Identification of the binding site for the extrahelical target base in N6-adenine DNA methyltransferases by photo-cross-linking with duplex oligodeoxyribonucleotides containing 5-iodouracil at the target position.

DNA methyltransferases flip their target bases out of the DNA double helix for catalysis. Base flipping of C5-cytosine DNA methyltransferases was directly observed in the protein-DNA cocrystal structures of M.HhaI and M.HaeIII. Indirect structural evidence for base flipping of N6-adenine and N4-cytosine DNA methyltransferases was obtained by modeling DNA into the three-dimensional structures of M.TaqI and M.PvuII in complex with the cofactor. In addition, biochemical evidence of base flipping was reported for different N6-adenine DNA methyltransferases. As no protein-DNA cocrystal structure for the related N6-adenine and N4-cytosine DNA methyltransferases is available, we used light-induced photochemical cross-linking to identify the binding site of the extrahelical target bases. The N6-adenine DNA methyltransferases M.TaqI and M.CviBIII, which both methylate adenine within the double-stranded 5'-TCGA-3' DNA sequence, were photo-cross-linked to duplex oligodeoxyribonucleotides containing 5-iodouracil at the target position in 50-60% and almost quantitative yield, respectively. Proteolytic fragmentation of the M. CviBIII-DNA complex followed by Edman degradation and electrospray ionization mass spectrometry indicates photo-cross-linking to tyrosine 122. In addition, the mutant methyltransferases M. TaqI/Y108A and M.TaqI/F196A were photo-cross-linked with 6-fold and 2-fold reduced efficiency, respectively, which suggests that tyrosine 108 is the primary site of modification in M.TaqI. Our results indicate a close proximity between the extrahelical target base and tyrosine 122 in M.CviBIII or tyrosine 108 in M.TaqI. As both residues belong to the conserved motif IV ((N/D/S)(P/I)P(Y/F/W)) found in all N6-adenine and N4-cytosine DNA as well as in N6-adenine RNA methyltransferases, a similar spatial relationship between the target bases and the aromatic amino acid residue within motif IV is expected for all these methyltransferases.     

The mechanism of target base attack in DNA cytosine carbon 5 methylation

We measured the tritium exchange reaction on cytosine C(5) in the presence of AdoMet analogues to investigate the catalytic mechanism of the bacterial DNA cytosine methyltransferase M.HhaI. Poly(dG-dC) and poly(dI-dC) substrates were used to investigate the function of the active site loop (residues 80-99), stability of the extrahelical base, base flipping mechanism, and processivity on DNA substrates. On the basis of several experimental approaches, we show that methyl transfer is the rate-limiting pre-steady-state step. Further, we show that the active site loop opening contributes to the rate-limiting step during multiple cycles of catalysis. Target base activation and nucleophilic attack by cysteine 81 are fast and readily reversible. Thus, the reaction intermediates involving the activated target base and the extrahelical base are in equilibrium and accumulate prior to the slow methyl transfer step. The stability of the activated target base depends on the active site loop closure, which is dependent on the hydrogen bond between isoleucine 86 and the guanine 5' to the target cytosine. These interactions prevent the premature release of the extrahelical base and uncontrolled solvent access; the latter modulates the exchange reaction and, by implication, the mutagenic deamination reaction. The processive catalysis by M.HhaI is also regulated by the interaction between isoleucine 86 and the DNA substrate. Nucleophilic attack by cysteine 81 is partially rate limiting when the target base is not fully stabilized in the extrahelical position, as observed during the reaction with the Gln(237)Trp mutant or in the cytosine C(5) exchange reaction in the absence of the cofactor.     

Internal dynamics in a DNA triple helix probed by (1)H-(15)N-NMR spectroscopy

The amino group of adenine plays a key role in maintaining DNA triple helical structures, being the only functional group in DNA that is involved in both Watson-Crick and Hoogsteen hydrogen bonds. In the present work we have probed the internal dynamics of the adenine amino group in the intramolecular YRY triple helix formed by the 31-mer DNA oligonucleotide d(AGAGAGAACCCCTTCTCTCTTTTTCTCTCTT). The DNA triple helix was specifically labeled with (15)N at the amino group of the adenine in the fifth position. The rotation rate of the labeled amino group was measured as a function of temperature using (1)H-(15)N heteronuclear NMR spectroscopy. The results indicate that, in the DNA triple helix, the rotation of the adenine amino group is greatly slowed relative to that in a DNA double helix. The temperature dependence of the rotation rate suggests a large entropic contribution to this effect, which may originate from different hydration patterns of the adenine amino group in the two structures.     

Rotational dynamics of adenine amino groups in a DNA double helix

Exocyclic amino groups of the bases undergo conformational fluctuations that affect the recognition and reactivity of nucleic acid molecules. Among these fluctuations, rotation of amino groups around C-N bonds is of special interest. In the present paper, we report the first determination of the rates and energetic parameters for rotation of the N6-amino group of adenine in a DNA double helix. The DNA molecule studied is the dodecamer [d(CGCGAGCTCGCG)]2. The adenine in each A. T basepair of the dodecamer was labeled with 15N at the N6 position, and the NMR resonances of the two protons in the adenine amino group were selectively observed by 15N-editing methods. The rates of rotation of the amino group were obtained from experiments of transfer of magnetization between the two protons in the same group and from lineshape analysis of 15N-edited amino proton NMR resonances. The results show that, over the temperature range from 0 to 70 degrees C, the rates of rotation of adenine amino groups range from 60 to 24,000 s-1. Formation of the activated state during rotation has a standard enthalpy change of 15.3 +/- 0.2 kcal/mol and a standard entropy change of 6.0 +/- 0.7 cal/(mol. K). Analysis of the results suggests that rotation of the amino group occurs in the paired, closed state of the adenine in the A. T basepair of the double-helical DNA structure.     

Functional analysis of amino acid residues at the dimerisation interface of KpnI DNA methyltransferase

KpnI DNA-(N6-adenine) methyltransferase (M.KpnI) recognises the sequence 5'-GGTACC-3' and transfers the methyl group from S-adenosyl-L-methionine (AdoMet) to the N6 position of the adenine residue in each strand. Earlier studies have shown that M.KpnI exists as a dimer in solution, unlike most other MTases. To address the importance of dimerisation for enzyme function, a three-dimensional model of M.KpnI was obtained based on protein fold-recognition analysis, using the crystal structures of M.RsrI and M.MboIIA as templates. Residues I146, I161 and Y167, the side chains of which are present in the putative dimerisation interface in the model, were targeted for site-directed mutagenesis. Methylation and in vitro restriction assays showed that the mutant MTases are catalytically inactive. Mutation at the I146 position resulted in complete disruption of the dimer. The replacement of I146 led to drastically reduced DNA and cofactor binding. Substitution of I161 resulted in weakening of the interaction between monomers, leading to both monomeric and dimeric species. Steady-state fluorescence measurements showed that the wild-type KpnI MTase induces structural distortion in bound DNA, while the mutant MTases do not. The results establish that monomeric MTase is catalytically inactive and that dimerisation is an essential event for M.KpnI to catalyse the methyl transfer reaction.     

Kinetic and catalytic properties of dimeric KpnI DNA methyltransferase

KpnI DNA-(N(6)-adenine)-methyltransferase (KpnI MTase) is a member of a restriction-modification (R-M) system in Klebsiella pneumoniae and recognizes the sequence 5'-GGTACC-3'. It modifies the recognition sequence by transferring the methyl group from S-adenosyl-l-methionine (AdoMet) to the N(6) position of adenine residue. KpnI MTase occurs as a dimer in solution as shown by gel filtration and chemical cross-linking analysis. The nonlinear dependence of methylation activity on enzyme concentration indicates that the functionally active form of the enzyme is also a dimer. Product inhibition studies with KpnI MTase showed that S-adenosyl-l-homocysteine is a competitive inhibitor with respect to AdoMet and noncompetitive inhibitor with respect to DNA. The methylated DNA showed noncompetitive inhibition with respect to both DNA and AdoMet. A reduction in the rate of methylation was observed at high concentrations of duplex DNA. The kinetic analysis where AdoMet binds first followed by DNA, supports an ordered bi bi mechanism. After methyl transfer, methylated DNA dissociates followed by S-adenosyl-l-homocysteine. Isotope-partitioning analysis showed that KpnI MTase-AdoMet complex is catalytically active.     

Base flipping in nucleotide excision repair

UvrB, the ultimate damage-binding protein in bacterial nucleotide excision repair is capable of binding a vast array of structurally unrelated lesions. A beta-hairpin structure in the protein plays an important role in damage-specific binding. In this paper we have monitored DNA conformational alterations in the UvrB-DNA complex, using the fluorescent adenine analogue 2-aminopurine. We show that binding of UvrB to a DNA fragment with cholesterol damage moves the base adjacent to the lesion at the 3' side into an extrahelical position. This extrahelical base is not accessible for acrylamide quenching, suggesting that it inserts into a pocket of the UvrB protein. Also the base opposite this flipped base is extruded from the DNA helix. The degree of solvent exposure of both residues varies with the type of cofactor (ADP/ATP) bound by UvrB. Fluorescence of the base adjacent to the damage is higher when UvrB is in the ADP-bound configuration, but concomitantly this UvrB-DNA complex is less stable. In the ATP-bound form the UvrB-DNA complex is very stable and in this configuration the base in the non-damaged strand is more exposed. Hairpin residue Tyr-95 is specifically involved in base flipping in the non-damaged strand. We present evidence that this conformational change in the non-damaged strand is important for 3' incision by UvrC.     

Impact of base pair identity 5′ to the spliceosomal branch site adenosine on branch site conformation

The branch site helix from Saccharomyces cerevisiae with pseudouridine (ψ) incorporated in a phylogenetically conserved position of U2 snRNA features an extrahelical branch site adenosine (A) that forms a base triple interaction with the minor groove edge of a widely conserved purine_{U2 strand}-pyrimidine_{intron strand} (R_U2-Y_intron) base pair two positions upstream. In these studies, NMR spectra of a duplex in which 2-aminopurine (2ap), a fluorescent analog of adenine lacking the proposed hydrogen bond donor, was substituted for the branch site A, indicated that the substitution does not alter the extrahelical position of the branch site residue; thus, it appears that a hydrogen bond between the adenine amino group and the R-Y pair is not obligatory for stabilization of the extrahelical conformation. In contrast, reversal of the orientation of A_U2-U_intron to U_U2-A_intron resulted in an intrahelical position for the branch site A or 2ap. Fluorescence intensity of 2ap substituted for the branch site A with the original R_U2-Y_intron orientation (AU or GC) was high, consistent with an extrahelical position, whereas fluorescence in helices with the reversed R-Y orientation, or with a mismatched pair (A-U → G•A or U•C), was markedly quenched, implying that the residue was stacked in the helix. The A 5′ to the branch site residue was not extrahelical in any of the duplexes. These findings suggest that the R_U2-Y_intron base pair orientation in the ψ-dependent branch site helix plays an important role in positioning the branch site A for recognition and/or function.     

Nucleotide-induced DNA polymerase active site motions accommodating a mutagenic DNA intermediate

DNA polymerases occasionally insert the wrong nucleotide. For this error to become a mutation, the mispair must be extended. We report a structure of DNA polymerase beta (pol beta) with a DNA mismatch at the boundary of the polymerase active site. The structure of this complex indicates that the templating adenine of the mispair stacks with the primer terminus adenine while the templating (coding) cytosine is flipped out of the DNA helix. Soaking the crystals of the binary complex with dGTP resulted in crystals of a ternary substrate complex. In this case, the templating cytosine is observed within the DNA helix and forms Watson-Crick hydrogen bonds with the incoming dGTP. The adenine at the primer terminus has rotated into a syn-conformation to interact with the opposite adenine in a planar configuration. Yet, the 3'-hydroxyl on the primer terminus is out of position for efficient nucleotide insertion.     

M.HhaI binds tightly to substrates containing mismatches at the target base.

The (cytosine-5) DNA methyltransferase M.HhaI causes its target cytosine base to be flipped completely out of the DNA helix upon binding. We have investigated the effects of replacing the target cytosine by other, mismatched bases, including adenine, guanine, thymine and uracil. We find that M.HhaI binds more tightly to such mismatched substrates and can even transfer a methyl group to uracil if a G:U mismatch is present. Other mismatched substrates in which the orphan guanine is changed exhibit similar behavior. Overall, the affinity of DNA binding correlates inversely with the stability of the target base pair, while the nature of the target base appears irrelevant for complex formation. The presence of a cofactor analog. S-adenosyl-L-homocysteine, greatly enhances the selectivity of the methyltransferase for cytosine at the target site. We propose that the DNA methyltransferases have evolved from mismatch binding proteins and that base flipping was, and still is, a key element in many DNA-enzyme interactions.     

Abasic sites in duplex DNA: molecular modeling of sequence-dependent effects on conformation

Molecular modeling calculations using JUnction Minimization of Nucleic Acids (JUMNA) have been used to study sequence effects on the conformation of abasic sites within duplex DNA. We have considered lesions leading to all possible unpaired bases (X), adenine, guanine, cytosine, or thymine contained within two distinct sequence contexts, CXC and GXG. Calculations were carried out on DNA 11-mers using extensive conformational search techniques to locate the most stable abasic conformations and using Poisson-Boltzmann corrected electrostatics to account for solvation effects. The results, which are in very good agreement with available experimental data, point to strong sequence effects on both the position of the unpaired base (intra or extrahelical) and on the overall curvature induced by the abasic lesion. For CXC, unpaired purines are found to lie within the helix, while unpaired pyrimidines are either extrahelical or in equilibrium between the intra and extrahelical forms. For GXG, all unpaired bases lead to intrahelical forms, but with marked, sequence-dependent differences in induced curvature.     

A mutational analysis of the two motifs common to adenine methyltransferases.

All methyltransferases that use S-adenosyl methionine as the methyl group donor contain a sequence similar to (D/E/S)XFXGXG which has been postulated to form part of the cofactor binding site. In N6-adenine DNA methyltransferases there is a second motif, (D/N)PP(Y/F), which has been proposed to play a role similar to the catalytically essential PC motif conserved in all C5-cytosine DNA methyltransferases. We have made a series of amino acid changes in these two motifs in the EcoKI N6-adenine DNA methyltransferase. The mutant enzymes have been purified to homogeneity and characterized by physical biochemical methods. The first G is the most conserved residue in motif I. Changing this G to D completely abolished S-adenosyl methionine binding, but left enzyme structure and DNA target recognition unaltered, thus documenting the S-adenosyl methionine binding function of motif I in N6-adenine methyltransferases. Substitution of the N with D, or F with either G or C, in motif II abolished enzyme activity, but left S-adenosyl methionine and DNA binding unaltered. Changes of F to Y or W resulted in partial enzyme activity, implying that an aromatic residue is important for methylation. The substitution of W for F greatly enhanced UV-induced cross-linking between the enzyme and S-adenosyl methionine, suggesting that the aromatic residue is close in space to the methyl-group donor.     

DNA duplexes containing photoactive derivatives of 2'-deoxyuridine as photocrosslinking probes for EcoRII DNA methyltransferase-substrate interaction

EcoRII DNA methyltransferase (M.EcoRII) recognizes the DNA sequence 5'.CC*T/AGG.3' and catalyzes the transfer of the methyl group from S-adenosyl-L-methionine to the C5 position of the inner cytosine residue (C*). We obtained several DNA duplexes containing photoactive 5-iodo-2'-deoxyuridine (i(5)dU) or 5-[4-(3-(trifluoromethyl)-3H-diazirin-3-yl)phenyl]-2'-deoxyuridine (Tfmdp-dU) to characterize regions of M.EcoRII involved in DNA binding and to investigate the DNA double helix conformational changes that take place during methylation. The efficiencies of methylation, DNA binding affinities and M.EcoRII-DNA photocrosslinking yields strongly depend on the type of modification and its location within the EcoRII recognition site. The data obtained agree with the flipping of the target cytosine out of the DNA double helix for catalysis. To probe regions of M.EcoRII involved in DNA binding, covalent conjugates M.EcoRII-DNA were cleaved by cyanogen bromide followed by analysis of the oligonucleotide-peptides obtained. DNA duplexes containing i(5)dU or Tfmdp-dU at the central position of the recognition site, or instead of the target cytosine were crosslinked to the Gly(268)-Met(391) region of the EcoRII methylase. Amino acid residues from this region may take part both in substrate recognition and stabilization of the extrahelical target cytosine residue.     

DNA methyltransferases: mechanistic models derived from kinetic analysis

The sequence-specific transfer of methyl groups from donor S-adenosyl-L-methionine (AdoMet) to certain positions of DNA-adenine or -cytosine residues by DNA methyltransferases (MTases) is a major form of epigenetic modification. It is virtually ubiquitous, except for some notable exceptions. Site-specific methylation can be regarded as a means to increase DNA information capacity and is involved in a large spectrum of biological processes. The importance of these functions necessitates a deeper understanding of the enzymatic mechanism(s) of DNA methylation. DNA MTases fall into one of two general classes; viz. amino-MTases and [C5-cytosine]-MTases. Amino-MTases, common in prokaryotes and lower eukaryotes, catalyze methylation of the exocyclic amino group of adenine ([N6-adenine]-MTase) or cytosine ([N4-cytosine]-MTase). In contrast, [C5-cytosine]-MTases methylate the cyclic carbon-5 atom of cytosine. Characteristics of DNA MTases are highly variable, differing in their affinity to their substrates or reaction products, their kinetic parameters, or other characteristics (order of substrate binding, rate limiting step in the overall reaction). It is not possible to present a unifying account of the published kinetic analyses of DNA methylation because different authors have used different substrate DNAs and/or reaction conditions. Nevertheless, it would be useful to describe those kinetic data and the mechanistic models that have been derived from them. Thus, this review considers in turn studies carried out with the most consistently and extensively investigated [N6-adenine]-, [N4-cytosine]- and [C5-cytosine]-DNA MTases.     

Entrapment and Structure of an Extrahelical Guanine Attempting to Enter the Active Site of a Bacterial DNA Glycosylase, MutM

MutM, a bacterial DNA glycosylase, protects genome integrity by catalyzing glycosidic bond cleavage of 8-oxoguanine (oxoG) lesions, thereby initiating base excision DNA repair. The process of searching for and locating oxoG lesions is especially challenging, because of the close structural resemblance of oxoG to its million-fold more abundant progenitor, G. Extrusion of the target nucleobase from the DNA double helix to an extrahelical position is an essential step in lesion recognition and catalysis by MutM. Although the interactions between the extruded oxoG and the active site of MutM have been well characterized, little is known in structural detail regarding the interrogation of extruded normal DNA bases by MutM. Here we report the capture and structural elucidation of a complex in which MutM is attempting to present an undamaged G to its active site. The structure of this MutM-extrahelical G complex provides insights into the mechanism MutM employs to discriminate against extrahelical normal DNA bases and into the base extrusion process in general.     

Interaction of DNA polymerase I (Klenow fragment) with DNA substrates containing extrahelical bases: implications for proofreading of frameshift errors during DNA synthesis

Frameshift mutagenesis occurs through the misalignment of primer and template strands during DNA synthesis and involves DNA intermediates that contain one or more extrahelical bases in either strand of the DNA substrate. To investigate whether these DNA structures are recognized by the proofreading apparatus of DNA polymerases, time-resolved fluorescence spectroscopy was used to examine the interaction between the Klenow fragment of DNA polymerase I and synthetic DNA primer-templates containing extrahelical bases at defined positions within the template strand. A dansyl probe attached to the DNA was used to measure the fractional occupancies of the polymerase and 3'-5' exonuclease sites of the enzyme for DNA substrates with and without the extrahelical bases. The presence of an extrahelical base at the first position from the primer 3' terminus increased the level of partitioning of the DNA substrates into the 3'-5' exonuclease site by 3-7-fold, relative to the perfectly base-paired primer-template, depending on the identity of the extrahelical base. The ability of different extrahelical bases to promote partitioning of DNA into the 3'-5' exonuclease site decreased in the following order: G > A approximately T > C. The results of partitioning measurements for DNA substrates containing a bulged adenine base at different positions within the template showed that an extrahelical base is recognized up to five bases from the primer 3' terminus. The largest effects were observed for the extrahelical base at the third or fourth positions from the primer terminus, which increased the level of partitioning of DNA into the 3'-5' exonuclease site by 8- and 18-fold, respectively, relative to that of the perfectly base-paired substrate. Steady-state fluorescence measurements of analogous primer-templates containing 2-aminopurine (AP) at the primer 3' terminus indicate that extrahelical bases increase the degree of terminus unwinding, especially when close to the terminus. In addition, steady-state kinetic measurements of removal of AP from the primer-templates indicate that the exonucleolytic cleavage activity of Klenow fragment is correlated with the increased level of partitioning of bulged DNA substrates to the 3'-5' exonuclease site relative to that of properly base-paired DNA. The results of this study indicate that misalignment of primer and template strands to generate an extrahelical base strongly promotes transfer of a DNA substrate to the 3'-5' exonuclease site, suggesting that the premutational intermediates in frameshift mutagenesis are subject to proofreading by the polymerase.     

The use of diaminopurine to investigate structural properties of nucleic acids and molecular recognition between ligands and DNA.

2,6-Diaminopurine (DAP) is an analogue of adenine which can be converted to nucleotides that serve as substrates for incorporation into nucleic acids by polymerases in place of (d)AMP. It pairs with thymidine (or uracil), engaging in three hydrogen bonds of the Watson-Crick type. The result of DAP incorporation is to add considerable stability to the double helix and to impart other structural features, such as an altered groove width and disruption of the normal spine of hydration. DNA containing DAP may or may not be recognized by restriction endonucleases; RNA containing DAP may not engage in normal splicing. The DAP.T pair affects the local flexibility of DNA and impedes the interaction with helix bending proteins. By providing a non-canonical hydrogen bond donor in the minor groove and/or blocking access to the floor of that groove it strongly affects interactions with small molecules such as antibiotics and anticancer drugs. Examples which illustrate altered recognition of nucleotide sequences in DAP-containing DNA are presented: changed sites of cutting by bleomycin, photocleavage by uranyl nitrate and footprinting with mithramycin. Using DNA in which both A-->DAP and G-->Inosine substitutions have been made it is possible to assess precisely the role of the purine 2-amino group in ligand-DNA recognition.     

Mechanistic link between DNA methyltransferases and DNA repair enzymes by base flipping

Rotation of a DNA nucleotide out of the double helix and into a protein binding pocket (“base flipping”) was first observed in the structure of a DNA methyltransferase. There is now evidence that a variety of proteins, particularly DNA repair enzymes, use base flipping in their interactions with DNA. Though the mechanisms for base movement into extrahelical positions are still unclear, the focus of this review is how base recognition is modulated by the stringency of binding to the extrahelical base(s) or sugar moiety. © 1997 John Wiley & Sons, Inc. Biopoly 44: 139–151, 1997     

Two alternative conformations of S-adenosyl-L-homocysteine bound to Escherichia coli DNA adenine methyltransferase and the implication of conformational changes in regulating the catalytic cycle

The crystal structure of the Escherichia coli DNA adenine methyltransferase (EcoDam) in a binary complex with the cofactor product S-adenosyl-L-homocysteine (AdoHcy) unexpectedly showed the bound AdoHcy in two alternative conformations, extended or folded. The extended conformation represents the catalytically competent conformation, identical to that of EcoDam-DNA-AdoHcy ternary complex. The folded conformation prevents catalysis, because the homocysteine moiety occupies the target Ade binding pocket. The largest difference between the binary and ternary structures is in the conformation of the N-terminal hexapeptide ((9)KWAGGK(14)). Cofactor binding leads to a strong change in the fluorescence of Trp(10), whose indole ring approaches the cofactor by 3.3A(.) Stopped-flow kinetics and AdoMet cross-linking studies indicate that the cofactor prefers binding to the enzyme after preincubation with DNA. In the presence of DNA, AdoMet binding is approximately 2-fold stronger than AdoHcy binding. In the binary complex the side chain of Lys(14) is disordered, whereas Lys(14) stabilizes the active site in the ternary complex. Fluorescence stopped-flow experiments indicate that Lys(14) is important for EcoDam binding of the extrahelical target base into the active site pocket. This suggests that the hexapeptide couples specific DNA binding (Lys(9)), AdoMet binding (Trp(10)), and insertion of the flipped target base into the active site pocket (Lys(14)).