sp. strain CBS3 grown with 4-chlorobenzoate as sole carbon source contained an enzyme that converted 4-chlorobenzoate to 4-hydroxybenzoate. This enzyme was shown to consist of three components, all necessary for the reaction. Component I, which had a molecular weight of about 3,000, was highly unstable. Components II and III were stable proteins with molecular weights of about 86,000 and 92,000.     

DL-2-Haloacid dehalogenase from Pseudomonas sp. 113 is a new class of dehalogenase catalyzing hydrolytic dehalogenation not involving enzyme-substrate ester intermediate.

DL-2-Haloacid dehalogenase from Pseudomonas sp. 113 (DL-DEX 113) catalyzes the hydrolytic dehalogenation of D- and L-2-haloalkanoic acids, producing the corresponding L- and D-2-hydroxyalkanoic acids, respectively. Every halidohydrolase studied so far (L-2-haloacid dehalogenase, haloalkane dehalogenase, and 4-chlorobenzoyl-CoA dehalogenase) has an active site carboxylate group that attacks the substrate carbon atom bound to the halogen atom, leading to the formation of an ester intermediate. This is subsequently hydrolyzed, resulting in the incorporation of an oxygen atom of the solvent water molecule into the carboxylate group of the enzyme. In the present study, we analyzed the reaction mechanism of DL-DEX 113. When a single turnover reaction of DL-DEX 113 was carried out with a large excess of the enzyme in H(2)(18)O with a 10 times smaller amount of the substrate, either D- or L-2-chloropropionate, the major product was found to be (18)O-labeled lactate by ionspray mass spectrometry. After a multiple turnover reaction in H(2)(18)O, the enzyme was digested with trypsin or lysyl endopeptidase, and the molecular masses of the peptide fragments were measured with an ionspray mass spectrometer. No peptide fragments contained (18)O. These results indicate that the H(2)(18)O of the solvent directly attacks the alpha-carbon of 2-haloalkanoic acid to displace the halogen atom. This is the first example of an enzymatic hydrolytic dehalogenation that proceeds without producing an ester intermediate.     

Resolution of 4-chlorobenzoate dehalogenase from Pseudomonas sp. strain CBS3 into three components.

Extracts of Pseudomonas sp. strain CBS3 grown with 4-chlorobenzoate as sole carbon source contained an enzyme that converted 4-chlorobenzoate to 4-hydroxybenzoate. This enzyme was shown to consist of three components, all necessary for the reaction. Component I, which had a molecular weight of about 3,000, was highly unstable. Components II and III were stable proteins with molecular weights of about 86,000 and 92,000.     

The enzyme pseudooxynicotine amine oxidase from Pseudomonas putida S16 is not an oxidase,but a dehydrogenase

The soil-dwelling bacterium Pseudomonas putida S16 can survive on nicotine as its sole carbon and nitrogen source. The enzymes nicotine oxidoreductase (NicA2) and pseudooxynicotine amine oxidase (Pnao), both members of the flavin-containing amine oxidase family, catalyze the first two steps in the nicotine catabolism pathway. Our laboratory has previously shown that, contrary to other members of its enzyme family, NicA2 is actually a dehydrogenase that uses a cytochrome c protein (CycN) as its electron acceptor. The natural electron acceptor for Pnao is unknown; however, within the P. putida S16 genome, pnao forms an operon with cycN and nicA2, leading us to hypothesize that Pnao may also be a dehydrogenase that uses CycN as its electron acceptor. Here we characterized the kinetic properties of Pnao and show that Pnao is poorly oxidized by O₂, but can be rapidly oxidized by CycN, indicating that Pnao indeed acts as a dehydrogenase that uses CycN as its oxidant. Comparing steady-state kinetics with transient kinetic experiments revealed that product release primarily limits turnover by Pnao. We also resolved the crystal structure of Pnao at 2.60 Å, which shows that Pnao has a similar structural fold as NicA2. Furthermore, rigid-body docking of the structure of CycN with Pnao and NicA2 identified a potential conserved binding site for CycN on these two enzymes. Taken together, our results demonstrate that although Pnao and NicA2 show a high degree of similarity to flavin containing amine oxidases that use dioxygen directly, both enzymes are actually dehydrogenases.     

The parAB gene products of Pseudomonas putida exhibit partition activity in both P. putida and Escherichia coli

The bacteria for which there is evidence that proteins of the ParAB family act in chromosome segregation also undergo developmental transitions that involve the ParAB homologues, raising the question of whether the partition activity is equivalent to that of plasmid partition systems. We have investigated the role in partition of the parAB locus of a free-living bacterium, Pseudomonas putida, not known to pass through developmental phases. A parAB deletion mutant, compared with wild type, showed slightly higher frequencies of anucleate cells in exponentially growing cultures but much higher frequencies in deceleration phase. This increase was growth medium dependent. Oversupply of ParA and ParB proteins also raised anucleate cell levels, specifically in the deceleration phase, in wild-type and mutant strains and regardless of medium, as well as generating abnormal cell morphologies. Absence or oversupply of ParAB function had either slight or considerable effects on growth rate, depending on temperature and medium. The need for the Par proteins in chromosome partition thus appears to be subject to the cell's physiological state. Three sequences similar to cis-acting stabilization sites of Bacillus subtilis are present in the P. putida oriC-parAB region. One was inserted into an unstable mini-F and shown to stabilize it in E. coli in a ParAB-dependent manner.