Intracellular regulation of human ClC‐5 by adenine nucleotides

ClC-5, an endosomal Cl⁻/H⁺ antiporter that is mutated in Dent disease, is essential for endosomal acidification and re-uptake of small molecular weight proteins in the renal proximal tubule. Eukaryotic chloride channels (CLCs) contain two cytoplasmic CBS domains, motifs present in different proteins, the function of which is still poorly understood. Structural studies have shown that ClC-5 can bind to ATP at the interface between the CBS domains, but so far the potential functional consequences of nucleotide binding to ClC-5 have not been investigated. Here, we show that the direct application of ATP, ADP and AMP in inside-out patch experiments potentiates the current mediated by ClC-5 with similar affinities. The nucleotides increase the probability of ClC-5 to be in an active, transporting state. The residues Tyr 617 and Asp 727, but not Ser 618, are crucial for the potentiation. These results provide a mechanistic and structural framework for the interpretation of nucleotide regulation of a CLC transporter.     

Substrate-induced conformational changes in Escherichia coli arginyl-tRNA synthetase observed by 19F NMR spectroscopy

The 19F nuclear magnetic resonance (NMR) spectra of 4-fluorotryptophan (4-F-Trp)-labeled Escherichia coli arginyl-tRNA synthetase (ArgRS) show that there are distinct conformational changes in the catalytic core and tRNA anticodon stem and loop-binding domain of the enzyme, when arginine and tRNA(Arg) are added to the unliganded enzyme. We have assigned five fluorine resonances of 4-F-Trp residues (162, 172, 228, 349 and 446) in the spectrum of the fluorinated enzyme by site-directed mutagenesis. The local conformational changes of E. coli ArgRS induced by its substrates observed herein by 19F NMR are similar to those of crystalline yeast homologous enzyme.     

Steady-state gradient in calcium ion activity across the intercellular bridges connecting oocytes and nurse cells in Hyalophora cecropia

Intracellular activities of K⁺, H⁺, Mg²⁺, Ca²⁺, and Cl^?, measured with ion selective microelectrodes in the oocyte and the nurse cells in ovarian follicles of Hyalophora cecropia, indicated that a Ca²⁺ current is a key component of the electrical potential that is maintained across the intercellular bridges connecting these two cells. In vitellogenic follicles, Ca²⁺ activity averaged 650 nM in the oocyte and 190 nM in the nurse cells, whereas activities of the other ions studied differed between these cells by no more than 6%. Incubation in 200 μM ammonium vanadate caused a reversal of electrical potential from 8.3 mV, nurse cell negative, to 3.0 mV, oocyte negative, and at the same time the Ca²⁺ gradient was reversed: activities rose to an average 3.0 μM in the nurse cells and 1.6 μM in the oocyte, whereas transbridge ratios of the other cations remained at 0–3%. In immature follicles that had not yet initiated their transbridge potentials, Ca²⁺ activities averaged ～? 2 μM in both oocyte and nurse cells. The results suggest that vitellogenic follicles possess a vanadatesensitive Ca²⁺ extrusion mechanism that is more powerful in the nurse cells than in the oocyte. © 1994 Wiley-Liss, Inc.     

Nitric oxide donors inhibit the acetylcholine-induced Cl− current in identified Onchidium neurons

The present study was undertaken to assess the effects of sodium nitroprusside (SNP) and diethylamine NO(C₂H₅)₂N[N(O)NO]⁻Na⁺ (DEA/NO), NO donors, on an acetylcholine (ACh)-induced Cl⁻ current in identified Onchidium neurons using voltage-clamp and pressure ejection techniques. Bath-applied SNP (10 μM) and DEA/NO (5–10 μM) reduced the ACh-induced Cl⁻ current in the neurons without affecting the resting membrane conductance and holding current. The suppressing effects of NO donors were concentration-dependent and completely reversible. Pretreatment with 1H-[1,2,4]oxadiazolo-[4,3-a]quinoxalin-1-one (1 μM), a specific inhibitor of NO-stimulated guanylate cyclase, and hemoglobin (50 μM), a nitric oxide scavenger, decreased the SNP-induced inhibition of the ACh-induced current. Intracellular injection of guanosine 3′,5′-cyclic monophosphate (cGMP) or bath-application of 3-isobutyl-1-methylxanthine (50 μM), a non-specific phosphodiesterase inhibitor, inhibited the ACh-induced current, mimicking the effect of NO donors. These results suggest that SNP and DEA/NO inhibit the ACh-induced Cl⁻ current and that this effect is mediated by an increase in intracellular cGMP. © 1998 John Wiley & Sons, Inc. J Neurobiol 35: 388–394, 1998     

A conformational study in solution of pro-somatostatin fragments by NMR and computational methods

The results of a conformational study by nuclear magnetic spectroscopy and computational methods on a series of point-mutated synthetic peptides, containing 14 amino acid residues and mimicking the region containing the Arg-Lys dibasic cleavage site of pro-somatostatin, have confirmed the possible role of a well defined secondary structure in the recognition phenomenon by processing enzymes. The importance of the residues located near the Arg-Lys dibasic site in the C-terminal region of the pro-hormone for the cleavage of the precursor into somatostatin-14 has been confirmed. The present structural analysis indicates the occurrence of two β-turns in the 4–7 and 11–14 regions, flanking the cleavage site, for all the peptides recognized as substrates by the processing enzyme. Interestingly, in the point-mutated analogue not processed by the enzyme and containing the replacement of proline by alanine in position 5 the first β-turn is displaced by one residue and involves the Ala⁵-Arg⁸ segment. This observation may explain the lack of recognition by the maturation enzyme. © 1998 European Peptide Society and John Wiley & Sons, Ltd.     

Conversion of the 2 Cl−/1 H+ antiporter ClC‐5 in a NO3−/H+ antiporter by a single point mutation

Several members of the CLC family are secondary active anion/proton exchangers, and not passive chloride channels. Among the exchangers, the endosomal ClC-5 protein that is mutated in Dent''s disease shows an extreme outward rectification that precludes a precise determination of its transport stoichiometry from measurements of the reversal potential. We developed a novel imaging method to determine the absolute proton flux in Xenopus oocytes from the extracellular proton gradient. We determined a transport stoichiometry of 2 Cl⁻/1 H⁺. Nitrate uncoupled proton transport but mutating the highly conserved serine 168 to proline, as found in the plant NO₃⁻/H⁺ antiporter atClCa, led to coupled NO₃⁻/H⁺ exchange. Among several amino acids tested at position 168, S168P was unique in mediating highly coupled NO₃⁻/H⁺ exchange. We further found that ClC-5 is strongly stimulated by intracellular protons in an allosteric manner with an apparent pK of ∼7.2. A 2:1 stoichiometry appears to be a general property of CLC anion/proton exchangers. Serine 168 has an important function in determining anionic specificity of the exchange mechanism.     

Determination of conformational transition rates in the trp promoter by 1H NMR rotating-frame T1 and cross-relaxation rate measurements

Rotating-frame relaxation measurements have been used in conjunction with spin-spin relaxation rate constants to investigate a conformational transition previously observed in the -10 region of the trp promoter d(CGTACTAGTTAACTAGTACG)2 (Lefèvre, Lane, Jardetzky 1987). The transition is localised to the sub-sequence TAAC, and is in fast exchange on the chemical shift time-scale. The rate constant for the exchange process has been determined from measurements of the rotating-frame relaxation rate constant as a function of the spin-lock field strength, and is approximately 5000 s^–1 at 30 °C. Measurements have also been made as a function of temperature and in two different magnetic fields: the results are fully consistent with those expected for the exchange contribution in a two-site system. A similar transition has been observed in d(GTGATTGACAATTA).d(CACTAACTGTTAAT), which contains the –35 region of the trp promoter. This has been investigated in the same way, and has been found to undergo exchange at a faster rate under comparable conditions. In addition, the cross-relaxation rate constants for Ade C2H-Ade C2H pairs have been measured as a function of temperature, and these indicate that certain internuclear distances in YAAY subsequences increase with increasing temperature. These changes in distance are consistent with a flattening of propellor twist of the AT base-pairs. The occurrence of conformational transitions in YAAY subsequences depends on the flanking sequence.Correspondence to: A. N. Lane     

Regulation of interleukin‐1β by interferon‐γ is species specific,limited by suppressor of cytokine signalling 1 and influences interleukin‐17 production

Reports describing the effect of interferon‐γ (IFNγ) on interleukin‐1β (IL‐1β) production are conflicting. We resolve this controversy by showing that IFNγ potentiates IL‐1β release from human cells, but transiently inhibits the production of IL‐1β from mouse cells. Release from this inhibition is dependent on suppressor of cytokine signalling 1. IL‐1β and Th17 cells are pathogenic in mouse models for autoimmune disease, which use Mycobacterium tuberculosis (MTB), in which IFNγ and IFNβ are anti‐inflammatory. We observed that these cytokines suppress IL‐1β production in response to MTB, resulting in a reduced number of IL‐17‐producing cells. In human cells, IFNγ increased IL‐1β production, and this might explain why IFNγ is detrimental for multiple sclerosis. In mice, IFNγ decreased IL‐1β and subsequently IL‐17, indicating that the adaptive immune response can provide a systemic, but transient, signal to limit inflammation.     

1H NMR conformational study on n-terminal nonapeptide sequences of HIV-1 Tat protein: a contribution to structure–activity relationships

On the basis of our recent results, the N-terminal sequence of HIV-1 Tat protein as a natural competitive inhibitor of dipeptidyl peptidase IV (DP IV) is supposed to interact directly with the active site of DP IV hence mediating its immunosuppressive effects via specific DP IV interactions. Of special interest is the finding that amino acid substitutions of the Tat(1–9) peptide (MDPVDPNIE) in position 5 with S-isoleucine and in position 6 with S-leucine led to peptides with strongly reduced inhibitory activity suggesting differences in the solution conformation of the three analogues. Therefore, ¹H NMR techniques in conjunction with molecular modelling have been used here to determine the solution structure of Tat(1–9), I⁵-Tat(1–9) and L⁶-Tat(1–9) and to examine the influence of amino acid exchanges on structural features of these peptides. The defined structures revealed differences in the conformations what might be the reason for different interactions of these Tat(1–9) analogues with certain amino acids of the active site of DP IV. © 1998 European Peptide Society and John Wiley & Sons, Ltd.     

Net efflux of Cl− during hypotonic turgor regulation in a brackish water alga Lamprothamnium*

Abstract. Net efflux of Cl^? was measured potentiometrically (Ag/AgCl electrode) during turgor regulation which was induced by hypotonic treatment (hypotonic turgor regulation) in the alga Lamprothamnium succinctum. The efflux of Cl^? reached the peak value (11 μmol m ^?2s^?1) several minutes after the hypotonic treatment was started and then declined. The efflux of Cl^? and inhibition of the cytoplasmic streaming [reflection of an increase in cytoplasmic concentration of free Ca²⁺([Ca²⁺]_c)] were blocked under a low external concentration of Ca²⁺ ([Ca²⁺]_e) (0·01 mol m^?3) and resumed after raising [Ca²⁺]_e to the normal value (3·9 mol m^?3). The decrease in cell-osmotic pressure upon hypotonic treatment was inhibited by lowering either turgor pressure or [Ca^2h]_e. The inhibition was reflected in decreases of both the efflux of Cl^? and the membrane conductance. Recovery of the cytoplasmic streaming from the inhibition was also accelerated by the same treatments. It is concluded that an increase in turgor pressure is continuously sensed by the cells and that continuous presence of external Ca²⁺ is necessary for the hypotonic turgor regulation.     

Changes in Chloride Fluxes and Cytosolic pH Induced by Abscisic Acid in Elodea densa Leaves

The effects of ABA on intracellular pH, net H⁺ extrusion, Cl^? fluxes and E_m values were studied in Elodea densa leaves, and the possible relationships between the ABA-induced changes of cytosolic pH and of Cl^? and H⁺ fluxes were investigated. Cytosolic and vacuolar pH were calculated by the weak acid and weak base distribution method. The data show that, also in this material (a water plant without stomata), ABA induces a decrease in both net H⁺ extrusion and intracellular pH, and strongly inhibits Cl^? efflux. No significant effect of ABA is detectable on E_m values, either at short or long intervals in the presence or absence of K⁺. Cl^? efflux is apparently independent of the activity of the plasmalemma H⁺ pump and of the E_m values. Conversely, it strongly depends on the value of cytosolic pH, a larger efflux occurring for the lower pH values both in the presence and in the absence of ABA. These results indicate that the ABA-induced cytosolic acidification cannot be the cause but, possibly, a consequence of the decrease in Cl^? efflux, and are consistent with the hypothesis of a primary role of ABA in regulating Cl^? efflux, presumably by directly affecting a class of Cl^?-permeable channels.     

Electrospun LiFe1−yMnyPO4/C Nanofiber Composites as Self‐Supporting Cathodes in Li‐Ion Batteries

LiFe_1?yMn_yPO₄/C nanofiber composites are applied as cathode materials in Li‐ion batteries and their electrochemical properties are explored. Nanofiber meshes are synthesized via electrospinning of commercially available precursors (LiOH·H₂O, FeSO₄·7H₂O, MnSO₄·H₂O, H₃PO₄, and polyvinylpyrrolidone). Nanofibers calcined at 850 °C under Ar/H₂ (95/5 vol%) atmosphere are directly used as self‐supporting electrodes in Swagelok half cells without the need for any conductive additive or polymer binder. The morphology, phase, and chemical composition of as‐prepared and heat‐treated samples are analyzed by means of X‐ray powder diffraction, thermogravimetric analysis, and electron and scanning microscopy techniques. Brunauer–Emmett–Teller gas adsorption–desorption measurements show a high specific surface area (111m² g^?1) for LiFe_0.5Mn_0.5PO₄. The influence of different Fe/Mn ratios on the morphology, electrical, and electrochemical performances are analyzed.     

Inter-domain motions of the N-domain of the KdpFABC complex, a P-type ATPase, are not driven by ATP-induced conformational changes

P-type ATPases are involved in the active transport of ions across biological membranes. The KdpFABC complex (P-type ATPase) of Escherichia coli is a high-affinity K+ uptake system that operates only when the cell experiences osmotic stress or K+ limitation. Here, we present the solution structure of the nucleotide binding domain of KdpB (backbone RMSD 0.17 A) and a model of the AMP-PNP binding mode based on intermolecular distance restraints. The calculated AMP-PNP binding mode shows the purine ring of the nucleotide to be "clipped" into the binding pocket via a pi-pi-interaction to F377 on one side and a cation-pi-interaction to K395 on the other. This binding mechanism seems to be conserved in all P-type ATPases, except the heavy metal transporting ATPases (type IB). Thus, we conclude that the Kdp-ATPase (currently type IA) is misgrouped and has more similarities to type III ATPases. The KdpB N-domain is the smallest and simplest known for a P-type ATPase, and represents a minimal example of this functional unit. No evidence of significant conformational changes was observed within the N-domain upon nucleotide binding, thus ruling out a role for ATP-induced conformational changes in the reaction cycle.     

Substrates induce conformational changes in human anion exchanger 1 (hAE1) as observed by fluorescence resonance energy transfer

The one-for-one exchange of Cl(-) and HCO(3)(-) ions is catalyzed by human erythrocyte anion exchanger 1 (hAE1) through a ping-pong mechanism whereby the protein exists in two main conformations, with the single anion-binding site exposed at either the cytoplasmic (inner) side (E(i)) or the extracellular side (E(o)), with interconversion between the two states being possible only after anion binding. Steady-state and time-resolved resonance energy transfer (FRET) techniques were used to determine the distance of the binding site for diTBA (bis-(1,3-diethylthiobarbituric acid)trimethine oxonol), a high affinity fluorescent oxonol inhibitor of hAE1, from a benchmark site (probably Lys-430) labeled by external fluorescein maleimide (FM). Using red cell ghost membranes, energy transfer distances were measured in media containing different anions between FM as the donor, covalently attached to one monomer, and diTBA as the acceptor, reversibly bound to the adjacent monomer of a hAE1 dimer. Energy transfer increased significantly in chloride or bicarbonate buffers relative to conditions where no transportable anions were present, that is, in citrate buffer. These differences in transfer efficiencies were interpreted in light of the conformational distributions of hAE1 in various buffers and the possible effects of diTBA itself on the distribution. The analysis indicates that the diTBA binding site comes closer to the FM site by approximately 7 A in chloride buffer as compared to that in citrate (or equivalent changes in diTBA orientation occur) because of the effects of anion binding. This provides the first direct physical evidence for structural changes in hAE1 induced by substrates.     

Hypoxic stress‐induced changes in adrenergic function: role of HIF1α

Sustaining epinephrine‐elicited behavioral and physiological responses during stress requires replenishment of epinephrine stores. Egr‐1 and Sp1 contribute by stimulating the gene encoding the epinephrine‐synthesizing enzyme, phenylethanolamine N‐methyltransferase (PNMT), as shown for immobilization stress in rats in adrenal medulla and for hypoxic stress in adrenal medulla‐derived PC12 cells. Hypoxia (5% O₂) also activates hypoxia inducible factor (HIF) 1α, increasing mRNA, nuclear protein and nuclear protein/hypoxia response element binding complex formation. Hypoxia and HIF1α over‐expression also elevate PNMT promoter‐driven luciferase activity in PC12 cells. Hypoxia may be limiting as HIF1α over‐expression increases luciferase expression to no greater extent than oxygen reduction alone. HIF1α inducers CoCl₂ or deferoxamine elevate luciferase as well. PC12 cells harboring a HIF1α expression construct show markedly higher levels of Egr‐1 and Sp1 mRNA and nuclear protein and PNMT mRNA and cytoplasmic protein. Inactivation of Egr‐1 and Sp1 binding sites in the proximal ?893 bp of PNMT promoter precludes HIF1α stimulation while a potential hypoxia response element (?282 bp) in the promoter shows weak HIF1α affinity at best. These findings are the first to suggest that hypoxia activates the proximal rat PNMT promoter primarily via HIF1α induction of Egr‐1 and Sp1 rather than by co‐activation by Egr‐1, Sp1 and HIF1α. In addition, the rise in HIF1α protein leading to Egr‐1 and Sp1 stimulation of PNMT appears to include HIF1α gene activation rather than simply prevention of HIF1α proteolytic degradation.