Split‐Cre recombinase effectively monitors protein–protein interactions in living bacteria

The ability of Cre recombinase to excise genetic material has been used extensively for genome engineering in prokaryotic and eukaryotic cells. Recently, split‐Cre fragments have been described that advance control of recombinase activity in mammalian cells. However, whether these fragments can be utilized for monitoring protein‐protein interactions has not been reported. In this work, we developed a protein‐fragment complementation assay (PCA) based on split‐Cre for monitoring and engineering pairwise protein interactions in living Escherichia coli cells. This required creation of a dual‐fluorescent reporter plasmid that permits visualization of reconstituted Cre recombinase activity by switching from red to green in the presence of an interacting protein pair. The resulting split‐Cre PCA faithfully links cell fluorescence with differences in binding affinity, thereby allowing the facile isolation of high‐affinity binders based on phenotype. Given the resolution of its activity and sensitivity to interactions, our system may prove a viable option for poorly expressed or weakly interacting protein pairs that evade detection in other PCA formats. Based on these findings, we anticipate that our split‐Cre PCA will become a highly complementary and useful new addition to the protein‐protein interaction toolbox.     

Protein fragment complementation in M.HhaI DNA methyltransferase

The 5mC DNA methyltransferase M.HhaI can be split into two individually inactive N- and C-terminal fragments that together can form an active enzyme in vivo capable of efficiently methylating DNA. This active fragment pair was identified by creating libraries of M.HhaI gene fragment pairs and then selecting for the pairs that code for an active 5mC methyltransferase. The site of bisection for successful protein fragment complementation in M.HhaI was in the variable region near the target recognition domain between motif VIII and TRD. This same region is the location of bifurcation in the naturally split 5mC methyltransferase M.AquI, the location for circular permutation in M.BssHII, and the location for previously engineered split versions of M.BspRI.     

Sequence‐specific interactions of minor groove binders with restriction fragments of cDNAs for H tau 40 protein and MAP kinase 2. A qualitative and quantitative footprinting study

A series of DNA minor groove binders comprising netropsin, distamycin, the bisquaternary ammonium heterocycles SN 6999 and SN 6570, cis‐diammine platinum(II)‐bridged bis‐netropsin, cis‐diammine platinum(II)‐bridged bis‐distamycin and bis‐glycine‐linked bis‐distamycin were investigated for sequence‐specific interactions. The oligonucleotides used were the 154 base pair HindIII–RsaI restriction fragment of cDNA of h tau 40 protein and the 113 base pair NcoI–PvuII restriction fragment of cDNA of MAP kinase 2. Both proteins are believed to be involved in the pathology of Alzheimer's disease. For all these ligands, binding sites were localised at positions 1134–1139 (5′AATCTT3′), 1152–1156 (5′ATATT3′) and 1178–1194 (5′TTTCAATCTTTTTATTT3′) for the former and 720–726 (5′TATTCTT3′), 751–771 (5′AATTGTATAATAAATTTAAAA3′) and 781–785 (5′TATTT3′) for the latter. The AT‐preference of ligand binding was obvious and footprint titration experiments were applied to estimate binding constants (K_a) for each individual binding site mentioned above. The binding strength decreases in the order netropsin > distamycin > SN 6999 ≈ SN 6570>platinum‐bridged netropsin or distamycin≈bis‐glycine‐bridged distamycin and was found independently of the binding sites examined. GC‐base pairs interspersed in short AT‐tracts reduced the K_a‐values by as much as two orders of magnitudes. The dependence of extended bidentate as well as of monodentate binding of netropsin and distamycin derivatives on the length of AT‐stretches has been discussed. Copyright © 1999 John Wiley & Sons, Ltd.     

Structure‐guided design of a reversible fluorogenic reporter of protein‐protein interactions

A reversible green fluorogenic protein‐fragment complementation assay was developed based on the crystal structure of UnaG, a recently discovered fluorescent protein. In living mammalian cells, the nonfluorescent fragments complemented and rapidly became fluorescent upon rapamycin‐induced FKBP and Frb protein interaction, and lost fluorescence when the protein interaction was inhibited. This reversible fluorogenic reporter, named uPPI [UnaG‐based protein‐protein interaction (PPI) reporter], uses bilirubin (BR) as the chromophore and requires no exogenous cofactor. BR is an endogenous molecule in mammalian cells and is not fluorescent by itself. uPPI may have many potential applications in visualizing spatiotemporal dynamics of PPIs.     

A new location to split Cre recombinase for protein fragment complementation

We have previously described a recombinase‐mediated gene stacking system in which the Cre recombinase is used to remove lox‐site flanked DNA no longer needed after each round of Bxb1 integrase‐mediated site‐specific integration. The Cre recombinase can be conveniently introduced by hybridization with a cre‐expressing plant. However, maintaining an efficient cre‐expressing line over many generations can be a problem, as high production of this DNA‐binding protein might interfere with normal chromosome activities. To counter this selection against high Cre activity, we considered a split‐cre approach, in which Cre activity is reconstituted after separate parts of Cre are brought into the same genome by hybridization. To insure that the recombinase‐mediated gene stacking system retains its freedom to operate, we tested for new locations to split Cre into complementing fragments. In this study, we describe testing four new locations for splitting the Cre recombinase for protein fragment complementation and show that the two fragments of Cre split between Lys244 and Asn245 can reconstitute activity that is comparable to that of wild‐type Cre.     

Combining protein complementation assays with resonance energy transfer to detect multipartner protein complexes in living cells

A variety of fluorescent proteins with different spectral properties have been created by mutating green fluorescent protein. When these proteins are split in two, neither fragment is fluorescent per se, nor can a fluorescent protein be reconstituted by co-expressing the complementary N- and C-terminal fragments. However, when these fragments are genetically fused to proteins that associate with each other in cellulo, the N- and C-terminal fragments of the fluorescent protein are brought together and can reconstitute a fluorescent protein. A similar protein complementation assay (PCA) can be performed with two complementary fragments of various luciferase isoforms. This makes these assays useful tools for detecting the association of two proteins in living cells. Bioluminescence resonance energy transfer (BRET) or fluorescence resonance energy transfer (FRET) occurs when energy from, respectively, a luminescent or fluorescent donor protein is non-radiatively transferred to a fluorescent acceptor protein. This transfer of energy can only occur if the proteins are within 100 Å of each other. Thus, BRET and FRET are also useful tools for detecting the association of two proteins in living cells. By combining different protein fragment complementation assays (PCA) with BRET or FRET it is possible to demonstrate that three or more proteins are simultaneous parts of the same protein complex in living cells. As an example of the utility of this approach, we show that as many as four different proteins are simultaneously associated as part of a G protein-coupled receptor signalling complex.     

Design,selection, and characterization of a split chorismate mutase

Split proteins are versatile tools for detecting protein–protein interactions and studying protein folding. Here, we report a new, particularly small split enzyme, engineered from a thermostable chorismate mutase (CM). Upon dissecting the helical‐bundle CM from Methanococcus jannaschii into a short N‐terminal helix and a 3‐helix segment and attaching an antiparallel leucine zipper dimerization domain to the individual fragments, we obtained a weakly active heterodimeric mutase. Using combinatorial mutagenesis and in vivo selection, we optimized the short linker sequences connecting the leucine zipper to the enzyme domain. One of the selected CMs was characterized in detail. It spontaneously assembles from the separately inactive fragments and exhibits wild‐type like CM activity. Owing to the availability of a well characterized selection system, the simple 4‐helix bundle topology, and the small size of the N‐terminal helix, the heterodimeric CM could be a valuable scaffold for enzyme engineering efforts and as a split sensor for specifically oriented protein–protein interactions.     

High-affinity fragment complementation of a fibronectin type III domain and its application to stability enhancement

The tenth fibronectin type III (FN3) domain of human fibronectin (FNfn10), a prototype of the ubiquitous FN3 domain, is a small, monomeric beta-sandwich protein. In this study, we have bisected FNfn10 in each loop to generate a total of six fragment pairs. We found that fragment pairs bisected at multiple loops of FNfn10 show complementation in vivo as tested with a yeast two-hybrid system. The dissociation constant of these fragment pairs determined in vitro were as low as 3 nM, resulting in one of the tightest fragment complementation systems reported so far. Furthermore, we show that the affinity of fragment complementation is correlated with the stability of the uncut parent protein. Exploring this correlation, we screened a yeast two-hybrid library of one fragment and identified mutations that suppress the effect of a destabilizing mutation in the other fragment. One of the identified mutations significantly increased the stability of the uncut wild-type protein, proving that fragment complementation can be used as a novel strategy for the selection of proteins with enhanced stability.     

Monitoring of conformational change in maltose binding protein using split green fluorescent protein

In this study, we describe a novel method for the detection of conformational changes in proteins, which is predicated on the reconstitution of split green fluorescent protein (GFP). We employed fluorescence complementation assays for the monitoring of the conformationally altered proteins. In particular, we used maltose binding protein (MBP) as a model protein, as MBP undergoes a characteristic hinge-twist movement upon substrate binding. The common feature of this approach is that GFP, as a reporter protein, splits into two non-fluorescent fragments, which are genetically fused to the N- and C-termini of MBP. Upon binding to maltose, the chromophores move closer together, resulting in the generation of fluorescence. This split GFP method also involves the reconstitution of GFP, which is determined via observations of the degree to which fluorescence intensity is restored. As a result, reconstituted GFP has been observed to generate fluorescence upon maltose binding in vitro, thereby allowing for the direct detection of changes in fluorescence intensity in response to maltose, in a concentration- and time-dependent fashion. Our findings showed that the fluorescence complementation assay can be used to monitor the conformational alterations of a target protein, and this ability may prove useful in a number of scientific and medical applications.     

Simultaneous visualization of two protein complexes in a single plant cell using multicolor fluorescence complementation analysis

Bimolecular fluorescence complementation (BiFC) is an approach used to analyze protein–protein interaction in vivo, in which non-fluorescent N-terminal and C-terminal fragments of a fluorescent protein are reconstituted to emit fluorescence only when they are brought together by interaction of two proteins to fuse both fragments. A method for simultaneous visualization of two protein complexes by multicolor BiFC with fragments from green fluorescent protein (GFP) and its variants such as cyan and yellow fluorescent proteins (CFP and YFP) was recently reported in animal cells. In this paper we describe a new strategy for simultaneous visualization of two protein complexes in plant cells using the multicolor BiFC with fragments from CFP, GFP, YFP and a red fluorescent protein variant (DsRed-Monomer). We identified nine different BiFC complexes using fragments of CFP, GFP and YFP, and one BiFC complex using fragments of DsRed-Monomer. Fluorescence complementation did not occur by combinations between fragments of GFP variants and DsRed-Monomer. Based on these findings, we achieved simultaneous visualization of two protein complexes in a single plant cell using two colored fluorescent complementation pairs (cyan/red, green/red or yellow/red).     

Electrostatic interactions in the reconstitution of an SH2 domain from constituent peptide fragments

Fragment complementation has been used to delineate the essential recognition elements for stable folding in Src homology 2 (SH2) domains by using NMR spectroscopy, alanine scanning, and surface plasmon resonance. The unfolded 9-kD and 5-kD peptide fragments formed by limited proteolytic digestion of the N-terminal SH2 domain from the p85alpha subunit of phosphatidylinositol 3'-kinase fold into an active native-like structure on interaction with one another. The corresponding 5-kD fragment of the homologous Src protein, however, was not capable of structurally complementing the p85 9-kD fragment, indicating that fragment complementation among these SH2 domains is sensitive to the sequence differences between the Src and p85 domains. Partial complementation and folding activity could be recovered with hybrid sequences of these SH2 domains. Complete alanine scanning of the 5-kD p85 fragment was used to identify the sequence recognition elements required for complex formation. The alanine substitutions in the p85 5-kD fragment that abolished binding affinity with the cognate 9-kD fragment correlate well with highly conserved residues among SH2 domains that are either integrally involved in core packing or found at the interface between fragments. Surprisingly, however, mutation of a nonconserved surface-exposed aspartic acid to alanine was found to have a significant effect on complementation. A single additional mutation of arginine to aspartic acid allowed for recovery of native structure and increased the thermal stability of the designed Src-p85 chimera by 18 degrees C. This modification appears to relieve an unfavorable surface electrostatic interaction, demonstrating the importance of surface charge interactions in protein stability.     

Detection of membrane protein–protein interaction in planta based on dual‐intein‐coupled tripartite split‐GFP association

Despite the great interest in identifying protein–protein interactions (PPIs) in biological systems, only a few attempts have been made at large‐scale PPI screening in planta. Unlike biochemical assays, bimolecular fluorescence complementation allows visualization of transient and weak PPIs in vivo at subcellular resolution. However, when the non‐fluorescent fragments are highly expressed, spontaneous and irreversible self‐assembly of the split halves can easily generate false positives. The recently developed tripartite split‐GFP system was shown to be a reliable PPI reporter in mammalian and yeast cells. In this study, we adapted this methodology, in combination with the β‐estradiol‐inducible expression cassette, for the detection of membrane PPIs in planta. Using a transient expression assay by agroinfiltration of Nicotiana benthamiana leaves, we demonstrate the utility of the tripartite split‐GFP association in plant cells and affirm that the tripartite split‐GFP system yields no spurious background signal even with abundant fusion proteins readily accessible to the compartments of interaction. By validating a few of the Arabidopsis PPIs, including the membrane PPIs implicated in phosphate homeostasis, we proved the fidelity of this assay for detection of PPIs in various cellular compartments in planta. Moreover, the technique combining the tripartite split‐GFP association and dual‐intein‐mediated cleavage of polyprotein precursor is feasible in stably transformed Arabidopsis plants. Our results provide a proof‐of‐concept implementation of the tripartite split‐GFP system as a potential tool for membrane PPI screens in planta.     

Controllable protein cleavages through intein fragment complementation

Intein‐based protein cleavages, if carried out in a controllable way, can be useful tools of recombinant protein purification, ligation, and cyclization. However, existing methods using contiguous inteins were often complicated by spontaneous cleavages, which could severely reduce the yield of the desired protein product. Here we demonstrate a new method of controllable cleavages without any spontaneous cleavage, using an artificial S1 split‐intein consisting of an 11‐aa N‐intein (I_N) and a 144‐aa C‐intein (I_C). In a C‐cleavage design, the I_C sequence was embedded in a recombinant precursor protein, and the small I_N was used as a synthetic peptide to trigger a cleavage at the C‐terminus of I_C. In an N‐cleavage design, the short I_N sequence was embedded in a recombinant precursor protein, and the separately produced I_C protein was used to catalyze a cleavage at the N‐terminus of I_N. These N‐ and C‐cleavages showed >95% efficiency, and both successfully avoided any spontaneous cleavage during expression and purification of the precursor proteins. The N‐cleavage design also revealed an unexpected and interesting structural flexibility of the I_C protein. These findings significantly expand the effectiveness of intein‐based protein cleavages, and they also reveal important insights of intein structural flexibility and fragment complementation.     

Detection of protein-protein interactions in plants using bimolecular fluorescence complementation

Protein function is often mediated via formation of stable or transient complexes. Here we report the determination of protein-protein interactions in plants using bimolecular fluorescence complementation (BiFC). The yellow fluorescent protein (YFP) was split into two non-overlapping N-terminal (YN) and C-terminal (YC) fragments. Each fragment was cloned in-frame to a gene of interest, enabling expression of fusion proteins. To demonstrate the feasibility of BiFC in plants, two pairs of interacting proteins were utilized: (i) the alpha and beta subunits of the Arabidopsis protein farnesyltransferase (PFT), and (ii) the polycomb proteins, FERTILIZATION-INDEPENDENT ENDOSPERM (FIE) and MEDEA (MEA). Members of each protein pair were transiently co-expressed in leaf epidermal cells of Nicotiana benthamiana or Arabidopsis. Reconstitution of a fluorescing YFP chromophore occurred only when the inquest proteins interacted. No fluorescence was detected following co-expression of free non-fused YN and YC or non-interacting protein pairs. Yellow fluorescence was detected in the cytoplasm of cells that expressed PFT alpha and beta subunits, or in nuclei and cytoplasm of cells that expressed FIE and MEA. In vivo measurements of fluorescence spectra emitted from reconstituted YFPs were identical to that of a non-split YFP, confirming reconstitution of the chromophore. Expression of the inquest proteins was verified by immunoblot analysis using monoclonal antibodies directed against tags within the hybrid proteins. In addition, protein interactions were confirmed by immunoprecipitations. These results demonstrate that plant BiFC is a simple, reliable and relatively fast method for determining protein-protein interactions in plants.     

Improved protein splicing using embedded split inteins

Naturally split inteins mediate a traceless protein ligation process known as protein trans‐splicing (PTS). Although frequently used in protein engineering applications, the efficiency of PTS can be reduced by the tendency of some split intein fusion constructs to aggregate; a consequence of the fragmented nature of the split intein itself or the polypeptide to which it is fused (the extein). Here, we report a strategy to help address this liability. This involves embedding the split intein within a protein sequence designed to stabilize either the intein fragment itself or the appended extein. We expect this approach to increase the scope of PTS‐based protein engineering efforts.     

Ligand promiscuity through the eyes of the aminoglycoside N3 acetyltransferase IIa

Aminoglycoside‐modifying enzymes (AGMEs) are expressed in many pathogenic bacteria and cause resistance to aminoglycoside (AG) antibiotics. Remarkably, the substrate promiscuity of AGMEs is quite variable. The molecular basis for such ligand promiscuity is largely unknown as there is not an obvious link between amino acid sequence or structure and the antibiotic profiles of AGMEs. To address this issue, this article presents the first kinetic and thermodynamic characterization of one of the least promiscuous AGMEs, the AG N3 acetyltransferase‐IIa (AAC‐IIa) and its comparison to two highly promiscuous AGMEs, the AG N3‐acetyltransferase‐IIIb (AAC‐IIIb) and the AG phosphotransferase(3′)‐IIIa (APH). Despite having similar antibiotic selectivities, AAC‐IIIb and APH catalyze different reactions and share no homology to one another. AAC‐IIa and AAC‐IIIb catalyze the same reaction and are very similar in both amino acid sequence and structure. However, they demonstrate strong differences in their substrate profiles and kinetic and thermodynamic properties. AAC‐IIa and APH are also polar opposites in terms of ligand promiscuity but share no sequence or apparent structural homology. However, they both are highly dynamic and may even contain disordered segments and both adopt well‐defined conformations when AGs are bound. Contrary to this AAC‐IIIb maintains a well‐defined structure even in apo form. Data presented herein suggest that the antibiotic promiscuity of AGMEs may be determined neither by the flexibility of the protein nor the size of the active site cavity alone but strongly modulated or controlled by the effects of the cosubstrate on the dynamic and thermodynamic properties of the enzyme.     

Significant reduction of BiFC non‐specific assembly facilitates in planta assessment of heterotrimeric G‐protein interactors

Protein networks and signaling cascades are key mechanisms for intra‐ and intercellular signal transduction. Identifying the interacting partners of a protein can provide vital clues regarding its physiological role. The bimolecular fluorescence complementation (BiFC) assay has become a routine tool for in vivo analysis of protein–protein interactions and their subcellular location. Although the BiFC system has improved since its inception, the available options for in planta analysis are still subject to very low signal‐to‐noise ratios, and a systematic comparison of BiFC confounding background signals has been lacking. Background signals can obscure weak interactions, provide false positives, and decrease confidence in true positives. To overcome these problems, we performed an extensive in planta analysis of published BiFC fragments used in metazoa and plants, and then developed an optimized single vector BiFC system which utilizes monomeric Venus (mVenus) split at residue 210, and contains an integrated mTurquoise2 marker to precisely identify transformed cells in order to distinguish true negatives. Here we provide our streamlined d ouble O RF e xpression (pDOE) BiFC system, and show that our advance in BiFC methodology functions even with an internally fused mVenus210 fragment. We illustrate the efficacy of the system by providing direct visualization of Arabidopsis MLO1 interacting with a calmodulin‐like (CML) protein, and by showing that heterotrimeric G‐protein subunits Gα (GPA1) and Gβ (AGB1) interact in plant cells. We further demonstrate that GPA1 and AGB1 each physically interact with PLDα1 in planta, and that mutation of the so‐called PLDα1 ‘DRY’ motif abolishes both of these interactions.     

Studies of dynamic protein-protein interactions in bacteria using renilla luciferase complementation are undermined by nonspecific enzyme inhibition

The luciferase protein fragment complementation assay is a powerful tool for studying protein-protein interactions. Two inactive fragments of luciferase are genetically fused to interacting proteins, and when these two proteins interact, the luciferase fragments can reversibly associate and reconstitute enzyme activity. Though this technology has been used extensively in live eukaryotic cells, split luciferase complementation has not yet been applied to studies of dynamic protein-protein interactions in live bacteria. As proof of concept and to develop a new tool for studies of bacterial chemotaxis, fragments of Renilla luciferase (Rluc) were fused to the chemotaxis-associated response regulator CheY3 and its phosphatase CheZ in the enteric pathogen Vibrio cholerae. Luciferase activity was dependent on the presence of both CheY3 and CheZ fusion proteins, demonstrating the specificity of the assay. Furthermore, enzyme activity was markedly reduced in V. cholerae chemotaxis mutants, suggesting that this approach can measure defects in chemotactic signaling. However, attempts to measure changes in dynamic CheY3-CheZ interactions in response to various chemoeffectors were undermined by nonspecific inhibition of the full-length luciferase. These observations reveal an unexpected limitation of split Rluc complementation that may have implications for existing data and highlight the need for great caution when evaluating small molecule effects on dynamic protein-protein interactions using the split luciferase technology.     

Deciphering interactions of the aminoglycoside phosphotransferase(3′)‐IIIa with its ligands

Aminoglycoside phosphotransferase(3′)‐IIIa (APH) is the enzyme with broadest substrate range among the phosphotransferases that cause resistance to aminoglycoside antibiotics. In this study, the thermodynamic characterization of interactions of APH with its ligands are done by determining dissociation constants of enzyme–substrate complexes using electron paramagnetic resonance and fluorescence spectroscopy. Metal binding studies showed that three divalent cations bind to the apo‐enzyme with low affinity. In the presence of AMPPCP, binding of the divalent cations occurs with 7‐to‐37‐fold higher affinity to three additional sites dependent on the presence and absence of different aminoglycosides. Surprisingly, when both ligands, AMPPCP and aminoglycoside, are present, the number of high affinity metal binding sites is reduced to two with a 2‐fold increase in binding affinity. The presence of divalent cations, with or without aminoglycoside present, shows only a small effect (<3‐fold) on binding affinity of the nucleotide to the enzyme. The presence of metal–nucleotide, but not nucleotide alone, increases the binding affinity of aminoglycosides to APH. Replacement of magnesium (II) with manganese (II) lowered the catalytic rates significantly while affecting the substrate selectivity of the enzyme such that the aminoglycosides with 2′‐NH₂ become better substrates (higher V_max) than those with 2′‐OH. © 2009 Wiley Periodicals, Inc. Biopolymers 91: 801–809, 2009. This article was originally published online as an accepted preprint. The “Published Online” date corresponds to the preprint version. You can request a copy of the preprint by emailing the Biopolymers editorial office at biopolymers@wiley.com