Elastolytic Mechanism of a Novel M23 Metalloprotease Pseudoalterin from Deep-sea Pseudoalteromonas sp. CF6-2: CLEAVING NOT ONLY GLYCYL BONDS IN THE HYDROPHOBIC REGIONS BUT ALSO PEPTIDE BONDS IN THE HYDROPHILIC REGIONS INVOLVED IN CROSS-LINKING*

Elastin is a common insoluble protein that is abundant in marine vertebrates, and for this reason its degradation is important for the recycling of marine nitrogen. It is still unclear how marine elastin is degraded because of the limited study of marine elastases. Here, a novel protease belonging to the M23A subfamily, secreted by Pseudoalteromonas sp. CF6-2 from deep-sea sediment, was purified and characterized, and its elastolytic mechanism was studied. This protease, named pseudoalterin, has low identities (<40%) to the known M23 proteases. Pseudoalterin has a narrow specificity but high activity toward elastin. Analysis of the cleavage sites of pseudoalterin on elastin showed that pseudoalterin cleaves the glycyl bonds in hydrophobic regions and the peptide bonds Ala–Ala, Ala–Lys, and Lys–Ala involved in cross-linking. Two peptic derivatives of desmosine, desmosine-Ala-Ala and desmosine-Ala-Ala-Ala, were detected in the elastin hydrolysate, indicating that pseudoalterin can dissociate cross-linked elastin. These results reveal a new elastolytic mechanism of the M23 protease pseudoalterin, which is different from the reported mechanism where the M23 proteases only cleave glycyl bonds in elastin. Genome analysis suggests that M23 proteases may be popular in deep-sea sediments, implying their important role in elastin degradation. An elastin degradation model of pseudoalterin was proposed, based on these results and scanning electron microscopic analysis of the degradation by pseudoalterin of bovine elastin and cross-linked recombinant tropoelastin. Our results shed light on the mechanism of elastin degradation in deep-sea sediment.     

Proline periodicity modulates the self-assembly properties of elastin-like polypeptides

Elastin is a self-assembling protein of the extracellular matrix that provides tissues with elastic extensibility and recoil. The monomeric precursor, tropoelastin, is highly hydrophobic yet remains substantially disordered and flexible in solution, due in large part to a high combined threshold of proline and glycine residues within hydrophobic sequences. In fact, proline-poor elastin-like sequences are known to form amyloid-like fibrils, rich in β-structure, from solution. On this basis, it is clear that hydrophobic elastin sequences are in general optimized to avoid an amyloid fate. However, a small number of hydrophobic domains near the C terminus of tropoelastin are substantially depleted of proline residues. Here we investigated the specific contribution of proline number and spacing to the structure and self-assembly propensities of elastin-like polypeptides. Increasing the spacing between proline residues significantly decreased the ability of polypeptides to reversibly self-associate. Real-time imaging of the assembly process revealed the presence of smaller colloidal droplets that displayed enhanced propensity to cluster into dense networks. Structural characterization showed that these aggregates were enriched in β-structure but unable to bind thioflavin-T. These data strongly support a model where proline-poor regions of the elastin monomer provide a unique contribution to assembly and suggest a role for localized β-sheet in mediating self-assembly interactions.     

Conformational Transitions of the Cross-linking Domains of Elastin during Self-assembly

Elastin is the intrinsically disordered polymeric protein imparting the exceptional properties of extension and elastic recoil to the extracellular matrix of most vertebrates. The monomeric precursor of elastin, tropoelastin, as well as polypeptides containing smaller subsets of the tropoelastin sequence, can self-assemble through a colloidal phase separation process called coacervation. Present understanding suggests that self-assembly is promoted by association of hydrophobic domains contained within the tropoelastin sequence, whereas polymerization is achieved by covalent joining of lysine side chains within distinct alanine-rich, α-helical cross-linking domains. In this study, model elastin polypeptides were used to determine the structure of cross-linking domains during the assembly process and the effect of sequence alterations in these domains on assembly and structure. CD temperature melts indicated that partial α-helical structure in cross-linking domains at lower temperatures was absent at physiological temperature. Solid-state NMR demonstrated that β-strand structure of the cross-linking domains dominated in the coacervate state, although α-helix was predominant after subsequent cross-linking of lysine side chains with genipin. Mutation of lysine residues to hydrophobic amino acids, tyrosine or alanine, leads to increased propensity for β-structure and the formation of amyloid-like fibrils, characterized by thioflavin-T binding and transmission electron microscopy. These findings indicate that cross-linking domains are structurally labile during assembly, adapting to changes in their environment and aggregated state. Furthermore, the sequence of cross-linking domains has a dramatic effect on self-assembly properties of elastin-like polypeptides, and the presence of lysine residues in these domains may serve to prevent inappropriate ordered aggregation.     

Quantitative observation of backbone disorder in native elastin

Elastin is a key protein in soft tissue function and pathology. Establishing a structural basis for understanding its reversible elasticity has proven to be difficult. Complementary to structure is the important aspect of flexibility and disorder in elastin. We have used solid-state NMR methods to examine polypeptide and hydrate ordering in both elastic (hydrated) and brittle (dry) elastin fibers and conclude (i) that tightly bound waters are absent in both dry and hydrated elastin and (ii) that the backbone in the hydrated protein is highly disordered with large amplitude motions. The hydrate was studied by (2)H and (17)O NMR, and the polypeptide by (13)C and (2)H NMR. Using a two-dimensional (13)C MAS method, an upper limit of S < 0.1 was determined for the backbone carbonyl group order parameter in hydrated elastin. For comparison, S approximately approximately 0.9 in most proteins. The former result is substantiated by two additional observations: the absence of the characteristic (2)H spectrum for stationary amides and "solution-like" (13)C magic angle spinning spectra at 75 degrees C, at which the material retains elasticity. Comparison of the observed shifts with accepted values for alpha-helices, beta-sheets, or random coils indicates a random coil structure at all carbons. These conclusions are discussed in the context of known thermodynamic properties of elastin and, more generally, protein folding. Because coacervation is an entropy-driven process, it is enhanced by the observed backbone disorder, which, we suggest, is the result of high proline content. This view is supported by recent studies of recombinant elastin polypeptides with systematic proline substitutions.     

Reversible structural changes in a hydrophobic protein,elastin, as indicated by fluorescence probe analysis

Fluorescent probe analysis of purified elastin using 1-anilinonaphthalene-8-sulfonate has been used to investigate reversible structural changes that accompany stretching of this rubberlike protein. There is a specific binding of 1-anilinonaphthalene-8-sulfonate to elastin with a single dye molecule attached per 74,000 molecular-weight protein subunit. When labeled elastin is stretched, the intensity of the 1-anilinonaphthalene-8-sulfonate fluorescence decreases reversibly, and this decrease appears to be linked to an increase in the environmental polarity in the immediate vicinity of the bound dye molecule. The results of experiments carried out in H₂O and D₂O indicate that this polarity change is due to an increase in the exposure of the 1-anilinonaphthalene-8-sulfonate to water as the hydrophobic interior of the protein subunit is unfolded during stretching. The data are consistent with the proposal that the elastin network is a two-phase system of hydrophobic protein globules surrounded by free solvent spaces.     

Bovine elastin cDNA clones: Evidence for the occurrence of a new elastin-related protein in fetal calf ligamentum nuchae

Poly (A+) mRNA was isolated from fetal calf ligamenturn nuchae and used for the construction of cDNA libraries. A fraction highly enriched in elastin mRNA was used to prepare the cDNA probes for screening the libraries. A 2 kb clone, pREl, gave the most positive signal in colony hybridization. It hybridized to a mRNA of the same size as reported for elastin mRNAs from chick and sheep. Hybrid-arrested translation showed that translation of mRNAs for proteins other than elastin doublet was not inhibited by pREI. Southern blot analysis showed that pREl has sequence homology with pVE6 and pVE10, which were tentatively identified as elastin-related cDNA clones representing two distinct mRNAs. DNA sequence data from the 5 end of pREl show that the translated amino acid sequence is not typical of known elastin sequences but contains some elastin-like sequences. All of this evidence strongly suggests the occurrence in fetal calf nuchal ligament of a mRNA which codes for a previously unknown elastin-related protein.     

Cooperativity between the hydrophobic and cross-linking domains of elastin

The principal protein component of the elastic fiber found in elastic tissues is elastin, an amorphous, cross-linked biopolymer that is assembled from a high molecular weight monomer. The hydrophobic and cross-linking domains of elastin have been considered separate and independent, such that changes to one region are not thought to affect the other. However, results from these solid-state 13C NMR experiments demonstrate that cooperativity in protein folding exists between the two domain types. The sequence of the EP20-24-24 polypeptide has three hydrophobic sequences from exons 20 and 24 of the soluble monomer tropoelastin, interspersed with cross-linking domains constructed from exons 21 and 23. In the middle of each cross-linking domain is a "hinge" sequence. When this pentapeptide is replaced with alanines, as in EP20-24-24[23U], its properties are changed. In addition to the expected increase in alpha-helical content and the resulting increase in rigidity of the cross-linking domains, changes to the organization of the hydrophobic regions are also observed. Using one-dimensional CPMAS (cross-polarization with magic angle spinning) techniques, including spectral editing and relaxation measurements, evidence for a change in dynamics to both domain types is observed. Furthermore, it is likely that the methyl groups of the leucines of the hydrophobic domains are also affected by the substitution to the hinge region of the cross-linking sequences. This cooperativity between the two domain types brings new questions to the phenomenon of coacervation in elastin polypeptides and strongly suggests that functional models for the protein must include a role for the cross-linking regions.     

67-kD elastin-binding protein is a protective "companion" of extracellular insoluble elastin and intracellular tropoelastin

The 67-kD elastin-binding protein (EBP) mediates cell adhesion to elastin and elastin fiber assembly, and it is similar, if not identical, to the 67-kD enzymatically inactive, alternatively spliced beta-galactosidase. The latter contains an elastin binding domain (S- GAL) homologous both to the aorta EBP and to NH2-terminal sequences of serine proteinases (Hinek, A., M. Rabinovitch, F. W. Keeley, and J. Callahan. 1993. J. Clin. Invest. 91:1198-1205). We now confirm the functional importance of this homology by showing that elastolytic activity of a representative serine elastase, porcine pancreatic elastase, was prevented by an antibody (anti-S-GAL) and by competing with purified EBP or S-GAL peptide. Immunohistochemistry of adult aorta indicates that the EBP exists as a permanent component of mature elastic fibers. This observation, together with the in vitro studies, suggests that the EBP could protect insoluble elastin from extracellular proteolysis and contribute to the extraordinary stability of this protein. Double immunolabeling of fetal lamb aorta with anti-S- GAL and antitropoelastin antibodies demonstrated, under light and electron microscopy, intracellular colocalization of the proteins in smooth muscle cells (SMC). Incubation of SMC with galactosugars to dissociate tropoelastin from EBP caused intracellular aggregation of tropoelastin. A tropoelastin/EBP complex was extracted from SMC lysates by coimmunoprecipitation and cross-linking, and its functional significance was addressed by showing that its dissociation by galactosugars caused degradation of tropoelastin by endogenous serine proteinase(s). This suggests that the EBP may also serve as a "companion" to intracellular tropoelastin, protecting this highly hydrophobic protein from self-aggregation and proteolytic degradation.     

Conformational dependence of collagenase (matrix metalloproteinase-1) up-regulation by elastin peptides in cultured fibroblasts

We have established that treatment of cultured human skin fibroblasts with tropoelastin or with heterogenic peptides, obtained after organo-alkaline or leukocyte elastase hydrolysis of insoluble elastin, induces a high expression of pro-collagenase-1 (pro-matrix metalloproteinase-1 (pro-MMP-1)). The identical effect was achieved after stimulation with a VGVAPG synthetic peptide, reflecting the elastin-derived domain known to bind to the 67-kDa elastin-binding protein. This clearly indicated involvement of this receptor in the described phenomenon. This notion was further reinforced by the fact that elastin peptides-dependent MMP-1 up-regulation has not been demonstrated in cultures preincubated with 1 mm lactose, which causes shedding of the elastin-binding protein and with pertussis toxin, which blocks the elastin-binding protein-dependent signaling pathway involving G protein, phospholipase C, and protein kinase C. Moreover, we demonstrated that diverse peptides maintaining GXXPG sequences can also induce similar cellular effects as a "principal" VGVAPG ligand of the elastin receptor. Results of our biophysical studies suggest that this peculiar consensus sequence stabilizes a type VIII beta-turn in several similar, but not identical, peptides that maintain a sufficient conformation to be recognized by the elastin receptor. We have also established that GXXPG elastin-derived peptides, in addition to pro-MMP-1, cause up-regulation of pro-matrix metalloproteinase-3 (pro-stromelysin 1). Furthermore, we found that the presence of plasmin in the culture medium activated these MMP proenzymes, leading to a consequent degradation of collagen substrate. Our results may be, therefore, relevant to pathobiology of inflammation, in which elastin-derived peptides bearing the GXXPG conformation (created after leukocyte-dependent proteolysis) bind to the elastin receptor of local fibroblasts and trigger signals leading to expression and activation of MMP-1 and MMP-3, which in turn exacerbate local connective tissue damage.     

Identification of a GA-rich sequence as a protein-binding site in the 3'-untranslated region of chicken elastin mRNA with a potential role in the developmental regulation of elastin mRNA stability

Synthesis of aortic elastin peaks in the perinatal period and then is strongly down-regulated with postnatal development and growth. Decreased stability of elastin mRNA contributes to this developmental decrease in chick aortic elastin production. We have previously shown that destabilization of elastin mRNA is correlated with decreased binding of cytosolic protein(s) to a large, GC-rich region of secondary structure in the 3'-untranslated region (3'-UTR) of elastin mRNA. In this study, using gel migration shift assays, deletion constructs, and antisense competition assays, we identify a major protein-binding site in the 3'-UTR of elastin as a GA-rich sequence (UGGGGGGAGGGAGGGAGGGA), which we have designated the G3A motif. This motif is present in the 3'-UTR of elastin from several species. Binding proteins are present in both nuclear and cytoplasmic extracts, and their abundance is associated with tissues producing elastin and correlated with circumstances in which elastin mRNA is stable. These results suggest that the conserved GA-rich sequence of the elastin 3'-UTR is an important element in the regulation of stability of the elastin mRNA.     

The N-terminal A domain of fibronectin-binding proteins A and B promotes adhesion of Staphylococcus aureus to elastin

The ability of Staphylococcus aureus to adhere to components of the extracellular matrix is an important mechanism for colonization of host tissues during infection. We have previously shown that S. aureus binds elastin, a major component of the extracellular matrix. The integral membrane protein, elastin-binding protein (EbpS), binds soluble elastin peptides and tropoelastin via its surface-exposed N-terminal domain. In this study, we demonstrate that some strains of S. aureus adhere strongly to immobilized human elastin and that this interaction is independent of EbpS but instead is mediated by the fibronectin-binding proteins, FnBPA and FnBPB. Our results show that EbpS mutant cells adhere to elastin-coated plates, whereas the cells negative for FnBPA and FnBPB do not adhere to the plates. Furthermore, only wild-type cells from the exponential phase of growth adhered when FnBPs were expressed maximally. We show that adherence to elastin promoted by FnBPA was not affected by soluble fibronectin, suggesting that the elastin binding domain is distinct from the fibronectin binding regions. Recombinant FnBPA(37-544) (rFnBPA(37-544)) protein corresponding to the A region of FnBPA and anti-FnBPA(37-544) antibodies inhibited FnBPA-mediated bacterial adherence to immobilized elastin. Finally, recombinant A domain proteins, rFnBPA(37-544) and rFnBPB(37-540), bound immobilized elastin dose-dependently and saturably. This interaction was inhibited by soluble elastin peptides, suggesting a specific receptor-ligand interaction.     

Structural insights into the elastin mimetic (LGGVG)6 using solid-state 13C NMR experiments and statistical analysis of the PDB

Elastin is a crosslinked hydrophobic protein found in abundance in vertebrate tissue and is the source of elasticity in connective tissues and blood vessels. The repeating polypeptide sequences found in the hydrophobic domains of elastin have been the focus of many studies that attempt to understand the function of the native protein on a molecular scale. In this study, the central residues of the (LGGVG)(6) elastin mimetic are targeted. Using a combination of a statistical analysis based on structures in the Brookhaven Protein Data Bank (PDB), 1D cross-polarization magic-angle-spinning (CPMAS) NMR spectroscopy, and 2D off-magic-angle-spinning (OMAS) spin-diffusion experiments, it is determined that none of the residues are found in a singular regular, highly ordered structure. Instead, like the poly(VPGVG) elastin mimetics, there are multiple conformations and significant disorder. Furthermore, the conformational ensembles are not reflective of proteins generally, as in the PDB, suggesting that the structure distributions in elastin mimetics are unique to these peptides and are a salient feature of the functional model of the native protein.     

Inhibition of Protein Synthesis Alters Protein Degradation through Activation of Protein Kinase B (AKT)

The homeostasis of protein metabolism is maintained and regulated by the rates of protein biosynthesis and degradation in living systems. Alterations of protein degradation may regulate protein biosynthesis through a feedback mechanism. Whether a change in protein biosynthesis modulates protein degradation has not been reported. In this study, we found that inhibition of protein biosynthesis induced phosphorylation/activation of AKT and led to phosphorylation of AKT target substrates, including FoxO1, GSK3α/β, p70S6K, AS160, and the E3 ubiquitin ligase MDM2. Phosphorylation of ribosomal protein S6 was also modulated by inhibition of protein biosynthesis. The AKT phosphorylation/activation was mediated mainly through the PI3K pathway because it was blocked by the PI3K inhibitor {"type":"entrez-nucleotide","attrs":{"text":"LY294002","term_id":"1257998346","term_text":"LY294002"}}LY294002. The activated AKT phosphorylated MDM2 at Ser¹⁶⁶ and promoted degradation of the tumor suppressor p53. These findings suggest that inhibition of protein biosynthesis can alter degradation of some proteins through activation of AKT. This study reveals a novel regulation of protein degradation and calls for caution in blocking protein biosynthesis to study the half-life of proteins.     

Aorta elastin turnover in normal and hypercholesterolemic Japanese quail

The turnover and degradation of mature elastin from the aortae of Japanese quail were estimated following with l-[U-¹⁴C]lysine by measuring the changes in specific activity of l-[U-¹⁴C]lysine and ¹⁴C-labelled desmosine and isodesmosine (crosslinking amino acids derived from lysyl residues) in elastin over a 39-week period. Only 5% of the variation in radioactivity could be attributed to changes in time. Therefore, it was concluded that the best estimates of mature elastin turnover are only quantifiable in years. Dietary cholesterol in amounts sifficient to induce plaque formation and fragmentation of the elastic lamina in the aorta did not significantly influence turnover time. It would appear that once the total pool of elastin in aorta is stabilized as mature fibers it is not subject to proteolysis or resynthesis of sufficient magnitude to result in measurable turnover.     

The Effect of Static Stretch on Elastin Degradation in Arteries

Previously we have shown that gradual changes in the structure of elastin during an elastase treatment can lead to important transition stages in the mechanical behavior of arteries [1]. However, in vivo arteries are constantly being loaded due to systolic and diastolic pressures and so understanding the effects of loading on the enzymatic degradation of elastin in arteries is important. With biaxial tensile testing, we measured the mechanical behavior of porcine thoracic aortas digested with a mild solution of purified elastase (5 U/mL) in the presence of a static stretch. Arterial mechanical properties and biochemical composition were analyzed to assess the effects of mechanical stretch on elastin degradation. As elastin is being removed, the dimensions of the artery increase by more than 20% in both the longitude and circumference directions. Elastin assays indicate a faster rate of degradation when stretch was present during the digestion. A simple exponential decay fitting confirms the time constant for digestion with stretch (0.11±0.04 h⁻¹) is almost twice that of digestion without stretch (0.069±0.028 h⁻¹). The transition from J-shaped to S-shaped stress vs. strain behavior in the longitudinal direction generally occurs when elastin content is reduced by about 60%. Multiphoton image analysis confirms the removal/fragmentation of elastin and also shows that the collagen fibers are closely intertwined with the elastin lamellae in the medial layer. After removal of elastin, the collagen fibers are no longer constrained and become disordered. Release of amorphous elastin during the fragmentation of the lamellae layers is observed and provides insights into the process of elastin degradation. Overall this study reveals several interesting microstructural changes in the extracellular matrix that could explain the resulting mechanical behavior of arteries with elastin degradation.     

Expression of a new chimeric protein with a highly repeated sequence in tobacco cells

In wheat, the high-molecular weight (HMW) glutenin subunits are known to contribute to gluten viscoelasticity, and show some similarities to elastomeric animal proteins as elastin. When combining the sequence of a glutenin with that of elastin is a way to create new chimeric functional proteins, which could be expressed in plants. The sequence of a glutenin subunit was modified by the insertion of several hydrophobic and elastic motifs derived from elastin (elastin-like peptide, ELP) into the hydrophilic repetitive domain of the glutenin subunit to create a triblock protein, the objective being to improve the mechanical (elastomeric) properties of this wheat storage protein. In this study, we investigated an expression model system to analyze the expression and trafficking of the wild-type HMW glutenin subunit (GS_W) and an HMW glutenin subunit mutated by the insertion of elastin motifs (GS_M-ELP). For this purpose, a series of constructs was made to express wild-type subunits and subunits mutated by insertion of elastin motifs in fusion with green fluorescent protein (GFP) in tobacco BY-2 cells. Our results showed for the first time the expression of HMW glutenin fused with GFP in tobacco protoplasts. We also expressed and localized the chimeric protein composed of plant glutenin and animal elastin-like peptides (ELP) in BY-2 protoplasts, and demonstrated its presence in protein body-like structures in the endoplasmic reticulum. This work, therefore, provides a basis for heterologous production of the glutenin-ELP triblock protein to characterize its mechanical properties.     

An engineered minidomain containing an elastin turn exhibits a reversible temperature-induced IgG binding.

A two-helix version of the triple alpha-helical staphylococcal Protein A, previously shown to retain the Fc binding properties of protein A, has been engineered to contain an elastin sequence, GVPGVG, within the inter-helix turn. The original type I beta-turn was replaced with a beta-turn from the muscle protein elastin, which has an inverse temperature-induced folding transition. These "elastin mutants" had lost their helical structure, as measured by circular dichroism (CD), and exhibited a lower stability than the wild-type domains (T(m) reduced by about 48 degrees C) in 30% trifluoroethanol. For the wild-type domains, the amount of alpha-helix and the binding affinity for Fc decreased as the temperature was increased. In contrast, although the starting affinity was lower for the disulfide elastin-turn mutant, it exhibited a 21-fold improvement in affinity over the same temperature range. The melting curve for the elastin-turn minidomain showed cooperative behavior, as measured by the increase in CD-amplitude at 222 nm. The observed CD behavior is consistent with the formation of a type I beta-turn, exhibiting similar DeltaH and DeltaS values to those seen previously for short elastin peptides [Reiersen, H., Clarke, A. R., and Rees, A. R. (1998) J. Mol. Biol. 283, 255-264], and accounting for the increase in on-rate. This demonstrates that, when inserted into a stable globular protein, short elastin sequences have the ability to modify local structure and activity, by operating as temperature modulated switches.     

Solid-state (13)C NMR reveals effects of temperature and hydration on elastin.

Elastin is the principal protein component of the elastic fiber in vertebrate tissue. The waters of hydration in the elastic fiber are believed to play a critical role in the structure and function of this largely hydrophobic, amorphous protein. (13)C CPMAS NMR spectra are acquired for elastin samples with different hydration levels. The spectral intensities in the aliphatic region undergo significant changes as 70% of the water in hydrated elastin is removed. In addition, dramatic differences in the CPMAS spectra of hydrated, lyophilized, and partially dehydrated elastin samples over a relatively small temperature range (-20 degrees C to 37 degrees C) are observed. Results from other experiments, including (13)C T(1) and (1)H T(1 rho) measurements, direct polarization with magic-angle spinning, and static CP of the hydrated and lyophilized elastin preparations, also support the model that there is significant mobility in fully hydrated elastin. Our results support models in which water plays an integral role in the structure and proper function of elastin in vertebrate tissue.     

13C CPMAS NMR studies of the elastin-like polypeptide (LGGVG)n

The elucidation of structure-function relationships in insoluble elastin is often approached using elastin-like polypeptides. In this manner, the characterization of the different regions in this extensive biopolymer may be facilitated in a "piece-wise" manner. Our solid-state NMR experiments indicate that (LGGVG)n has structural similarities to elastin and some elastin peptides, providing support for the utility of the mimetic peptides. Furthermore, previous NMR and CD studies indicated that the structure of the elastin-like polypeptide (LGGVG)n in solution is best described as a "conformational ensemble" with a mixture of type I and II beta-turns, in addition to unfolded regions. Our data indicate that the peptide does not adopt a single conformation in the solid state, lending further support to models for elastin that involve significant conformational heterogeneity.