The mouse poly(C)-binding protein exists in multiple isoforms and interacts with several RNA-binding proteins.

The murine poly(C)-binding protein (mCBP) was previously shown to belong to the group of K-homology (KH) proteins by virtue of its homology to hnRNP-K. We have isolated cDNA-splice variants of mCBP which differ by two variable regions of 93 bp and/or 39 +/- 3 bp respectively. Both variable regions are located between the second and third KH-domain of mCBP. The characterization of a partial genomic clone enabled us to propose a model for the generation of the second variable region by the use of a putative alternative splice signal. The mCBP mRNA is expressed ubiquitously and the protein is found predominantly in the nucleus with the exception of the nucleoli. We have identified five proteins which interact with mCBP in the yeast two hybrid system: mouse y-box protein 1 (msy-1), y-box-binding protein, hnRNP-L, filamin and splicing factor 9G8. The interaction between mCBP and splicing factor 9G8 was confirmed in vivo. These results suggest a function of mCBP in RNA metabolism.     

Identification of non-telomeric G4-DNA binding proteins in human,E. coli,yeast, and Arabidopsis

G4-DNA binding proteins of E. coli, Saccharomyces cerevisiae, Arabidopsis, and human have been identified by a synthetic non-telomeric G4-DNA oligo 5'-d(ACTGTCGTACTTGATATGGGGGT)-3' using gel mobility shift assays. G4-DNA binding proteins are specific to G4-DNA, a four-stranded guanine-DNA structure. Bound complexes of G4-DNA and proteins were identified in nuclear extracts of all examined organisms in this study. In humans, three different G4-DNA and protein complexes were identified. However, human telomeric G-quadruplex oligo did not compete with G4-DNA oligo in the competition assays, suggesting that the identified G4-DNA binding proteins may be different from the known human telomeric G4-DNA binding proteins. We discovered two complexes of G4-DNA and protein in Arabidopsis identified in mobility shift assays. Interestingly, two complexes of G4-DNA and proteins were identified from E. coli, which have a circular genomic DNA structure. Results of this investigation suggest that non-telomeric G4-DNA structure and its binding proteins may be involved in important functional roles in both prokaryotes and eukaryotes.     

Stimulation of oligonucleotide binding of estradiol receptor complexes by accessory proteins.

During purification of E2R using oligo(dT)-cellulose chromatography, a receptor accessory factor (RAF) was identified in the cytosol of mouse kidney. This factor stimulates the binding of purified E2R to oligo(dT)-, oligo(dC)-, and oligo(dA)-cellulose as well as to DNA cellulose. It is a heat-stable, trypsin-resistant protein with an apparent molecular weight of between 10 and 30,000 daltons. Although structurally unrelated, similar stimulation of oligonucleotide binding was seen with calf thymus histones and, to a lesser extent, egg white lysozyme. Individual histones, especially H2a, H2B, and H3, also facilitate rebinding of purified E2R to oligo(dT)-cellulose, while H1 is less effective. Furthermore, histones stabilize the holoreceptor during sedimentation at 4 degrees and 12 degrees C. The N- and C-terminal half molecules of H2b were generated by cyanogen bromide-mediated cleavage and the N-terminal half was found to duplicate the effects of the parent molecule, both in binding and holoreceptor stabilization. These data suggest that the in vivo binding of E2R to DNA can be modulated by accessory proteins of cytosol and nuclear origin.     

Oligodeoxynucleotide base recognition by steroid hormone receptors

Oligodeoxynucleotides covalently linked to cellulose were used as probes of the DNA-binding domains of mouse steroid holoreceptors. With uterine cytosol estrogen receptor (E₂R) the relative binding order, in prior studies, was oligo(dG) > oligo(dT) ≧ oligo(dC) > > oligo(dA) > oligo(dI). The binding reactions were salt-sensitive with an optimal KCl concentration of 0.1–0.2 M. There was no enhancement of binding by activation, either temperature- or salt-induced. In the present study, using the oligomer ligands at a lower concentration, oligo(dT) binding was greater than that to oligo(dC). Quantitative differences in oligodeoxynucleotide binding were elicited by a number of inhibitors. These differences are again seen by exposure of E₂R to chaotropic salts such as SCN^?, ClO₄^? and NO₃^? as well as to putative modifiers of receptor amino acids, ie, iodoacetamide, 1,2 cyclohexanedione, and Rose Bengal. These results, and the quantitative differences following heat and purification, led to a designation of two types of subsites within the DNA-binding domain of uterine E₂R. These are stable G sites, which interact with oligo(dG); and labile N sites, which bind to oligo(dT), oligo(dC) and oligo(dA). Stimulation of binding to N sites and stabilization of the holoreceptor was effected by histones H2A and H2B. However, the differential response to incubation at 37°C was not altered by addition of H2B. Treatment of uterine E₂R by limited proteolysis also eliminated the stimulatory response to H2B. The above data, as well as prior studies, indicate that steroid holoreceptors can discriminate between the structural features of deoxynucleotide bases and this recognition process can be modulated by accessory proteins.     

Proteins crosslinked to messenger RNA by irradiating polyribosomes with ultraviolet light.

A set of proteins crosslinked to L-cell mRNA by irradiating polyribosomes with 254 nm ultraviolet light has been identified. 35S-methionine-labeled crosslinked mRNA-protein complexes were isolated by chromatography on oligo(dT)-cellulose under conditions that prevented non-covalent binding of proteins to RNA and to the column. After enzymatic removal of the RNA the proteins were analyzed in sodium dodecylsulfate/polyacrylamide gels. Six proteins having molecular weights of 98,000, 78,000, 75,000, 68,000, 62,000, and 52,000 were crosslinked to mRNA whether intact polyribosomes or EDTA- released mRNA-protein complexes were irradiated. Digestions with specific RNAases and chromatography on oligo(dT)-cellulose were used to show that a protein of 78,000 daltons was the only one crosslinked to poly(A), and the other proteins were crosslinked to sequences other than poly(A). However, a 78,000 dalton protein was also crosslinked to a sequence other than poly(A).     

CD spectra show the relational style between Zic-, Gli-, Glis-zinc finger protein and DNA

Zic family proteins have five C2H2-type zinc finger motifs. The Zic-zinc finger domains show high homology to the corresponding domains of the Gli and Glis families, which also contain five C2H2-type zinc finger motifs. The zinc finger motifs of the proteins of these three protein families form an alpha-helix conformation in solution. The addition of oligo DNA that included a Gli-binding sequence increased the alpha-helix content estimated by using circular dichroism spectroscopy. Comparison of the Zic-, Gli-, and Glis-zinc fingers indicated that the alpha-helix content after the addition of oligo DNA correlated well with the affinity of each zinc finger for the oligo DNA (correlation coefficient, 0.85). The importance of the zinc ion for protein folding was reflected in a reduction in the alpha-helix content upon removal of the zinc ion. Owing to the compact globular structure, the alpha-helix structure of the proteins of these three protein families is extremely thermally stable. These results suggest that the alpha-helix structure is important for DNA binding and profoundly related to functional and structural diversity among the three families.     

DNA binding properties of the Saccharomyces cerevisiae DAT1 gene product.

The DAT1 gene of Saccharomyces cerevisiae encodes a DNA binding protein (Dat1p) that specifically recognizes the minor groove of non-alternating oligo(A).oligo(T) tracts. Sequence-specific recognition requires arginine residues found within three perfectly repeated pentads (G-R-K-P-G) of the Dat1p DNA binding domain [Reardon, B. J., Winters, R. S., Gordon, D., and Winter, E. (1993) Proc. Natl. Acad. Sci. USA 90, 11327-1131]. This report describes a rapid and simple method for purifying the Dat1p DNA binding domain and the biochemical characterization of its interaction with oligo(A).oligo(T) tracts. Oligonucleotide binding experiments and the characterization of yeast genomic Dat1p binding sites show that Dat1p specifically binds to any 11 base sequence in which 10 bases conform to an oligo(A).oligo(T) tract. Binding studies of different sized Dat1p derivatives show that the Dat1p DNA binding domain can function as a monomer. Competition DNA binding assays using poly(I).poly(C), demonstrate that the minor groove oligo(A).oligo(T) constituents are not sufficient for high specificity DNA binding. These data constrain the possible models for Dat1p/oligo(A).oligo(T) complexes, suggest that the DNA binding domain is in an extended structure when complexed to its cognate DNA, and show that Dat1p binding sites are more prevalent than previously thought.     

A Dictyostelium protein binds to distinct oligo(dA) x oligo(dT) DNA sequences in the C-module of the retrotransposable element DRE.

The genome of the eukaryotic microbe Dictyostelium discoideum contains some 200 copies of the nonlong-terminal repeat retrotransposon DRE. Among several unique features of this retroelement, DRE is transcribed in both directions leading to the formation of partially overlapping plus strand and minus strand RNAs. The synthesis of minus strand RNAs is controlled by the C-module, a 134-bp DNA sequence located at the 3'-end of DRE. A nuclear protein (CMBF) binds to the C-module via interaction with two almost homopolymeric 24 bp oligo(dA) x oligo(dT) sequences. The DNA-binding drugs distamycin and netropsin, which bind to A x T-rich DNA sequences in the minor groove, competed efficiently for the binding of CMBF to the C-module. The CMBF-encoding gene, cbfA, was isolated and a DNA-binding domain was mapped to a 25-kDa C-terminal region of the protein. A peptide motif involved in the binding of A x T-rich DNA by high mobility group-I proteins ('GRP' box) was identified in the deduced CMBF protein sequence, and exchange of a consensus arginine residue for alanine within the CMBF GRP box abolished the interaction of CMBF with the C-module. The current data support the theory that CMBF binds to the C-module by detecting its long-range DNA conformation and interacting with A x T base pairs in the minor groove of oligo(dA) x oligo(dT) stretches.     

G‐protein coupled receptor array technologies: Site directed immobilisation of liposomes containing the H1‐histamine or M2‐muscarinic receptors

This paper describes a novel strategy to create a microarray of G‐protein coupled receptors (GPCRs), an important group of membrane proteins both physiologically and pharmacologically. The H₁‐histamine receptor and the M₂‐muscarinic receptor were both used as model GPCRs in this study. The receptor proteins were embedded in liposomes created from the cellular membrane extracts of Spodoptera frugiperda (Sf9) insect cell culture line with its accompanying baculovirus protein insert used for overexpression of the receptors. Once captured onto a surface these liposomes provide a favourable lipidic environment for the integral membrane proteins. Site directed immobilisation of these liposomes was achieved by introduction of cholesterol‐modified oligonucleotides (oligos). These oligo/cholesterol conjugates incorporate within the lipid bilayer and were captured by the complementary oligo strand exposed on the surface. Sequence specific immobilisation was demonstrated using a quartz crystal microbalance with dissipation (QCM‐D). Confirmatory results were also obtained by monitoring fluorescent ligand binding to GPCRs captured on a spotted oligo microarray using Confocal Laser Scanning Microscopy and the ZeptoREADER microarray imaging system. Sequence specific immobilisation of such biologically important membrane proteins could lead to the development of a heterogeneous self‐sorting liposome array of GPCRs which would underpin a variety of future novel applications.     

Specific inhibition of DNA binding to nuclear scaffolds and histone H1 by distamycin. The role of oligo(dA).oligo(dT) tracts

Scaffold-associated regions (SARs) are A + T-rich sequences defined by their specific interaction with the nuclear scaffold. These sequences also direct highly specific binding to purified histone H1, and are characterized by the presence of oligo(dA).oligo(dT) tracts, which are a target for the drug distamyin, an antibiotic with a wide range of biological activities. The interaction of distamycin with SAR sequences results in the complete suppression of binding to either scaffolds or histone H1, suggesting that (dA.dT)n tracts play a direct role in mediating these specific interactions and that histone H1 and nuclear scaffold proteins may recognize a characteristic minor groove width or conformation. The effect of distamycin on these specific DNA-protein interactions in vitro suggests that binding of SARs to the nuclear scaffold and SAR-dependent nucleation of H1 assembly might be important targets of the drug in vivo.     

Binding of oligonucleotides to cell membranes at acidic pH.

Antisense oligodeoxynucleotides [oligo(dN)] have the ability to enter living cells and block the expression of specific genes. However, little is known about the mechanism of cellular uptake of oligo(dN). We have found that oligo(dN) can bind to the cell membranes of eukaryotic cells with much greater efficiency under acidic conditions (pH 4.0-4.5) than at neutral pH. The binding appears to be specific to poly nucleic acids since various sizes of oligo(dN), DNA and RNA, but not mononucleotides, compete for the binding. We have identified a 34 kDa membrane protein from T-cells, which binds to oligo(dT) cellulose at pH 4.5 and can be eluted at pH 7.5. This protein fraction blocked the binding of oligo(dN) to living T-cells in a competitive fashion. Our results suggest that eukaryotic cells have a receptor for oligo(dN) at acidic pH and that the 34 kDa dalton protein on the cell membrane may mediate such binding.     

Interactions of factors bound at two different sites in the 5'-upstream region of the adenovirus 12 E1A gene

A nuclear extract of Ehrlich ascites tumor cell contains factors binding to two distinct sites in the 5'-upstream region of the adenovirus 12 E1A gene. The gel shift assay was performed for characterization of the binding factors with oligo DNA probes containing sequences corresponding to these sites. The specific binding of a factor to one probe was enhanced when the other oligo DNA was present in excess in the binding reaction. Thus possibly, protein-protein interactions between factors may mutually prevent their binding to target sequences.     

The binding of rat uterine cytosol oestrogen receptors to oligodeoxythymidylate--cellulose. Its relationship to a stable form of receptor complex with separate ligand- and oligonucleotide-binding sites.

The interaction of rat uterine cytosol oestrogen-receptor complexes with the synthetic acceptor oligo(dT)--cellulose was studied. Differences in the stability of receptor complexes and their ability to bind to oligo(dT)--cellulose on storage at 4 degrees C or when exposed to increased temperatures indicated heterogeneity of steroid- and oligonucleotide-binding sites. Dilution, dialysis and (NH4)2SO4 precipitation increased the interaction of receptor complexes with oligo(dT)--cellulose (a step termed activation). This increase may be the result of the removal of low-molecular-weight cytosol components which inhibit receptor activation, dimerization to the 5 S form, which binds to oligo(dT)--cellulose, or interaction of 5 S receptor with the oligonucleotide. Cytosol oestradiol--receptor complexes exhibited biphasic dissociation kinetics. All these manipulations resulted in an increase in the proportion of the slow-dissociating component equivalent to the increase in receptor binding to oligo(dT)--cellulose. In contrast, addition of 10mM-sodium molybdate to cytosol decreased both oligo(dT)--cellulose binding and the proportion of receptor with slow dissociation kinetics. The inclusion of proteinase inhibitors did not affect interactions of receptor with oligo(dT)--cellulose nor the dissociation kinetics. These results suggest that oligo(dT)--cellulose binding may serve to quantify the proportion of cytosol receptor in an active form capable of nuclear interaction and to help to ascertain whether a receptor system is fully functional. This binding procedure could prove useful in the evaluation of oestrogen responsivity under normal and pathological conditions.     

The translational placement of nucleosome cores in vitro determines the access of the transacting factor suGF1 to DNA.

The sea urchin G-string binding factor (suGF1) is one of several proteins that bind sequence-specifically to oligo(dGxdC) motifs, frequently present upstream of eukaryotic genes. In this study we investigate the interaction of suGF1, purified to near homogeneity, with its oligo(dGxdC) binding site in a reconstituted nucleosome core in vitro. We show that the in vitro reconstitution of a 214 bp fragment containing a suGF1 binding site results in the appearance of five distinct nucleosome core species. These species contain the histone octamer in an identical rotational setting but in different translational frames. The resulting different nucleosomal locations of the suGF1 binding site in the five core species are shown to modulate the ability of suGF1 to bind to nucleosomal DNA, even though the rotational setting of the DNA in the nucleosome cores maximally exposes the suGF1 binding site. We propose that a direct protein-protein steric clash between suGF1 and the histone octamer is the most likely determinant in modulating the binding of suGF1 to its nucleosomally wrapped binding site. This result suggests that in vivo suGF1, like TBP, NF1 and heat shock factor, may require a complementary nucleosome disrupting activity or that suGF1 binds to free nascent replicated DNA prior to nucleosome deposition.     

Sequence content of oligo(uridylic acid)-containing messenger ribonucleic acid from HeLa cells

Oligo(uridylic acid)-containing [oligo(U+)] RNA was isolated from poly(adenylic acid)-containing [poly(A+)] mRNA from HeLa cells by using either formaldehyde pretreatment or poly(A) removal, both of which resulted in increased accessibility of oligo(U)-rich sequences to a poly(A)-agarose affinity column. In this report, we compared the sequence content of oligo(U+) RNA with that of molecules lacking oligo(U) [oligo(U-) RNA] by their relative hybridization to cDNA reverse-transcribed from poly(A+) mRNA and by comparison of their in vitro translation products synthesized in a rabbit reticulocyte lysate. Formaldehyde-modified poly(A+) RNA, treated to remove the formol adjuncts, was inactive as a template for in vitro protein synthesis; consequently, only depolyadenylated RNA, which retains its translatability, could be used in the translation studies. The hybridization kinetic experiments revealed that oligo(U+) RNA contained most of the sequence information present in oligo(U-) RNA but at a reduced level (ca. 25%), the majority of the oligo(U+) RNA sequences being poorly represented in the cDNA. This result was supported by one- and two-dimensional gel analysis of their in vitro translation products which showed that oligo(U+) RNA, although less effective as a template for translation than oligo(U-) RNA, coded for proteins, the most abundant of which were encoded by rare messages not highly represented in oligo(U-) RNA or the total poly(A+) RNA. Although some minor products were synthesized by both oligo(U+) and oligo(U-) RNA, at least 33 proteins were unique to or highly enriched in the pattern of products directed by oligo(U+) RNA.(ABSTRACT TRUNCATED AT 250 WORDS)     

Sequence-specific conjugates of oligo(2'-O-methylribonucleotides) and hairpin oligocarboxamide minor-groove binders: design, synthesis, and binding studies with double-stranded DNA

New conjugates of triplex-forming pyrimidine oligo(2'-O-methylribonucleotides) with one or two 'head-to-head' hairpin oligo(N-methylpyrrole carboxamide) minor-groove binders (MGBs) attached to the terminal phosphate of the oligonucleotides with a oligo(ethylene glycol) linker were synthesized. It was demonstrated that, under appropriate conditions, the conjugates form stable complexes with double-stranded DNA (dsDNA) similarly to triplex-forming oligo(deoxyribonucleotide) (TFO) conjugates containing 5-methylated cytosines. Kinetic and thermodynamic parameters of the complex formation were evaluated by gel-shift assay and thermal denaturation. Higher melting temperatures (Tm), faster complex formation, and lower dissociation constants (Kd) of the triple helices (6-7 nM) were observed for complexes of MGB-oligo(2'-O-methylribonucleotide) conjugates with the target dsDNA compared to the nonconjugated individual components. Interaction of MGB moieties with the HIV proviral DNA fragment was indicated by UV/VIS absorption changes at 320 nm in the melting curves. The introduction of thymidine via a 3',3'-type 'inverted' phosphodiester linkage at the 3'-end of oligo(2'-O-methylribonucleotide) conjugates (3'-protection) had no strong influence on triplex formation, but slightly affected complex stability. At pH 6.0, when one or two hairpin MGBs were attached to the oligonucleotide, both triplex formation and minor-groove binding played important roles in complex formation. When two 'head-to-head' oligo(N-methylpyrrole) ligands were attached to the same terminal phosphate of the oligonucleotide or the linker, binding was observed at pH >7.5 and at high temperatures (up to 74 degrees). However, under these conditions, binding was retained only by the MGB part of the conjugate.     

The selective isolation of the uterine oestradiol-receptor complex by binding to oligo(dT)-cellulose. The mediation of an essential activator in the transformation of cytosol receptor.

The [3H]oestradiol-receptor complex was selectively isolated from rat uterus cytosol by column chromatography on oligo(dT)-cellulose. Optimal conditions are described for the binding of the complex to oligo(dT)-cellulose, which is shown to be similar to its binding to DNA-cellulose. The cytosol complex has an apparent mol. wt. of 50,000-60,000 in high salt concentrations, as determined by Sephadex G-100 chromatography. This corresponds to the 4S cytoplasmic oestradiol receptor. In binding to oligo(dT)-cellulose the receptor is transformed into a form with an apparent mol.wt. of 100,000-120,000, corresponding to the 5S nuclear receptor complex. This transformation mimics the conversion in vivo of the cytoplasmic oestradiol receptor into the nuclear form. The binding of the complex to oligo(dT)-cellulose as a 5S nuclear form is unequivocally demonstrated to require the mediation of an activating present in the cytosol. The requirement for an activating factor is discussed in relation to reports that nuclear binding of the oestradiol-receptor complex is not dictated solely by the availability of the cytoplasmic oestradiol receptor.