The interaction between bovine serum albumin and surfactants.

1. Potassium n-decyl phosphate binds exothermically to bovine serum albumin at pH 7.0 to form a specific complex containing approx. 60 phosphate anions. 2. The formation of the complex is accompanied by changes in the u.v. difference spectrum of the protein. 3. At higher phosphate concentrations (above 0.4mM) surfactant molecules continue to be bound, and the protein undergoes a gross change in conformation. 4. n-Dodecyltri-methylammonium bromide binds endothermically to bovine serum albumin at pH7.0 but the extent of binding for a given free surfactant concentration is less than for the phosphate surfactant. 5. Binding is accompanied by a small change in the specific viscosity and by changes in the u.v. difference spectrum of the protein. 6. It is suggested that over the surfactant concentration ranges studied n-decyl phosphate ions first bind to the C-terminal part of the protein and then to the more compact N-terminal part whereas n-dodecyltrimethylammonium ions bind only to the C-terminal part of bovine serum albumin.     

The interaction between cholesterol and human serum albumin

The interaction between cholesterol and Human Serum Albumin (HSA) was studied by fluorescence technique. Addition of cholesterol causes decreasing of the fluorescence intensity of HSA and the mechanism can be attributed to static quenching. Both negative enthalpy and entropy change indicate this binding was an "enthalpy-driven" reaction. The number of binding site and distance between residues and ligands were also calculated: n = 0.98, r = 3.84 nm. UV-vis spectra showed HSA molecules unfolded to some extent and the hydrophobicity was decreased in the presence of cholesterol.     

Analysis of interaction between dendriplexes and bovine serum albumin

Dendrimers are new nanotechnological carriers for gene delivery. Short oligodeoxynucleotides (ODNs) are a new class of antisense therapy drugs for cancer and infectious or metabolic diseases. The interactions between short oligodeoxynucleotides (GEM91, CTCTCGCACCCATCTCTCTCCTTCT; SREV, TCGTCGCTGTCTCCGCTTCTTCCTGCCA; unlabeled or fluorescein-labeled), novel water-soluble carbosilane dendrimers, and bovine serum albumin were studied by fluorescence and gel electrophoresis. The molar ratios of the dendrimer/ODN dendriplexes ranged from 4 to 7. The efficiency of formation and stability of the dendriplexes depended on electrostatic interactions between the dendrimer and the ODNs. Dendriplex formation significantly decreased the interactions between ODNs and albumin. Thus, the formation of dendriplexes between carbosilane dendrimers and ODNs may improve ODN delivery.     

Studies on the interaction between tetraphenylporphyrin compounds and bovine serum albumin.

The interaction of three porphyrin compounds with bovine serum albumin (BSA) was examined by fluorescence emission spectra at the excitation wavelength 280 nm and in UV-Vis absorption spectra. Through fluorescence quenching experiments, it was confirmed that the combination of three porphyrin compounds with BSA was a single static quenching process. The binding constant K(A), the thermodynamic parameters enthalpy change (DeltaH(0)), Gibbs free energy change (DeltaG(0)) and entropy change (DeltaS(0)) were obtained. It was found that hydrophobic interaction played a main role in tetraphenylporphyrin (TPP) or tetraparacholophenylporphyrin (TClPP) binding to BSA, while tetraparamethoxyphenylporphyrin (TMEOPP) mainly based on van der Waals' force. According to F?ster energy transfer, the separate distance r, the energy transfer efficiency E and F?ster radium R(0) were calculated. The results obtained from the above experiments showed that three porphyrin compounds were tightly bound to BSA.     

Spectroscopic study of the interaction between lycopene and bovine serum albumin

The interaction of lycopene with bovine serum albumin (BSA) in aqueous solution was studied by fluorescence quenching, three‐dimensional fluorescence and circular dichroism spectroscopy. The data showed that the fluorescence of BSA was quenched by lycopene at different temperatures through a dynamic mechanism. The evaluation of three‐dimensional fluorescence spectra revealed a conformational modification of BSA induced by coupling with lycopene and an increase in protein diameter as a consequence of the ligand–protein interaction. Moreover, the information obtained from evaluation of the effect of lycopene on BSA conformation by circular dichroism strongly supported the existence of a slight unfolding of BSA induced by coupling to lycopene. Copyright © 2012 John Wiley & Sons, Ltd.     

Determination of the specific interaction between palmatine and bovine serum albumin

The binding of palmatine to bovine serum albumin (BSA) was studied under physiological conditions (pH = 7.40) by molecular spectroscopic approach. It was proved that the fluorescence quenching of BSA by palmatine is a result of the formation of palmatine–BSA complex. Binding parameters were determined using the modified Stern–Volmer equation and Scatchard equation, to measure the specific binding between palmatine and BSA. The thermodynamic parameters calculated, ∆G°, ∆H° and ∆S° indicate that the electrostatic interactions play a major role in the palmatine–BSA association. Site marker competitive displacement experiments demonstrated that palmatine binds with specific affinity to site II (subdomain IIIA) of BSA. Furthermore, the specific binding distance r (3.36 nm) was obtained according to fluorescence resonance energy transfer. The results of synchronous fluorescence spectra and UV–Visible absorption spectra show that the conformation of bovine serum albumin has been changed.     

Spectroscopic studies of interaction between CuO nanoparticles and bovine serum albumin

Recently, the great interests in manufacturing and application of metal oxide nanoparticles in commercial and industrial products have led to focus on the potential impact of these particles on biomacromolecules. In the present study, the interaction of copper oxide (CuO) nanoparticles with bovine serum albumin (BSA) was studied by spectroscopic techniques. The zeta potential value for BSA and CuO nanoparticles with average diameter of around 50 nm at concentration of 10 μM in the deionized (DI) water were ?5.8 and ?22.5 mV, respectively. Circular dichroism studies did not show any changes in the content of secondary structure of the protein after CuO nanoparticles interaction. Fluorescence data revealed that the fluorescence quenching of BSA by CuO nanoparticles was the result of the formed complex of CuO nanoparticles – BSA. Binding constants and other thermodynamic parameters were determined at three different temperatures. The hydrogen bond interactions are the predominant intermolecular forces to stabilize the CuO nanoparticle – BSA complex. This study provides important insight into the interaction of CuO nanoparticles with proteins, which may be of importance for further application of these nanoparticles in biomedical applications.     

The investigation of the interaction between orientin and bovine serum albumin by spectroscopic analysis

In this paper, the interaction between orientin and bovine serum albumin (BSA) was examined using fluorescence and absorbance spectroscopy. The analysis of the quenching mechanism was done using Stern–Volmer plots which exhibit upward (positive) deviation. A linear response to orientin was shown in the concentration range between 3 and 50 μM. The experimental results showed the presence of a static quenching process between orientin and BSA. The thermodynamic parameters ΔH, ΔS and ΔG were also calculated and suggested that the hydrophobic and electrostatic interactions played an important role in the interaction between orientin and BSA. Furthermore, the distances between BSA and orientin were determined according to Förster non‐radiation energy transfer theory. In addition, the results of the synchronous fluorescence obtained indicated that the binding of orientin with BSA could affect conformation in BSA. Copyright © 2013 John Wiley & Sons, Ltd.     

The investigation of the interaction between ribavirin and bovine serum albumin by spectroscopic methods

The interaction between ribavirin (RIB) with bovine serum albumin (BSA) has been investigated by fluorescence quenching technique in combination with UV–vis absorption and circular dichroism (CD) spectroscopies under the simulative physiological conditions. The quenching of BSA fluorescence by RIB was found to be a result of the formation of RIB–BSA complex. The binding constants and the number of binding sites were calculated at three different temperatures. The values of thermodynamic parameters ?H, ?S, ?G at different temperatures indicate that hydrophobic and hydrogen bonds played important roles for RIB–BSA association. The binding distance r was obtained according to the theory of FÖrster’s non–radiation energy transfer. The displacement experiments was performed for identifying the location of the binding site of RIB on BSA. The effects of common ions on the binding constant of RIB and BSA were also examined. Finally, the conformational changes of BSA in the presence of RIB were also analyzed by CD spectra and Synchronous fluorescence spectra.     

Electrostatic interaction and complex formation between gum arabic and bovine serum albumin

The interaction of gum arabic (GA) and bovine serum albumin (BSA) has been investigated through turbidity and light scattering intensity measurements and by the use of dynamic light scattering, laser Doppler velocimetry, and isothermal titration calorimetry. It has been shown that GA and BSA can form soluble and insoluble complexes depending on the solution pH and the mixing ratio and is a function of the net charge on the complex. Soluble complexes were obtained when the electrophoretic mobility was greater than ±1. 5 μm s(-1) V(-1) cm(-1). Changes in the value of the isoelectric point of the complexes with mixing ratio and isothermal titration calorimetric data indicated that complexes formed at pHs 3 and 4 consisted of ～60 BSA molecules for every GA molecule, while at pH 5 there were ～10 BSA molecules per GA molecule. Calorimetric studies also indicated that the interaction occurred in two stages at both pH 3 and pH 4, but that the nature of the interaction at these two pH values was significantly different. This was attributed to differences in the relative magnitude of the positive and negative charges on the BSA and GA, respectively, and possibly due to changes in the BSA conformation. The fact that there is an interaction at pH 5, which is above the isoelectric point of the BSA, is due to the interaction of the carboxylate groups on the GA with positive patches on the BSA or to the charge regulation of the protein-polysaccharide system brought about by changes in dissociation equilibria. Complexation is reduced as the ionic strength of the solvent increases and is prevented at a NaCl concentration of 120 mM.     

The binding characteristics of the interaction between 3-(2-cyanoethyl) cytosine and human serum albumin

The binding characteristics of the interaction between 3-(2-cyanoethyl) cytosine (CECT) and human serum albumin (HSA) were investigated using fluorescence, UV absorption spectroscopic and molecular modeling techniques under simulative physiological conditions. The intrinsic fluorescence intensity of HSA was decreased with the addition of CECT. The fluorescence data handled by Stern–Volmer equation proved that the quenching mechanism of the interaction between CECT and HSA was a static quenching procedure. The binding constants evaluated utilizing the Lineweaver–Burk equation at 17, 27 and 37?°C, were 2.340?×?10⁴, 2.093?×?10⁴ and 1.899?×?10⁴?L?mol^?1, respectively. The thermodynamic parameters were calculated according to van’t Hoff equations. Negative enthalpy (ΔH) and positive entropy (ΔS) values indicated that both hydrogen bond and hydrophobic force played a major role in the binding process of CECT to HSA, which was consistent with the results of the molecular modeling study. In addition, the effect of other ions on the binding constant of CECT-HSA was examined.     

Characterization of the interaction between 2′-deoxyuridine and human serum albumin

The binding of 2′-deoxyuridine to human serum albumin (HSA) was investigated by fluorescence spectroscopy in combination with molecular modeling under simulation of physiological conditions. The quenching mechanism was suggested to be static according to the fluorescence measurement. The thermodynamic parameters: enthalpy change (ΔH) and entropy change (ΔS) were calculated to be −18.87 kJ/mol and 24.00 J/(mol K) according to the Vant’Hoff equation. These data suggest that hydrophobic interactions are the predominant intermolecular forces stabilizing the complex. Experimental results are in agreement with the results obtained by molecular modeling study. In addition, the effects of common ions on the binding constants were also studied at room temperature.     

Spectroscopic analysis of the binding interaction between tinidazole and bovine serum albumin (BSA)

The interaction between bovine serum albumin (BSA) and tinidazole (Tindamax; 1) in aqueous solution was investigated in detail by means of UV/VIS and fluorescence spectroscopy, as well as through resonance light-scattering (RLS) spectroscopy. The apparent binding constant and number of binding sites were determined at three different temperatures, as well as the average binding distances between 1 and the nearest amino acid residue(s) of BSA, as analyzed by means of F?rster's theory of non-radiation energy transfer. Compound 1 was found to quench the inner fluorescence of BSA by forming a tight 1:1 aggregate, based on both static quenching and non-radiation energy transfer. The entropy change upon complexation was positive, and the enthalpy change was negative, indicating that the observed spontaneous binding is mainly driven by electrostatic interactions.     

Characterization of the interaction between human serum albumin and morin

The interaction of morin with human serum albumin (HSA) has been investigated by using fluorescence, UV absorption and Fourier transform infrared spectroscopic approaches for the first time. Fluorescence data revealed the presence of a specific binding site on HSA for morin, and the binding affinity was 1.13+/-0.11x10(-5) L Mol(-1) in the physiological condition. The intrinsic fluorescence of morin was conspicuously enhanced in the presence of HSA due to excited-state proton transfer. The binding ability of morin to protein decreased with the increase of the buffer pH from 6.4 to 8.4, which signified that the level of protonation of the hydroxyl groups played an important role during the drug-protein binding process. From the UV absorption spectra of morin in various pH medium, the dissociation behaviors of the hydroxyl groups on the drug molecule were assigned. The second derivative UV absorption spectra of morin after interacting with HSA were used to elucidate the binding mode of morin to protein. The obvious red shift of the UV absorption band I of morin upon binding to HSA further confirmed the formation of HSA-morin complex, and this property was also utilized to estimate the binding constant. The interaction between morin and HSA induced an obvious reduction of the protein alpha-helix and beta-sheet structures.     

The effect of Cu2+ on interaction between flavonoids with different C-ring substituents and bovine serum albumin: structure-affinity relationship aspect

Four flavonoids quercetin (QU), luteolin (LU), taxifolin (TA) and (+)-catechin (CA) with the same A- and B-rings but different C-ring substituents have been investigated for their binding to bovine serum albumin (BSA) in the absence and presence of Cu²⁺ by means of various spectroscopic methods such as fluorescence, UV-visible and circular dichroism (CD). The results indicated that hydroxyl group at 3-position increased the binding affinities between flavonoids and BSA. The values of the binding affinities were in the order: QU > CA > TA > LU. The presence of Cu²⁺ affected the interactions of flavonoids with BSA significantly. The binding affinities of QU and TA for BSA were decreased about 6.7% and 13.2%. However, the binding affinities of LU and CA for BSA were increased about 43.0% and 20.7%. The formation of Cu²⁺-flavonoid complex and steric hindrance together influenced the binding affinities of QU, LU and TA for BSA, while the conformational change of BSA may be the main reason for the increased binding affinity of CA for BSA. However, the quenching mechanism for QU, LU, TA and CA to BSA was based on static quenching combined with non-radiative energy transfer irrespective of the absence or presence of Cu²⁺. The UV-visible results showed the change in BSA conformation and the formation of flavonoid-Cu²⁺ complex. The CD results also explained the conformational changes of BSA on binding with flavonoids.