Binding of netropsin to several DNA constructs: evidence for at least two different 1:1 complexes formed from an -AATT-containing ds-DNA construct and a single minor groove binding ligand

Isothermal titration calorimetry, ITC, has been used to determine the thermodynamics (DeltaG, DeltaH, and -TDeltaS) for binding netropsin to a number of DNA constructs. The DNA constructs included: six different 20-22mer hairpin forming sequences and an 8-mer DNA forming a duplex dimer. All DNA constructs had a single -AT-rich netropsin binding with one of the following sequences, (A(2)T(2))(2), (ATAT)(2), or (AAAA/TTTT). Binding energetics are less dependent on site sequence than on changes in the neighboring single stranded DNA (hairpin loop size and tail length). All of the 1:1 complexes exhibit an enthalpy change that is dependent on the fractional saturation of the binding site. Later binding ligands interact with a significantly more favorable enthalpy change (partial differential DeltaH(1-2) from 2 to 6 kcal/mol) and a significantly less favorable entropy change (partial differential (-TDeltaS(1-2))) from -4 to -9 kcal/mol). The ITC data could only be fit within expected experimental error by use of a thermodynamic model that includes two independent binding processes with a combined stoichiometry of 1 mol of ligand per 1 mol of oligonucleotide. Based on the biophysical evidence reported here, including theoretical calculations for the energetics of "trapping" or structuring of a single water molecule and molecular docking computations, it is proposed that there are two modes by which flexible ligands can bind in the minor groove of duplex DNA. The higher affinity binding mode is for netropsin to lay along the floor of the minor groove in a bent conformation and exclude all water from the groove. The slightly weaker binding mode is for the netropsin molecule to have a slightly more linear conformation and for the required curvature to be the result of a water molecule that bridges between the floor of the minor groove and two of the amidino nitrogens located at one end of the bound netropsin molecule.     

Thermodynamics of the binding of Streptomyces subtilisin inhibitor to alpha-chymotrypsin

The binding of Streptomyces subtilisin inhibitor (SSI) to alpha-chymotrypsin (CT) (EC 3.4.21.1) was studied by isothermal and differential scanning calorimetry at pH 7.0. Thermodynamic quantities for the binding of SSI to the enzyme were derived as functions of temperature from binding constants (S. Matsumori, B. Tonomura, and K. Hiromi, private communication) and isothermal calorimetric experiments at 5-30 degrees C. At 25 degrees C, the values are delta G degrees b = -29.9 kJ mol-1, delta Hb = +18.7 (+/- 1.3) kJ mol-1, delta S degrees b = +0.16 kJ K-1 mol-1, and delta C p,b = -1.08 (+/- 0.11) kJ mol-1. The binding of SSI to CT is weak compared with its binding to subtilisin [Uehara, Y., Tonomura, B., & Hiromi, K. (1978) J. Biochem. (Tokyo) 84, 1195-1202; Takahashi, K., & Fukada, H. (1985) Biochemistry 24, 297-300]. This difference is due primarily to a less favorable enthalpy change in the formation of the complex with CT. The hydrophobic effect is presumably the major source of the entropy and heat capacity changes which accompany the binding process. The unfolding temperature of the complex is about 7 degrees C higher than that of the free enzyme. The enthalpy and the heat capacity changes for the unfolding of CT were found to be 814 kJ mol-1 and 17.3 kJ K-1 mol-1 at 49 degrees C. The same quantities for the unfolding of the SSI-CT complex are 1183 kJ mol-1 and 39.2 kJ K-1 mol-1 at 57 degrees C.     

Adenine base unstacking dominates the observed enthalpy and heat capacity changes for the Escherichia coli SSB tetramer binding to single-stranded oligoadenylates.

Isothermal titration calorimetry (ITC) was used to test the hypothesis that the relatively small enthalpy change (DeltaHobs) and large negative heat capacity change (DeltaCp,obs) observed for the binding of the Escherichia coli SSB protein to single-stranded (ss) oligodeoxyadenylates result from the temperature-dependent adenine base unstacking equilibrium that is thermodynamically coupled to binding. We have determined DeltaH1,obs for the binding of 1 mole of each of dT(pT)34, dC(pC)34, and dA(pA)34 to the SSB tetramer (20 mM NaCl at pH 8.1). For dT(pT)34 and dC(pC)34, we found large, negative values for DeltaH1,obs of -75 +/- 1 and -85 +/- 2 kcal/mol at 25 degrees C, with DeltaCp,obs values of -540 +/- 20 and -570 +/- 30 cal mol-1 K-1 (7-50 degrees C), respectively. However, for SSB-dA(pA)34 binding, DeltaH1,obs is considerably less negative (-14 +/- 1 kcal/mol at 25 degrees C), even becoming positive at temperatures below 13 degrees C, and DeltaCp,obs is nearly twice as large in magnitude (-1180 +/- 40 cal mol-1 K-1). These very different thermodynamic properties for SSB-dA(pA)34 binding appear to result from the fact that the bases in dA(pA)34 are more stacked at any temperature than are the bases in dC(pC)34 or dT(pT)34 and that the bases become unstacked within the SSB-ssDNA complexes. Therefore, the DeltaCp,obs for SSB-ssDNA binding has multiple contributions, a major one being the coupling to binding of a temperature-dependent conformational change in the ssDNA, although SSB binding to unstacked ssDNA still has an "intrinsic" negative DeltaCp,0. In general, such temperature-dependent changes in the conformational "end states" of interacting macromolecules can contribute significantly to both DeltaCp,obs and DeltaHobs.     

Electrostatic contributions to heat capacity changes of DNA-ligand binding.

Significant heat capacity changes (DeltaCp) often accompany protein unfolding, protein binding, and specific DNA-ligand binding reactions. Such changes are widely used to analyze contributions arising from hydrophobic and polar hydration. Current models relate the magnitude of DeltaCp to the solvent accessible surface area (ASA) of the molecule. However, for many binding systems-particularly those involving non-peptide ligands-these models predict a DeltaCp that is significantly different from the experimentally measured value. Electrostatic interactions provide a potential source of heat capacity changes and do not scale with ASA. Using finite-difference Poisson-Boltzmann methods (FDPB), we have determined the contribution of electrostatics to the DeltaCp associated with binding for DNA binding reactions involving the ligands DAPI, netropsin, lexitropsin, and the lambda repressor binding domain.     

Thermodynamics of the interaction between O-acetylserine sulfhydrylase and the C-terminus of serine acetyltransferase

Cysteine biosynthesis in plants is partly regulated by the physical association of O-acetylserine sulfhydrylase (OASS) and serine acetyltransferase (SAT). Interaction of OASS and SAT requires only the 10 C-terminal residues of SAT. Here we analyze the thermodynamics of formation of a complex of Arabidopsis thaliana OASS (AtOASS) and the C-terminal ligand of AtSAT (C10 peptide) as a function of temperature and salt concentration using fluorescence spectroscopy and isothermal titration calorimetry (ITC). Our results suggest that the C-terminus of AtSAT provides the major contribution to the total binding energy in the plant cysteine synthase complex. The C10 peptide binds to the AtOASS homodimer in a 2:1 complex. Interaction between AtOASS and the C10 peptide is tight (Kd = 5-100 nM) over a range of temperatures (10-35 degrees C) and NaCl concentrations (0.02-1.3 M). AtOASS binding of the C10 peptide displays negative cooperativity at higher temperatures. ITC studies reveal compensating changes in the enthalpy and entropy of binding that also depend on temperature. The enthalpy of interaction has a significant temperature dependence (DeltaCp = -401 cal mol-1 K-1). The heat capacity change and salt dependence studies suggest that hydrophobic interactions drive formation of the AtOASS.C10 peptide complex. The potential regulatory effect of temperature on the plant cysteine synthase complex is discussed.     

Linear free-energy model description of the conformational stability of uracil-DNA glycosylase inhibitor A thermodynamic characterization of interaction with denaturant and cold denaturation.

The equilibrium unfolding of uracil DNA glycosylase inhibitor (Ugi), a small acidic protein of molecular mass 9474 Da, has been studied by a combination of thermal-induced and guanidine hydrochloride (GdnCl)-induced denaturation. The analysis of the denaturation data provides a measure of the changes in conformational free energy, enthalpy, entropy and heat capacity DeltaCp that accompany the equilibrium unfolding of Ugi over a wide range of temperature and GdnCl concentration. The unfolding of Ugi is a simple two-state, reversible process. The protein undergoes both low-temperature and high-temperature unfolding even in the absence of GdnCl but more so in the presence of denaturant. The data are consistent with the linear free-energy model and with a temperature independent DeltaCp over the large temperature range of unfolding. The small DeltaCp (6.52 kJ.mol-1.K-1) for the unfolding of Ugi, is perhaps a reflection of a relatively small, buried hydrophobic core in the folded form of this small monomeric protein. Despite a relatively low value of DeltaG(H2O), 7.40 kJ.mol-1 at pH 8.3, Ugi displays considerable stability with the temperature of maximum stability being 301.6 K.     

DNA conformational effects on the interaction of netropsin with A-tract sequences

The influence of cosolutes and DNA sequence on the interaction of netropsin with three duplexes has been studied by isothermal titration calorimetry. In buffer, netropsin forms two complexes with a net stoichiometry of 1:1 in the minor groove of the oligonucleotide (GCGCGAATTCGCGC)2. One complex has a weaker affinity and is more enthalpically favored relative to the other one, consistent with previous studies [Freyer, M. W., et al. (2006) Biophys. Chem. 126, 186-196]. With the cosolutes betaine and 2-methyl-2,4-pentanediol, the enthalpy and heat capacity changes indicate that the complex with weaker affinity is disfavored relative to the complex with higher affinity. With (CGCGCAATTGCGCG)2, netropsin has one binding mode in buffer, and complex formation is not influenced by the cosolutes. The similarities of the enthalpy and heat capacity changes suggest that netropsin interacts similarly with these two oligonucleotides in the presence of cosolutes. The oligonucleotide (GCGCAAATTTGCGC)2 also forms two complexes with netropsin, and the complex with weaker affinity is again disfavored by the cosolutes. Thus, the interaction of netropsin with these A/T binding sites is influenced both by the bases adjacent to the binding site and by cosolutes. We suggest that these two factors influence the conformation of the minor-groove binding site of DNA.     

Microcalorimetric investigation of the interaction of calmodulin with seminalplasmin and myosin light chain kinase

Flow microcalorimetric titrations of calmodulin with seminalplasmin at 25 degrees C revealed that the high affinity one-to-one complex in the presence of Ca2+ (Comte, M., Malnoe, A., and Cox, J. A. (1986) Biochem. J. 240, 567-573) is entirely enthalpy-driven (delta H0 = -50 kJ.mol-1; delta S0 = O J.K-1.mol-1; delta Cp0 = O J.K-1.mol-1) and is not influenced by the proton or Mg2+ concentration. The Sr2+- and Cd2+-promoted high affinity complexes are also exothermic for -49 and -45 kJ.mol-1, respectively. The observed low affinity interaction in the absence of divalent ions displays no enthalpy change. No enthalpy changes are observed when calmodulin and seminalplasmin are mixed in the presence of millimolar concentrations of Mg2+, Zn2+, or Mn2+. Enthalpy titrations of the 1:1 calmodulin-seminalplasmin complex with Ca2+ and of partly Ca2+-saturated calmodulin with seminalplasmin revealed that only the species calmodulin.Can greater than or equal to 2 is fully competent for high affinity interaction with seminalplasmin. Binding of the second Ca2+ is strongly enhanced (K2 greater than or equal to 5 X 10(7) M-1) as compared to that in free calmodulin (K2 = 2.6 X 10(5) M-1). This is essentially due to the concomitant strongly exothermic step of isomerization of the calmodulin-seminalplasmin complex from its low to its high affinity form. Binding of the remaining two Ca2+ to the high affinity seminalplasmin-calmodulin complex displays the same affinity constants and endothermic enthalpy change as in free calmodulin. A microcalorimetric study on the complex formation between Ca2+-saturated calmodulin and turkey gizzard myosin light chain kinase revealed that the interaction is strongly exothermic with an important overall gain of order (delta H0 = -85 kJ.mol-1; delta S0 = -122 J.K-1.mol-1) and occurs with significant proton uptake (0.44 H+ per mol at pH 7.5). The observed low affinity interaction (K = 2.2 X 10(5) M-1) in the absence of Ca2+ (Mamar-Bachi, A., and Cox, J. A. (1987) Cell Calcium 8, 473-482) displays neither a change in enthalpy nor in protonation.     

Use of the parmbsc0 force field and trajectory analysis to study the binding of netropsin to the DNA fragment (5'CCAATTGG)(2) in the presence of excess NaCl salt in aqueous solution

The parmbsc0 force field was applied to study in detail the binding of netropsin, at a salt concentration of 0.28M Na(+), to the minor groove of an 8-mer (5'CCAATTGG)(2) DNA duplex forming a netropsin·DNA complex which previously has been characterized by X-ray crystallography, albeit with the use of closely related DNA duplexes. The X-ray structure revealed that the terminal guanidinium and amidinium groups of netropsin interact with the extreme ends of the palindromic AATT sequence of the receptor DNA. The parmbsc0 parameters of B-DNA and AMBER v9 parameters of netropsin generated a stable 6ns molecular dynamics (MD) trajectory for a 1:1 class I binding motif of this complex. Trajectory analysis for the salt and hydration effects on the binding of netropsin to the 8-mer DNA duplex revealed that 18 water molecules and 2 Na(+) are displaced from the DNA upon netropsin binding. A hydration density map of the complex parallels the X-ray data showing that two structured water molecules are localized near the netropsin guanidinium and amidinium groups forming H-bond bridges between the receptor and the ligand.     

Thermodynamic description of the effect of the mutation Y49F on human glutathione transferase P1-1 in binding with glutathione and the inhibitor S-hexylglutathione

The thermodynamics of binding of both the substrate glutathione (GSH) and the competitive inhibitor S-hexylglutathione to the mutant Y49F of human glutathione S-transferase (hGST P1-1), a key residue at the dimer interface, has been investigated by isothermal titration calorimetry and fluorescence spectroscopy. Calorimetric measurements indicated that the binding of these ligands to both the Y49F mutant and wild-type enzyme is enthalpically favorable and entropically unfavorable over the temperature range studied. The affinity of these ligands for the Y49F mutant is lower than those for the wild-type enzyme due mainly to an entropy change. Therefore, the thermodynamic effect of this mutation is to decrease the entropy loss due to binding. Calorimetric titrations in several buffers with different ionization heat amounts indicate a release of protons when the mutant binds GSH, whereas protons are taken up in binding S-hexylglutathione at pH 6.5. This suggests that the thiol group of GSH releases protons to buffer media during binding and a group with low pKa (such as Asp98) is responsible for the uptake of protons. The temperature dependence of the free energy of binding, DeltaG0, is weak because of the enthalpy-entropy compensation caused by a large heat capacity change. The heat capacity change is -199.5 +/- 26.9 cal K-1 mol-1 for GSH binding and -333.6 +/- 28.8 cal K-1 mol-1 for S-hexylglutathione binding. The thermodynamic parameters are consistent with the mutation Tyr49 --> Phe, producing a slight conformational change in the active site.     

Binding of netropsin and 4,6-diamidino-2-phenylindole to an A2T2 DNA hairpin: a comparison of biophysical techniques

Isothermal titration calorimetry (ITC), differential scanning calorimetry (DSC), and biosensor-surface plasmon resonance (SPR) are evaluated for their accuracy in determining equilibrium constants, ease of use, and range of application. Systems chosen for comparison of the three techniques were the formation of complexes between two minor groove binding compounds, netropsin and 4,6-diamidino-2-phenylindole (DAPI), and a DNA hairpin having the sequence 5'-d(CGAATTCGTCTCCGAATTCG)-3'. These systems were chosen for their structural differences, simplicity (1:1 binding), and binding affinity in the range of interest (K approximately 10(8) M(-1)). The binding affinities determined from all three techniques were in excellent agreement; for example, netropsin/DNA formation constants were determined to be K = 1.7x10(8) M(-1) (ITC), K = 2.4x10(8) M(-1) (DSC), and K = 2.9x10(8) M(-1) (SPR). DSC and SPR techniques have an advantage over ITC in studies of ligands that bind with affinities greater than 10(8) M(-1). The ITC technique has the advantage of determining a full set of thermodynamic parameters, including deltaH, TdeltaS, and deltaC(p) in addition to deltaG (or K). The ITC data revealed complex binding behavior in these minor groove binding systems not detected in the other methods. All three techniques provide accurate estimates of binding affinity, and each has unique benefits for drug binding studies.     

Conformational dynamics and the energetics of protein--ligand interactions: role of interdomain loop in human cytochrome P450 reductase

A combination of mutagenesis, calorimetry, kinetics, and small-angle X-ray scattering (SAXS) has been used to study the mechanism of ligand binding energy propagation through human cytochrome P450 reductase (CPR). Remarkably, the energetics of 2',5'-ADP binding to R597 at the FAD-binding domain are affected by mutations taking place at an interdomain loop located 60 A away. Either deletion of a 7 amino acid long segment (T236-G237-E238-E239-S240-S241-I242) or its replacement by poly-proline repeats (5 and 10 residues) results in a significant increase in 2',5'-ADP enthalpy of binding (DeltaHB). This is accompanied by a decrease in the number of thermodynamic microstates available for the ligand-CPR complex. Moreover, the estimated heat capacity change (DeltaCp) for this interaction changes from -220 cal mol-1 K-1 in the wild-type enzyme to -580 cal mol-1 K-1 in the deletion mutant. Pre-steady-state kinetics measurements reveal a 50-fold decrease in the microscopic rate for interdomain (FAD --> FMN) electron transfer in the deletion mutant (kobs = 0.4 s-1). Multiple turnover cytochome c reduction assays indicate that these mutations impair the ability of the FMN-binding domain to shuttle electrons from the FAD-binding domain to the cytochrome partner. Binding of 2',5'-ADP to wild-type CPR triggers a large-scale structural rearrangement resulting in the complex having a more compact domain organization, and the maximum molecular dimension (Dmax) decreases from 110 A in ligand-free enzyme to 100 A in the ligand-bound CPR. The SAXS experiments also demonstrate that what is affected by the mutations is indeed the relative diffusional motion of the domains. Furthemore, ab initio shape reconstruction and homology modeling would suggest that-in the deletion mutant-hindering of domain motion occurs concomitantly with dimerization. The results presented here show that the energetics of this highly localized interaction (2',5'-ADP binding) have a global character, and are highly sensitive to functional structural dynamics involving distal domains. These findings support early theoretical studies which postulate a single protein molecule to be a real, independent thermodynamic ensemble.     

Thermodynamics of oligosaccharide binding to a monoclonal antibody specific for a Salmonella O-antigen point to hydrophobic interactions in the binding site.

The thermodynamic characteristics of oligosaccharide binding to an antibody binding site that is dominated by aromatic amino acids suggest that the hydrophobic effect contributes substantially to complex formation as well as hydrogen bonding and van der Waals interactions. A detailed titration microcalorimetric study on the temperature dependence of the binding of a trisaccharide, representing the epitope of a Salmonella O-antigen, showed that its maximum binding to the monoclonal antibody Se155-4 occurs just below room temperature and both enthalpy and entropy changes are strongly dependent on temperature in a mutually compensating manner. The heat capacity change also shows an unusually strong temperature dependence being large and negative above room temperature and positive below. van't Hoff analysis of the temperature dependence of the binding constant yielded a biphasic curve with two apparent intrinsic enthalpy estimations (approximately -100 kJ mol-1 above 18 degrees C and approximately +100 kJ mol-1 below), each very different from the calorimetrically determined enthalpies (ranging from about -60 kJ mol-1 to -20 kJ mol-1). This was interpreted as being due to large enthalpy contributions from concomitant reactions, most notably changes in solvation. Linear plots, -delta H0 versus -T delta S0, observed for temperature-dependent measurements mirror the behavior seen for a series of functional group replacements, suggesting that the molecular and physical origin of these phenomena are closely related and linked to the role of water in complex formation. The thermodynamic results are compared to the mode of binding determined from a 2.05-A resolution structure of the Fab-oligosaccharide complex, and with literature data for the heat capacities of sugars in aqueous solution and for the thermodynamics of carbohydrate binding to transport proteins and lectins.     

Temperature dependence and thermodynamics of Klenow polymerase binding to primed-template DNA

DNA binding of Klenow polymerase has been characterized with respect to temperature to delineate the thermodynamic driving forces involved in the interaction of this polymerase with primed-template DNA. The temperature dependence of the binding affinity exhibits distinct curvature, with tightest binding at 25-30 degrees C. Nonlinear temperature dependence indicates Klenow binds different primed-template constructs with large heat capacity (DeltaCp) values (-870 to -1220 cal/mole K) and thus exhibits large temperature dependent changes in enthalpy and entropy. Binding is entropy driven at lower temperatures and enthalpy driven at physiological temperatures. Large negative DeltaCp values have been proposed to be a 'signature' of site-specific DNA binding, but type I DNA polymerases do not exhibit significant DNA sequence specificity. We suggest that the binding of Klenow to a specific DNA structure, the primed-template junction, results in a correlated thermodynamic profile that mirrors what is commonly seen for DNA sequence-specific binding proteins. Klenow joins a small number of other DNA-sequence independent DNA binding proteins which exhibit unexpectedly large negative DeltaCp values. Spectroscopic measurements show small conformational rearrangements of both the DNA and Klenow upon binding, and small angle x-ray scattering shows a global induced fit conformational compaction of the protein upon binding. Calculations from both crystal structure and solution structural data indicate that Klenow DNA binding is an exception to the often observed correlation between DeltaCp and changes in accessible surface area. In the case of Klenow, surface area burial can account for only about half of the DeltaCp of binding.     

Molecular recognition in noncovalent antitumor agent-DNA complexes: NMR studies of the base and sequence dependent recognition of the DNA minor groove by netropsin

We have investigated intermolecular interactions and conformational features of the netropsin complexes with d(G1-G2-A3-A4-T5-T6-C7-C8) duplex (AATT 8-mer) and the d(G1-G2-T3-A4-T5-A6-C7-C8) duplex (TATA 8-mer) by one and two-dimensional NMR studies in solution. We have assigned the amide, pyrrole and methylene protons of netropsin and the base and sugar H1' protons of the nucleic acid from an analysis of the nuclear Overhauser effect (NOESY) and correlated (COSY) spectra of the complex at 25 degrees C. The directionality of the observed distance-dependent NOEs demonstrates that the 8-mer helices remain right-handed and that the arrangement of concave and convex face protons of netropsin are retained in the complexes. The observed changes in NOE patterns and chemical shift changes on complex formation suggest small conformational changes in the nucleic acid at the AATT and TATA antibiotic binding sites and possibly the flanking G.C base pairs. We observe intermolecular NOEs between all three amide and both pyrrole protons on the concave face of the antibiotic and the minor groove adenosine H2 proton of the two central A4.T5 base pairs of the AATT 8-mer and TATA 8-mer duplexes. The concave face pyrrole protons of the antibiotic also exhibit NOEs to the sugar H1' protons of residues 5 and 6 in the AATT and TATA 8-mer complexes. We also detect intermolecular NOEs between the guanidino and propioamidino methylene protons at either end of netropsin and the adenosine H2 proton of the two flanking A3.T6 base pairs in the AATT 8-mer and T3.A6 base pairs in the TATA 8-mer duplexes. These studies establish a set of nine contacts between the concave face of the antibiotic and the minor groove AATT segment and TATA segment of the 8-mer duplexes in solution. The observed magnitude of the NOEs require that there be no intervening water molecules sandwiched between the concave face of the antibiotic and the minor groove of the DNA so that release of the minor groove spine of hydration is a prerequisite for netropsin complex formation. The observed differences in the netropsin amide proton chemical shifts in the AATT 8-mer and TATA 8-mer complexes suggest differences in the strength and/or type of intermolecular hydrogen bonds at the AATT and TATA binding sites.(ABSTRACT TRUNCATED AT 400 WORDS)     

Thermodynamics of interaction of a fluorescent DNA oligomer with the anti-tumour drug netropsin.

Fluorescence spectroscopy was used to study the interaction between the minor-groove-binding drug netropsin and the self-complementary oligonucleotide d(CTGAnPTTCAG)2 containing the fluorescent base analogue 2-aminopurine (nP). The binding of netropsin to this oligonucleotide causes strong quenching of the 2-aminopurine fluorescence, observed by steady-state as well as time-resolved spectroscopy. From fluorescence titrations, binding isotherms were recorded and evaluated. The parameters showed one netropsin binding site/oligonucleotide duplex and an association constant of about 10(5) M-1 at 25 degrees C, 3-4 orders of magnitude weaker than for an exclusive adenine/thymine host sequence. From the temperature dependence of the association constant the thermodynamic parameters were obtained as delta G = -29 kJ/mol, delta H = -12 kJ/mol and delta S = +55 J.mol-1.K-1 at 25 degrees C. These parameters resemble those of the interaction of poly[(dG-dC).(dG-dC)] with netropsin, indicating a mainly entropy-driven reaction. The amino group of 2-aminopurine, like that of guanine, resides in the minor groove of DNA. Therefore the relatively weak binding of netropsin to d(CTGAnPTTCAG)2 is probably related to partial blockage of the tight fit of netropsin into the preferred minor groove of an exclusive adenine/thymine host sequence.     

Structural insight into the kinetics and DeltaCp of interactions between TEM-1 beta-lactamase and beta-lactamase inhibitory protein (BLIP)

In a previous study, we examined thermodynamic parameters for 20 alanine mutants in beta-lactamase inhibitory protein (BLIP) for binding to TEM-1 beta-lactamase. Here we have determined the structures of two thermodynamically distinctive complexes of BLIP mutants with TEM-1 beta-lactamase. The complex BLIP Y51A-TEM-1 is a tight binding complex with the most negative binding heat capacity change (DeltaG = approximately -13 kcal mol(-1) and DeltaCp = approximately -0.8 kcal mol(-1) K(-1)) among all of the mutants, whereas BLIP W150A-TEM-1 is a weak complex with one of the least negative binding heat capacity changes (DeltaG = approximately -8.5 kcal mol(-1) and DeltaCp = approximately -0.27 kcal mol(-1) K(-1)). We previously determined that BLIP Tyr51 is a canonical and Trp150 an anti-canonical TEM-1-contact residue, where canonical refers to the alanine substitution resulting in a matched change in the hydrophobicity of binding free energy. Structure determination indicates a rearrangement of the interactions between Asp49 of the W150A BLIP mutant and the catalytic pocket of TEM-1. The Asp49 of W150A moves more than 4 angstroms to form two new hydrogen bonds while losing four original hydrogen bonds. This explains the anti-canonical nature of the Trp150 to alanine substitution, and also reveals a strong long distance coupling between Trp150 and Asp49 of BLIP, because these two residues are more than 25 angstroms apart. Kinetic measurements indicate that the mutations influence the dissociation rate but not the association rate. Further analysis of the structures indicates that an increased number of interface-trapped water molecules correlate with poor interface packing in a mutant. It appears that the increase of interface-trapped water molecules is inversely correlated with negative binding heat capacity changes.     

Dissecting the stability of a beta-hairpin peptide that folds in water: NMR and molecular dynamics analysis of the beta-turn and beta-strand contributions to folding.

NMR studies of the folding and conformational properties of a beta-hairpin peptide, several peptide fragments of the hairpin, and sequence-modified analogues, have enabled the various contributions to beta-hairpin stability in water to be dissected. Temperature and pH-induced unfolding studies indicate that the folding-unfolding equilibrium approximates to a two-state model. The hairpin is highly resistant to denaturation and is still significantly folded in 7 M urea at 298 K. Thermodynamic analysis shows the hairpin to fold in water with a significant change in heat capacity, however, DeltaCp degrees in 7 M urea is reduced. V/Y-->A mutations on one strand of the hairpin reduce folding to <10 %, consistent with a hydrophobic stabilisation model. We show that in a truncated peptide (residues 6-16) lacking the hydrophobic residues on one beta-strand, the type I' Asn-Gly turn in the sequence SINGKK is significantly populated in water in the absence of interstrand hydrophobic contacts. Unrestrained molecular dynamics simulations of unfolding, using an explicit solvation model, show that the conformation of the NG turn persists for longer than the AG analogue, which has a much lower propensity for type I' turn formation from a data base analysis of preferred turns. The origin of the high stability of the Asn-Gly turn is not entirely clear; data base analysis of 66 NG turns, together with molecular dynamics simulations, reveals no participation of the Asn side-chain in turn-stabilising interactions with the peptide backbone. However, hydration analysis of the molecular dynamics simulations reveals a pocket of "high density" water bridging between the Asn side-chain and peptide main-chain that suggests solvent-mediated interactions may play an important role in modulating phi,psi propensities in the NG turn region.     

Thermodynamics of DNA branching.

Branched DNA molecules arise transiently as intermediates in genetic recombination or on extrusion of cruciforms from covalent circular DNA duplexes that contain palindromic sequences. The free energy of these structures relative to normal DNA duplexes is of interest both physically and biologically. Oligonucleotide complexes that can form stable branched structures, DNA junctions, have made it possible to model normally unstable branched states of DNA such as Holliday recombinational intermediates. We present here an evaluation of the free energy of creating four-arm branch points in duplex DNA, using a system of two complementary junctions and four DNA duplexes formed from different combinations of the same set of eight 16-mer strands. The thermodynamics of formation of each branched structure from the matching pair of intact duplexes have been estimated in two experiments. In the first, labeled strands are allowed to partition between duplexes and junctions in a competition assay on polyacrylamide gels. In the second, the heats of forming branched or linear molecules from the component strands have been determined by titration microcalorimetry at several temperatures. Taken together these measurements allow us to determine the standard thermodynamic parameters for the process of creating a branch in an otherwise normal DNA duplex. The free energy for reacting two 16-mer duplexes to yield a four-arm junction in which the branch site is incapable of migrating is + 1.1 (+/- 0.4) kcal mol-1 (at 18 degrees C, 10 mM-Mg2+). Analysis of the distribution of duplex and tetramer products by electrophoresis confirms that the free energy difference between the four duplexes and two junctions is small at this temperature. The associated enthalpy change at 18 degrees C is +27.1 (+/- 1.3) kcal mol-1, while the entropy is +89 (+/- 30) cal K-1 mol-1. The free energy for branching is temperature dependent, with a large unfavorable enthalpy change compensated by a favorable entropy term. Since forming one four-stranded complex from two duplexes should be an entropically unfavorable process, branch formation is likely to be accompanied by significant changes in hydration and ion binding. A significant apparent delta Cp is also observed for the formation of one mole of junction, +0.97 (+/-0.05) kcal deg-1 mol-1.     

Configurational entropy change of netropsin and distamycin upon DNA minor-groove binding

Binding of a small molecule to a macromolecular target reduces its conformational freedom, resulting in a negative entropy change that opposes the binding. The goal of this study is to estimate the configurational entropy change of two minor-groove-binding ligands, netropsin and distamycin, upon binding to the DNA duplex d(CGCGAAAAACGCG).d(CGCGTTTTTCGCG). Configurational entropy upper bounds based on 10-ns molecular dynamics simulations of netropsin and distamycin in solution and in complex with DNA in solution were estimated using the covariance matrix of atom-positional fluctuations. The results suggest that netropsin and distamycin lose a significant amount of configurational entropy upon binding to the DNA minor groove. The estimated changes in configurational entropy for netropsin and distamycin are -127 J K(-1) mol(-1) and -104 J K(-1) mol(-1), respectively. Estimates of the configurational entropy contributions of parts of the ligands are presented, showing that the loss of configurational entropy is comparatively more pronounced for the flexible tails than for the relatively rigid central body.