共查询到20条相似文献,搜索用时 328 毫秒
1.
2.
3.
4.
Riboflavin significantly enhanced the efficacy of simulated solar disinfection (SODIS) at 150 watts per square meter (W m−2) against a variety of microorganisms, including Escherichia coli, Fusarium solani, Candida albicans, and Acanthamoeba polyphaga trophozoites (>3 to 4 log10 after 2 to 6 h; P < 0.001). With A. polyphaga cysts, the kill (3.5 log10 after 6 h) was obtained only in the presence of riboflavin and 250 W m−2 irradiance.Solar disinfection (SODIS) is an established and proven technique for the generation of safer drinking water (11). Water is collected into transparent plastic polyethylene terephthalate (PET) bottles and placed in direct sunlight for 6 to 8 h prior to consumption (14). The application of SODIS has been shown to be a simple and cost-effective method for reducing the incidence of gastrointestinal infection in communities where potable water is not available (2-4). Under laboratory conditions using simulated sunlight, SODIS has been shown to inactivate pathogenic bacteria, fungi, viruses, and protozoa (6, 12, 15). Although SODIS is not fully understood, it is believed to achieve microbial killing through a combination of DNA-damaging effects of ultraviolet (UV) radiation and thermal inactivation from solar heating (21).The combination of UVA radiation and riboflavin (vitamin B2) has recently been reported to have therapeutic application in the treatment of bacterial and fungal ocular pathogens (13, 17) and has also been proposed as a method for decontaminating donor blood products prior to transfusion (1). In the present study, we report that the addition of riboflavin significantly enhances the disinfectant efficacy of simulated SODIS against bacterial, fungal, and protozoan pathogens.Chemicals and media were obtained from Sigma (Dorset, United Kingdom), Oxoid (Basingstoke, United Kingdom), and BD (Oxford, United Kingdom). Pseudomonas aeruginosa (ATCC 9027), Staphylococcus aureus (ATCC 6538), Bacillus subtilis (ATCC 6633), Candida albicans (ATCC 10231), and Fusarium solani (ATCC 36031) were obtained from ATCC (through LGC Standards, United Kingdom). Escherichia coli (JM101) was obtained in house, and the Legionella pneumophila strain used was a recent environmental isolate.B. subtilis spores were produced from culture on a previously published defined sporulation medium (19). L. pneumophila was grown on buffered charcoal-yeast extract agar (5). All other bacteria were cultured on tryptone soy agar, and C. albicans was cultured on Sabouraud dextrose agar as described previously (9). Fusarium solani was cultured on potato dextrose agar, and conidia were prepared as reported previously (7). Acanthamoeba polyphaga (Ros) was isolated from an unpublished keratitis case at Moorfields Eye Hospital, London, United Kingdom, in 1991. Trophozoites were maintained and cysts prepared as described previously (8, 18).Assays were conducted in transparent 12-well tissue culture microtiter plates with UV-transparent lids (Helena Biosciences, United Kingdom). Test organisms (1 × 106/ml) were suspended in 3 ml of one-quarter-strength Ringer''s solution or natural freshwater (as pretreated water from a reservoir in United Kingdom) with or without riboflavin (250 μM). The plates were exposed to simulated sunlight at an optical output irradiance of 150 watts per square meter (W m−2) delivered from an HPR125 W quartz mercury arc lamp (Philips, Guildford, United Kingdom). Optical irradiances were measured using a calibrated broadband optical power meter (Melles Griot, Netherlands). Test plates were maintained at 30°C by partial submersion in a water bath.At timed intervals for bacteria and fungi, the aliquots were plated out by using a WASP spiral plater and colonies subsequently counted by using a ProtoCOL automated colony counter (Don Whitley, West Yorkshire, United Kingdom). Acanthamoeba trophozoite and cyst viabilities were determined as described previously (6). Statistical analysis was performed using a one-way analysis of variance (ANOVA) of data from triplicate experiments via the InStat statistical software package (GraphPad, La Jolla, CA).The efficacies of simulated sunlight at an optical output irradiance of 150 W m−2 alone (SODIS) and in the presence of 250 μM riboflavin (SODIS-R) against the test organisms are shown in Table Table1.1. With the exception of B. subtilis spores and A. polyphaga cysts, SODIS-R resulted in a significant increase in microbial killing compared to SODIS alone (P < 0.001). In most instances, SODIS-R achieved total inactivation by 2 h, compared to 6 h for SODIS alone (Table (Table1).1). For F. solani, C. albicans, ands A. polyphaga trophozoites, only SODIS-R achieved a complete organism kill after 4 to 6 h (P < 0.001). All control experiments in which the experiments were protected from the light source showed no reduction in organism viability over the time course (results not shown).
Open in a separate windowaConditions are at an intensity of 150 W m−2 unless otherwise indicated.bThe values reported are means ± standard errors of the means from triplicate experiments.cAdditional experiments for this condition were performed using natural freshwater.The highly resistant A. polyphaga cysts and B. subtilis spores were unaffected by SODIS or SODIS-R at an optical irradiance of 150 W m−2. However, a significant reduction in cyst viability was observed at 6 h when the optical irradiance was increased to 250 W m−2 for SODIS-R only (P < 0.001; Table Table1).1). For spores, a kill was obtained only at 320 W m−2 after 6-h exposure, and no difference between SODIS and SODIS-R was observed (Table (Table1).1). Previously, we reported a >2-log kill at 6 h for Acanthamoeba cysts by using SODIS at the higher optical irradiance of 850 W m−2, compared to the 0.1-log10 kill observed here using the lower intensity of 250 W m−2 or the 3.5-log10 kill with SODIS-R.Inactivation experiments performed with Acanthamoeba cysts and trophozoites suspended in natural freshwater gave results comparable to those obtained with Ringer''s solution (P > 0.05; Table Table1).1). However, it is acknowledged that the findings of this study are based on laboratory-grade water and freshwater and that differences in water quality through changes in turbidity, pH, and mineral composition may significantly affect the performance of SODIS (20). Accordingly, further studies are indicated to evaluate the enhanced efficacy of SODIS-R by using natural waters of varying composition in the areas where SODIS is to be employed.Previous studies with SODIS under laboratory conditions have employed lamps delivering an optical irradiance of 850 W m−2 to reflect typical natural sunlight conditions (6, 11, 12, 15, 16). Here, we used an optical irradiance of 150 to 320 W m−2 to obtain slower organism inactivation and, hence, determine the potential enhancing effect of riboflavin on SODIS.In conclusion, this study has shown that the addition of riboflavin significantly enhances the efficacy of simulated SODIS against a range of microorganisms. The precise mechanism by which photoactivated riboflavin enhances antimicrobial activity is unknown, but studies have indicated that the process may be due, in part, to the generation of singlet oxygen, H2O2, superoxide, and hydroxyl free radicals (10). Further studies are warranted to assess the potential benefits from riboflavin-enhanced SODIS in reducing the incidence of gastrointestinal infection in communities where potable water is not available. 相似文献
TABLE 1.
Efficacies of simulated SODIS for 6 h alone and with 250 μM riboflavin (SODIS-R)Organism | Conditiona | Log10 reduction in viability at indicated h of exposureb | |||
---|---|---|---|---|---|
1 | 2 | 4 | 6 | ||
E. coli | SODIS | 0.0 ± 0.0 | 0.2 ± 0.1 | 5.7 ± 0.0 | 5.7 ± 0.0 |
SODIS-R | 1.1 ± 0.0 | 5.7 ± 0.0 | 5.7 ± 0.0 | 5.7 ± 0.0 | |
L. pneumophila | SODIS | 0.7 ± 0.2 | 1.3 ± 0.3 | 4.8 ± 0.2 | 4.8 ± 0.2 |
SODIS-R | 4.4 ± 0.0 | 4.4 ± 0.0 | 4.4 ± 0.0 | 4.4 ± 0.0 | |
P. aeruginosa | SODIS | 0.7 ± 0.0 | 1.8 ± 0.0 | 4.9 ± 0.0 | 4.9 ± 0.0 |
SODIS-R | 5.0 ± 0.0 | 5.0 ± 0.0 | 5.0 ± 0.0 | 5.0 ± 0.0 | |
S. aureus | SODIS | 0.0 ± 0.0 | 0.0 ± 0.0 | 6.2 ± 0.0 | 6.2 ± 0.0 |
SODIS-R | 0.2 ± 0.1 | 6.3 ± 0.0 | 6.3 ± 0.0 | 6.3 ± 0.0 | |
C. albicans | SODIS | 0.2 ± 0.0 | 0.4 ± 0.1 | 0.5 ± 0.1 | 1.0 ± 0.1 |
SODIS-R | 0.1 ± 0.0 | 0.7 ± 0.1 | 5.3 ± 0.0 | 5.3 ± 0.0 | |
F. solani conidia | SODIS | 0.2 ± 0.1 | 0.3 ± 0.0 | 0.2 ± 0.0 | 0.7 ± 0.1 |
SODIS-R | 0.3 ± 0.1 | 0.8 ± 0.1 | 1.3 ± 0.1 | 4.4 ± 0.0 | |
B. subtilis spores | SODIS | 0.3 ± 0.0 | 0.2 ± 0.0 | 0.0 ± 0.0 | 0.1 ± 0.0 |
SODIS-R | 0.1 ± 0.1 | 0.2 ± 0.1 | 0.3 ± 0.3 | 0.1 ± 0.0 | |
SODIS (250 W m−2) | 0.1 ± 0.0 | 0.1 ± 0.1 | 0.1 ± 0.1 | 0.0 ± 0.0 | |
SODIS-R (250 W m−2) | 0.0 ± 0.0 | 0.0 ± 0.0 | 0.2 ± 0.0 | 0.4 ± 0.0 | |
SODIS (320 W m−2) | 0.1 ± 0.1 | 0.1 ± 0.0 | 0.0 ± 0.1 | 4.3 ± 0.0 | |
SODIS-R (320 W m−2) | 0.1 ± 0.0 | 0.1 ± 0.1 | 0.9 ± 0.0 | 4.3 ± 0.0 | |
A. polyphaga trophozoites | SODIS | 0.4 ± 0.2 | 0.6 ± 0.1 | 0.6 ± 0.2 | 0.4 ± 0.1 |
SODIS-R | 0.3 ± 0.1 | 1.3 ± 0.1 | 2.3 ± 0.4 | 3.1 ± 0.2 | |
SODIS, naturalc | 0.3 ± 0.1 | 0.4 ± 0.1 | 0.5 ± 0.2 | 0.3 ± 0.2 | |
SODIS-R, naturalc | 0.2 ± 0.1 | 1.0 ± 0.2 | 2.2 ± 0.3 | 2.9 ± 0.3 | |
A. polyphaga cysts | SODIS | 0.4 ± 0.1 | 0.1 ± 0.3 | 0.3 ± 0.1 | 0.4 ± 0.2 |
SODIS-R | 0.4 ± 0.2 | 0.3 ± 0.2 | 0.5 ± 0.1 | 0.8 ± 0.3 | |
SODIS (250 W m−2) | 0.0 ± 0.1 | 0.2 ± 0.3 | 0.2 ± 0.1 | 0.1 ± 0.2 | |
SODIS-R (250 W m−2) | 0.4 ± 0.2 | 0.3 ± 0.2 | 0.8 ± 0.1 | 3.5 ± 0.3 | |
SODIS (250 W m−2), naturalc | 0.0 ± 0.3 | 0.2 ± 0.1 | 0.1 ± 0.1 | 0.2 ± 0.1 | |
SODIS-R (250 W m−2), naturalc | 0.1 ± 0.1 | 0.2 ± 0.2 | 0.6 ± 0.1 | 3.4 ± 0.2 |
5.
6.
7.
Hassan Rashidi Muhammad T. Akhtar Frank van der Kooy Robert Verpoorte Wouter A. Duetz 《Applied and environmental microbiology》2009,75(22):7135-7141
The microbial biotransformation of Δ9-tetrahydrocannabinol was investigated using a collection of 206 alkane-degrading strains. Fifteen percent of these strains, mainly gram-positive strains from the genera Rhodococcus, Mycobacterium, Gordonia, and Dietzia, yielded more-polar derivatives. Eight derivatives were produced on a mg scale, isolated, and purified, and their chemical structures were elucidated with the use of liquid chromatography-mass spectrometry, 1H-nuclear magnetic resonance (1H-NMR), and two-dimensional NMR (1H-1H correlation spectroscopy and heteronuclear multiple bond coherence). All eight biotransformation products possessed modified alkyl chains, with hydroxy, carboxy, and ester functionalities. In a number of strains, β-oxidation of the initially formed C5 carboxylic acid led to the formation of a carboxylic acid lacking two methylene groups.Δ9-Tetrahydrocannabinol (Δ9-THC) is the decarboxylated product of the corresponding Δ9-THC acid, the major cannabinoid present in the cannabis plant (Cannabis sativa L., Cannabaceae). This compound is officially registered as a drug for the stimulation of appetite and antiemesis in patients under chemotherapy and human immunodeficiency virus therapy regimens. Other biological activities ascribed to this compound include lowering intraocular pressure in glaucoma, acting as an analgesic for muscle relaxation, immunosuppression, sedation, bronchodilation, and neuroprotection (11).Δ9-THC and many of its derivatives are highly lipophilic and poorly water soluble. Calculations of the n-octanol/water partition coefficient (Ko/w) of Δ9-THC at neutral pH vary between 6,000, using the shake flask method (15), and 9.44 × 106, by reverse-phase high-performance liquid chromatography estimation (19). The poor water solubility and high lipophilicity of cannabinoids cause their absorption across the lipid bilayer membranes and fast elimination from blood circulation. In terms of the “Lipinsky rule of 5” (14), the high lipophilicity of cannabinoids hinders the further development of these compounds into large-scale pharmaceutical products.To generate more water-soluble analogues, one can either apply de novo chemical synthesis (as, e.g., in reference 16) or modify naturally occurring cannabinoids, e.g., by introducing hydroxy, carbonyl, or carboxy groups. Chemical hydroxylation of compounds such as cannabinoids is difficult (Δ9-THC is easily converted into Δ8-THC under mild conditions), and therefore microbial biotransformation of cannabinoids is potentially a more fruitful option to achieve this goal.So far, studies on biotransformation of Δ9-THC were mainly focused on fungi, which led to the formation of a number of mono- and dihydroxylated derivatives. Previous reports on the biotransformation of cannabinoids by various microorganisms are summarized in Table Table1.1. The aim of the present study was to test whether bacterial strains are capable of transforming Δ9-THC into new products (with potentially better pharmaceutical characteristics) at a higher yield and specificity than previously found for fungal strains. For this purpose, we have chosen to use a collection of alkane-degrading strains, since it was shown in previous studies (8, 18, 20) that alkane oxygenases often display a broad substrate range. Production of novel cannabinoid derivatives that might have interesting pharmacological activities was another objective of this project.
Open in a separate windowaCBD, cannabidiol; CBN, cannabinol. 相似文献
TABLE 1.
Previous biotransformation experiments conducted using various microorganisms to transform cannabinoidsCannabinoid(s)a | Microorganism(s) used | No. of transformed products | Reference |
---|---|---|---|
Δ9-THC | Cunninghamella blakesleeana | 6 | 3 |
Δ8-THC | Pellicularia filamentosa | 4 | 21 |
Δ8-THC | Streptomyces lavendulae | 4 | 21 |
Δ6a,10a-THC | 400 cultures (soil microorganisms) | Various | 1 |
Nabilone | 400 cultures (soil microorganisms) | Various | 1 |
Δ6a,10a-THC | 358 cultures containing bacteria, actinomycetes, and molds | 3 | 10 |
Δ9-THC, Δ8-THC, CBD, CBN | Syncephalastrum racemosum, Mycobacterium rhodochrous | Various | 17 |
Δ9-THC | Chaetomium globosum | 3 | 7 |
Δ9-THC | 51 fungal strains | 8 | 4 |
Nabilone | Microbes | Various | 2 |
Δ9-THC | Fusarium nivale, Gibberella fujikuroi, and Thamnidium elegans | 8 | 5 |
8.
9.
10.
Yongchao Li Diana C. Irwin David B. Wilson 《Applied and environmental microbiology》2010,76(8):2582-2588
Amino acid modifications of the Thermobifida fusca Cel9A-68 catalytic domain or carbohydrate binding module 3c (CBM3c) were combined to create enzymes with changed amino acids in both domains. Bacterial crystalline cellulose (BC) and swollen cellulose (SWC) assays of the expressed and purified enzymes showed that three combinations resulted in 150% and 200% increased activity, respectively, and also increased synergistic activity with other cellulases. Several other combinations resulted in drastically lowered activity, giving insight into the need for a balance between the binding in the catalytic cleft on either side of the cleavage site, as well as coordination between binding affinity for the catalytic domain and CBM3c. The same combinations of amino acid variants in the whole enzyme, Cel9A-90, did not increase BC or SWC activity but did have higher filter paper (FP) activity at 12% digestion.Cellulases catalyze the breakdown of cellulose into simple sugars that can be fermented to ethanol. The large amount of natural cellulose available is an exciting potential source of fuels and chemicals. However, the detailed molecular mechanisms of crystalline cellulose degradation by glycoside hydrolases are still not well understood and their low efficiency is a major barrier to cellulosic ethanol production.Thermobifida fusca is a filamentous soil bacterium that grows at 50°C in defined medium and can utilize cellulose as its sole carbon source. It is a major degrader of plant cell walls in heated organic materials such as compost piles and rotting hay and produces a set of enzymes that includes six different cellulases, three xylanases, a xyloglucanase, and two CBM33 binding proteins (12). Among them are three endocellulases, Cel9B, Cel6A, and Cel5A (7, 8), two exocellulases, Cel48A and Cel6B (6, 19), and a processive endocellulase, Cel9A (5, 7).T. fusca Cel9A-90 (Uniprot and P26221) is a multidomain enzyme consisting of a family 9 catalytic domain (CD) rigidly attached by a short linker to a family 3c cellulose binding module (CBM3c), followed by a fibronectin III-like domain and a family 2 CBM (CBM2). Cel9A-68 consists of the family 9 CD and CBM3c. The crystal structure of this species (Fig. YP_290232(Fig.1)1) was determined by X-ray crystallography at 1.9 Å resolution (Protein Data Bank [PDB] code 4tf4) (15). Previous work has shown that E424 is the catalytic acid and D58 is the catalytic base (11, 20). H125 and Y206 were shown to play an important role in activity by forming a hydrogen bonding network with D58, an important supporting residue, D55, and Glc(−1)O1. Several enzymes with amino acid changes in subsites Glc(−1) to Glc(−4) had less than 20% activity on bacterial cellulose (BC) and markedly reduced processivity. It was proposed that these modifications disturb the coordination between product release and the subsequent binding of a cellulose chain into subsites Glc(−1) to Glc(−4) (11). Another variant enzyme with a deletion of a group of amino acids forming a block at the end of the catalytic cleft, Cel9A-68 Δ(T245-L251)R252K (DEL), showed slightly improved filter paper (FP) activity and binding to BC (20).Open in a separate windowFIG. 1.Crystal structure of Cel9A-68 (PDB code 4tf4) showing the locations of the variant residues, catalytic acid E424, catalytic base D58, hydrogen bonding network residues D55, H125, and Y206, and six glucose residues, Glc(−4) to Glc(+2). Part of the linker is visible in dark blue.The CBM3c domain is critical for hydrolysis and processivity. Cel9A-51, an enzyme with the family 9 CD and the linker but without CBM3c, had low activity on carboxymethyl cellulose (CMC), BC, and swollen cellulose (SWC) and showed no processivity (4). The role of CBM3c was investigated by mutagenesis, and one modified enzyme, R557A/E559A, had impaired activity on all of these substrates but normal binding and processivity (11). Variants with changes at five other CBM3c residues were found to slightly lower the activity of the modified enzymes, while Cel9A-68 enzymes containing either F476A, D513A, or I514H were found to have slightly increased binding and processivity (11) (see Table Table1).1). In the present work, CBM3c has been investigated more extensively to identify residues involved in substrate binding and processivity, understand the role of CBM3c more clearly, and study the coordination between the CD and CBM3c. An additional goal was to combine amino acid variants showing increased crystalline cellulose activity to see if this further increased activity. Finally, we have investigated whether the changes that improved the activity of Cel9A-68 also enhanced the activity of intact Cel9A-90.
Open in a separate windowaThe target percent digestion could not be reached; activity was calculated using 1.5 μM enzyme.bDEL refers to deletion of T245 to L251 and R252K. 相似文献
TABLE 1.
Activities of Cel9A-68 CBM3c variant enzymes and CD variant enzymes used to create the double variantsEnzyme | Activity (% of wild type) on: | % Processivity | % BC binding | Reference | |||
---|---|---|---|---|---|---|---|
CMC | SWC | BC | FPa | ||||
Wild type | 100 | 100 | 100 | 100 | 100 | 15 | This work |
R378K | 98 | 91 | 103 | 93 | 139 | 20 | 11 |
DELb | 98 | 101 | 101 | 128 | 96 | 20 | |
F476A | 97 | 105 | 79 | 100 | 145 | 21 | 11 |
D513A | 100 | 115 | 121 | 107 | 119 | 20 | 11 |
I514H | 104 | 91 | 112 | 104 | 110 | 23 | 11 |
Y520A | 108 | 78 | 33a | 79 | 87 | 14 | 11 |
R557A | 103 | 98 | 60a | 93 | 90 | This work | |
E559A | 86 | 90 | 30a | 70 | 94 | This work | |
R557A+E559A | 90 | 75 | 15a | 75 | 106 | 15 | 11 |
Q561A | 103 | 56 | 51a | 78 | 74 | This work | |
R563A | 97 | 70 | 52a | 93 | 129 | 20 | 11 |
11.
12.
Robert Ng Lakshmanan Govindasamy Brittney L. Gurda Robert McKenna Olga G. Kozyreva R. Jude Samulski Kristin N. Parent Timothy S. Baker Mavis Agbandje-McKenna 《Journal of virology》2010,84(24):12945-12957
The three-dimensional structure of adeno-associated virus (AAV) serotype 6 (AAV6) was determined using cryo-electron microscopy and image reconstruction and using X-ray crystallography to 9.7- and 3.0-Å resolution, respectively. The AAV6 capsid contains a highly conserved, eight-stranded (βB to βI) β-barrel core and large loop regions between the strands which form the capsid surface, as observed in other AAV structures. The loops show conformational variation compared to other AAVs, consistent with previous reports that amino acids in these loop regions are involved in differentiating AAV receptor binding, transduction efficiency, and antigenicity properties. Toward structure-function annotation of AAV6 with respect to its unique dual glycan receptor (heparan sulfate and sialic acid) utilization for cellular recognition, and its enhanced lung epithelial transduction compared to other AAVs, the capsid structure was compared to that of AAV1, which binds sialic acid and differs from AAV6 in only 6 out of 736 amino acids. Five of these residues are located at or close to the icosahedral 3-fold axis of the capsid, thereby identifying this region as imparting important functions, such as receptor attachment and transduction phenotype. Two of the five observed amino acids are located in the capsid interior, suggesting that differential AAV infection properties are also controlled by postentry intracellular events. Density ordered inside the capsid, under the 3-fold axis in a previously reported, conserved AAV DNA binding pocket, was modeled as a nucleotide and a base, further implicating this capsid region in AAV genome recognition and/or stabilization.Adeno-associated viruses (AAVs) are nonpathogenic single-stranded DNA (ssDNA) parvoviruses that belong to the Dependovirus genus and require helper viruses, such as Adenovirus or Herpesvirus, for lytic infection (4, 8, 22, 67). These viruses package a genome of ∼4.7 kb inside an icosahedral capsid (∼260 Å in diameter) with a triangulation number equal to 1 assembled from a total of 60 copies of their overlapping capsid viral protein (VP) 1 (VP1), VP2, and VP3 in a predicted ratio of 1:1:8/10 (10). The VPs are encoded from a cap open reading frame (ORF). VP3 is 61 kDa and constitutes 90% of the capsid''s protein composition. The less abundant VPs, VP1 (87 kDa) and VP2 (73 kDa), share the same C-terminal amino acid sequence with VP3 but have additional N-terminal sequences. A rep ORF codes for four overlapping proteins required for replication and DNA packaging.To date, more than 100 AAV isolates have been identified (21). Among the human and nonhuman primate AAVs isolated, 12 serotypes (AAV serotype 1 [AAV1] to AAV12) have been described and are classified into six phylogenetic clades on the basis of their VP sequences and antigenic reactivities, with AAV4 and AAV5 considered to be clonal isolates (21). AAV1 and AAV6, which represent clade A, differ by only 6 out of 736 VP1 amino acids (5 amino acids within VP3) and are antigenically cross-reactive. Other clade representatives include AAV2 (clade B), AAV2-AAV3 hybrid (clade C), AAV7 (clade D), AAV8 (clade E), and AAV9 (clade F) (21).The AAVs are under development as clinical gene delivery vectors (e.g., see references 5, 9, 12, 13, 24, 25, 53, and 61), with AAV2, the prototype member of the genus, being the most extensively studied serotype for this application. AAV2 has been successfully used to treat several disorders, but its broad tissue tropism makes it less effective for tissue-specific applications and the prevalence of preexisting neutralizing antibodies in the human population (11, 43) limits its utilization, especially when readministration is required to achieve a therapeutic outcome. Efforts have thus focused on characterizing the capsid-associated tissue tropism and transduction properties conferred by the capsid of representative serotypes of other clades (21). Outcomes of these studies include the observation that AAV1 and AAV6, for example, transduce liver, muscle, and airway epithelial cells more efficiently (e.g., up to 200-fold) than AAV2 (27, 28, 30). In addition, the six residues (Table (Table1)1) that differ between the VPs of AAV1 and AAV6 (a natural recombinant of AAV1 and AAV2 [56]) confer functional disparity between these two viruses. For example, AAV6 shows ∼3-fold higher lung cell epithelium transduction than AAV1 (27), and AAV1 and AAV6 bind terminally sialylated proteoglycans as their primary receptor, whereas AAV6 additionally binds to heparan sulfate (HS) proteoglycans with moderate affinity (70, 71). Therefore, a comparison of the AAV1 and AAV6 serotypes and, in particular, their capsid structures can help pinpoint the capsid regions that confer differences in cellular recognition and tissue transduction.
Open in a separate windowaMutant residues in boldface have an AAV6 parental original; those underlined have an AAV1 parental origin.bS, sialic acid; HS, heparan sulfate; HS+, HS positive.cThe sialic acid binding phenotypes of these mutants were not discussed in the respective publications but are assumed to be still present.dThe glycan targets for these mutants were not discussed in this publication; thus, the phenotypes indicated are assumed.eThis mutant is sialic acid independent (S-ind) for cellular transduction.The structures of AAV1 to AAV5 and AAV8 have been determined by X-ray crystallography and/or cryo-electron microscopy and image reconstruction (cryo-EM) (23, 36, 47, 52, 66, 73; unpublished data), and preliminary characterization of crystals has also been reported for AAV1, AAV5, AAV7, and AAV9 (15, 45, 46, 55). The capsid VP structures contain a conserved eight-stranded (βB to βI) β-barrel core and large loop regions between the strands that form the capsid surface. The capsid surface is characterized by depressions at the icosahedral 2-fold axes of symmetry, finger-like projections surrounding the 3-fold axes, and canyon-like depressions surrounding the 5-fold axes. A total of nine variable regions (VRs; VRI to VRIX) were defined when the two most disparate structures, AAV2 and AAV4, were compared (23). The VRs contain amino acids that contribute to slight differences in surface topologies and distinct functional phenotypes, such as in receptor binding, transduction efficiency, and antigenic reactivity (10, 23, 37, 47).The structure of virus-like particles (VLPs) of AAV6, produced in a baculovirus/Sf9 insect cell expression system, has been determined by two highly complementary approaches, cryo-EM and X-ray crystallography. The AAV6 VP structure contains the general features already described for the AAVs and has conformational differences in the VRs compared to the VRs of other AAVs. The 9.7-Å-resolution cryoreconstructed structure enabled the localization of the C-α positions of five of the six amino acids that differ between highly homologous AAV6 and AAV1 but did not provide information on the positions of the side chains or their orientations. The X-ray crystal structure determined to 3.0-Å resolution enabled us to precisely map the atomic positions of these five residues at or close to the icosahedral 3-fold axes of the capsid. Reported mutagenesis and biochemical studies had functionally annotated the six residues differing between AAV1 and AAV6 with respect to their roles in receptor attachment and differential cellular transduction. Their disposition identifies the 3-fold capsid region as playing essential roles in AAV infection. 相似文献
TABLE 1.
Amino acid differences between AAV1 and AAV6 and their reported mutantsAAV | Amino acid at positiona: | Glycan targetb | Reference | ||||||
---|---|---|---|---|---|---|---|---|---|
129 | 418 | 531 | 532 | 584 | 598 | 642 | |||
AAV1 | L | E | E | D | F | A | N | S | 70 |
AAV1-E/K | L | E | K | D | F | A | N | HS+ (and S)c | 70 |
AAV6 | F | D | K | D | L | V | H | HS and S | 70 |
AAV6.1 | F | D | E | D | L | V | H | HS− (and S)c | 40, 70 |
AAV6.2 | L | D | K | D | L | V | H | HS (and S)c | 40, 70 |
AAV6R2 | L | D | E | D | L | V | H | HS− (and S)c | 40 |
HAE1 | L | E | E | D | L | V | N | (HS− and S)d | 39 |
HAE2 | L | D | K | D | L | V | N | (HS and S)d | 39 |
shH10 | F | D | K | N | L | V | N | HS (and S-inde) | 33 |
13.
Katharine J. Bar Hui Li Annie Chamberland Cecile Tremblay Jean Pierre Routy Truman Grayson Chuanxi Sun Shuyi Wang Gerald H. Learn Charity J. Morgan Joseph E. Schumacher Barton F. Haynes Brandon F. Keele Beatrice H. Hahn George M. Shaw 《Journal of virology》2010,84(12):6241-6247
Recent studies indicate that sexual transmission of human immunodeficiency virus type 1 (HIV-1) generally results from productive infection by only one virus, a finding attributable to the mucosal barrier. Surprisingly, a recent study of injection drug users (IDUs) from St. Petersburg, Russia, also found most subjects to be acutely infected by a single virus. Here, we show by single-genome amplification and sequencing in a different IDU cohort that 60% of IDU subjects were infected by more than one virus, including one subject who was acutely infected by at least 16 viruses. Multivariant transmission was more common in IDUs than in heterosexuals (60% versus 19%; odds ratio, 6.14; 95% confidence interval [CI], 1.37 to 31.27; P = 0.008). These findings highlight the diversity in HIV-1 infection risks among different IDU cohorts and the challenges faced by vaccines in protecting against this mode of infection.Elucidation of virus-host interactions during and immediately following the transmission event is one of the great challenges and opportunities in human immunodeficiency virus (HIV)/AIDS prevention research (14-16, 31, 34, 45). Recent innovations involving single-genome amplification (SGA), direct amplicon sequencing, and phylogenetic inference based on a model of random virus evolution (18-20, 43) have allowed for the identification of transmitted/founder viruses that actually cross from donor to recipient, leading to productive HIV type 1 (HIV-1) infection. Our laboratory and others have made the surprising finding that HIV-1 transmission results from productive infection by a single transmitted/founder virus (or virally infected cell) in ∼80% of HIV-infected heterosexuals and in ∼60% of HIV-infected men who have sex with men (MSM) (1, 13, 18, 24). These studies thus provided a precise quantitative estimate for the long-recognized genetic bottleneck in HIV-1 transmission (6, 11-13, 17, 25, 28, 30, 35, 38, 42, 47-49) and a plausible explanation for the low acquisition rate per coital act and for graded infection risks associated with different exposure routes and behaviors (15, 36).In contrast to sexual transmission of HIV-1, virus transmission resulting from injection drug use has received relatively little attention (2, 3, 29, 42) despite the fact that injection drug use-associated transmission accounts for as many as 10% of new infections globally (26, 46). We hypothesized that SGA strategies developed for identifying transmitted/founder viruses following mucosal acquisition are applicable to deciphering transmission events following intravenous inoculation and that, due to the absence of a mucosal barrier, injection drug users (IDUs) exhibit a higher frequency of multiple-variant transmission and a wider range in numbers of transmitted viruses than do acutely infected heterosexual subjects. We obtained evidence in support of these hypotheses from the simian immunodeficiency virus (SIV)-Indian rhesus macaque infection model, where we showed that discrete low-diversity viral lineages emanating from single or multiple transmitted/founder viruses could be identified following intravenous inoculation and that the rectal mucosal barrier to infection was 2,000- to 20,000-fold greater than with intravenous inoculation (19). However, we also recognized potentially important differences between virus transmission in Indian rhesus macaques and virus transmission in humans that could complicate an IDU acquisition study. For example, in the SIV macaque model, the virus inocula can be well characterized genetically and the route and timing of virus exposure in relation to plasma sampling precisely defined, whereas in IDUs, the virus inoculum is generally undefined and the timing of virus infection only approximated based on clinical history and seroconversion testing (8). In addition, IDUs may have additional routes of potential virus acquisition due to concomitant sexual activity. Finally, there is a paucity of IDU cohorts for whom incident infection is monitored sufficiently frequently and clinical samples are collected often enough to allow for the identification and enumeration of transmitted/founder viruses. To address these special challenges, we proposed a pilot study of 10 IDU subjects designed to determine with 95% confidence if the proportion of multivariant transmissions in IDUs was more than 2-fold greater than the 20% frequency established for heterosexual transmission (1, 13, 18, 24). A secondary objective of the study was to determine whether the range in numbers of transmitted/founder viruses in IDUs exceeded the 1-to-6 range observed in heterosexuals (1, 13, 18, 24). To ensure comparability among the studies, we employed SGA-direct amplicon sequencing approaches, statistical methods, and power calculations identical to those that we had used previously to enumerate transmitted/founder viruses in heterosexual and MSM cohorts (1, 13, 18, 20, 24).We first surveyed investigators representing acute-infection cohorts in the United States, Canada, Russia, and China; only one cohort—the Montreal Primary HIV Infection Cohort (41)—had IDU clinical samples and clinical data available for study. The Montreal cohort of subjects with acute and early-stage HIV-1 infection was established in 1996 and recruits subjects from both academic and private medical centers throughout the city. Injection drug use is an important contributing factor to Montreal''s HIV burden, with IDUs comprising approximately 20% of the city''s AIDS cases and 35% of the cohort (21, 40, 41). A large proportion of Montreal''s IDUs use injection cocaine, with 50 to 69% of subjects reporting cocaine as their injection drug of choice (4, 5, 9, 22, 23).Subjects with documented serological evidence of recent HIV-1 infection and a concurrent history of injection drug use were selected for study. These individuals had few or no reported risk factors for sexual HIV-1 acquisition. Clinical history and laboratory tests of HIV-1 viremia and antibody seroconversion were used to determine the Fiebig clinical stage (8) and to estimate the date of infection (Table (Table1).1). One subject was determined to be in Fiebig stage III, one subject was in Fiebig stage IV, five subjects were in Fiebig stage V, and three subjects were in Fiebig stage VI. We performed SGA-direct amplicon sequencing on stored plasma samples and obtained a total of 391 3′ half-genomes (median, 25 per subject; range, 19 to 167). Nine of these sequences contained large deletions or were G-to-A hypermutated and were excluded from subsequent analysis. Sequences were aligned, visually inspected using the Highlighter tool (www.hiv.lanl.gov/content/sequence/HIGHLIGHT/highlighter.html), and analyzed by neighbor-joining (NJ) phylogenetic-tree construction. A composite NJ tree of full-length gp160 env sequences from all 10 subjects (Fig. (Fig.1A)1A) revealed distinct patient-specific monophyletic lineages, each with high bootstrap support and separated from the others by a mean genetic distance of 10.79% (median, 11.29%; range, 3.00 to 13.42%). Maximum within-patient env gene diversity ranged from 0.23% to 3.34% (Table (Table1).1). Four subjects displayed distinctly lower within-patient maximum env diversities (0.23 to 0.49%) than the other six subjects (1.48% to 3.34%). The lower maximum env diversities in the former group are consistent with infection either by a single virus or by multiple closely related viruses, while the higher diversities can be explained only by transmission of more than one virus based on empirical observations (1, 13, 18, 24) and mathematical modeling (18, 20).Open in a separate windowFIG. 1.NJ trees and Highlighter plots of HIV-1 gp160 env sequences. (A) Composite tree of 382 gp160 env sequences from all study subjects. The numerals at the nodes indicate bootstrap values for which statistical support exceeded 70%. (B) Subject ACT54869022 sequences suggest productive infection by a single virus (V1). (C) Subject HDNDRPI032 sequences suggest productive infection by as many as three viruses. (D) Subject HDNDRPI001 sequences suggest productive infection by at least five viruses with extensive interlineage recombination. Sequences are color coded to indicate viral progeny from distinct transmitted/founder viruses. Recombinant virus sequences are depicted in black. Methods for SGA, sequencing, model analysis, Highlighter plotting, and identification of transmitted/founder virus lineages are described elsewhere (18, 20, 24, 44). The horizontal scale bars represent genetic distance. nt, nucleotide.
Open in a separate windowaM, male; F, female.bNumbers of days postinfection were estimated on the basis of serological markers, clinical symptoms, or a history of a high-risk behavior leading to virus exposure.cDiversity measurements determined by PAUP* analysis.dThe model prediction of the maximum achievable env diversity 100 days after transmission is 0.60% (95% CI, 0.54 to 0.68%). Diversity values exceeding this range imply transmission and productive infection by more than one virus. Diversity values less than 0.54% can be explained by transmission of one virus or of multiple closely related viruses (18).eModel described in Keele et al. (18).fMinimum estimate of transmitted/founder viruses.gND, not determined.An example of productive clinical infection by a single virus is shown in phylogenetic tree and Highlighter plots from subject ACT54869022 (Fig. (Fig.1B).1B). A similar phylogenetic pattern of single-variant transmission was found in 4 of 10 IDU subjects (Table (Table1).1). Examples of multivariant transmission are shown for subject HDNDRPI032, for whom there was evidence of infection by 3 transmitted/founder viruses (Fig. (Fig.1C)1C) and for subject HDNDRPI001, for whom there was evidence of infection by at least 5 transmitted/founder viruses (Fig. (Fig.1D).1D). One IDU subject, HDNDRPI034, had evidence of multivariant transmission to an extent not previously seen in any of 225 subjects who acquired their infection by mucosal routes (1, 13, 18, 24) or in any of 13 IDUs, as recently reported by Masharsky and colleagues (29). We greatly extended the depth of our analysis in this subject to include 163 3′ half-genome sequences in order to increase the sensitivity of detection of low-frequency viral variants. Power calculations indicated that a sample size of 163 sequences gave us a >95% probability of sampling minor variants comprising as little as 2% of the virus population. By this approach, we found evidence of productive infection by at least 16 genetically distinct viruses (Fig. (Fig.2).2). Fourteen of these could be identified unambiguously based on the presence of discrete low-diversity viral lineages, each consisting of between 2 and 48 sequences. Two additional unique viral sequences with long branch lengths (3F8 and G10) exhibited diversity that was sufficiently great to indicate a distinct transmission event as opposed to divergence from other transmitted/founder lineages (see the legend to Fig. Fig.2).2). It is possible that still other unique sequences from this subject also represented transmitted/founder viruses, but we could not demonstrate this formally. We also could not determine if all 16 (or more) transmission events resulted from a single intravenous inoculation or from a series of inoculations separated by hours or days; however, it is likely that all transmitted viruses in this subject resulted from exposure to plasma from a single infected individual, since the maximum env diversity was only 3.34% (Fig. (Fig.1A).1A). It is also likely that transmission occurred within a brief window of time, since the period from transmission to the end of Fiebig stage III is typically only about 25 days (95% CI, 22 to 37 days) (18, 20) and the diversity observed in all transmitted/founder viral lineages in subject HDNDRPI034 was exceedingly low, consistent with model predictions for subjects with very recent infections (18, 20).Open in a separate windowFIG. 2.NJ tree and Highlighter plot of HIV-1 3′ half-genome sequences from subject HDNDRPI034. Sequences emanating from 16 transmitted/founder viruses are color coded. Fourteen transmitted/founder viral lineages comprised of 2 or more identical or nearly identical sequences could be readily distinguished from recombinant sequences (depicted in black), which invariably appeared as unique sequences containing interspersed segments shared with other transmitted/founder virus lineages. The two sequences with the longest branch lengths (3F8 and G10) were interpreted to represent rare progeny of discrete transmitted/founder viruses because their unique polymorphisms far exceeded the maximum diversity estimated to occur in the first 30 days of infection (0.22%; CI, 0.15 to 0.31%) (18) and far exceeded the diversity observed within the other transmitted/founder virus lineages. The horizontal scale bar represents genetic distance.Lastly, we compared the multiplicity of HIV-1 transmission in the Montreal IDU subjects with that of non-IDU subjects for whom identical SGA methods had been employed. In this combined-cohort analysis, we found the frequency of multiple-variant transmission in heterosexuals to be 19% (34 of 175) and in MSM 38% (19 of 50) (Table (Table2)2) (24). The current study was powered to detect a >2-fold difference in multivariant transmission between IDUs and heterosexual subjects; in fact, we observed a 3-fold-higher frequency of multiple-variant transmission in Montreal IDUs (6 of 10 subjects [60%]) than in heterosexuals (odds ratio, 6.14; 95% CI, 1.37 to 31.27; Fisher exact test, P = 0.008) and a 1.5-fold-higher frequency in Montreal IDUs than in MSM (odds ratio, 2.41; 95% CI, 0.50 to 13.20; P = 0.294, not significant). In addition, we found that the range of numbers of transmitted/founder viruses was greater in IDUs (range, 1 to 16 viruses; median, 3) than in either heterosexuals (range, 1 to 6 viruses; median, 1) or MSM (range, 1 to 10 viruses; median, 1). The finding of larger numbers of transmitted/founder viruses in IDUs was not simply the result of more intensive sampling, since the numbers of sequences analyzed in all studies were comparable. Moreover, it is notable that in studies reported elsewhere, we sampled as many as 239 sequences by SGA or as many as 500,000 sequences by 454 pyrosequencing from four acutely infected MSM subjects and in each case found evidence of productive clinical infection by only a single virus (24; W. Fischer, B. Keele, G. Shaw, and B. Korber, unpublished). These results thus suggest that IDUs may be infected by more viruses and by a greater range of viruses than is the case following mucosal transmission. On this count, our findings differ from those reported by Masharsky and coworkers for an IDU cohort from St. Petersburg, Russia (29). Their study found a low frequency of multiple virus transmissions (31%), not significantly different from that of acutely infected heterosexuals, and a low number of transmitted/founder viruses (range, 1 to 3 viruses; median, 1). Because the SGA methods employed in both studies were identical, the numbers of sequences analyzed per subject were comparable (median of 25 sequences in Montreal versus 33 in St. Petersburg), and because the discriminating power of the SGA-direct sequencing method was sufficient to distinguish transmitted/founder viruses differing by as few as 3 nucleotides, or <0.1% of nucleotides (Fig. (Fig.2,2, compare lineages V4 and V5), it is unlikely that differences in the genetic diversity of HIV-1 in the two IDU populations explain the differences in findings between the two studies. Instead, we suspect that the explanation lies in the small cohort sizes (10 versus 13 subjects) and the particular risk behaviors of the IDUs in each cohort. The Russian cohort is heavily weighted toward heroine use, whereas the Montreal cohort is weighted toward injection cocaine use, the latter being associated with more frequent drug administration and the attendant infection risks of needle sharing (4).
Open in a separate windowaFisher''s exact test of multiple-variant transmission in heterosexuals versus in IDUs.bFisher''s exact test of multiple-variant transmission in MSM versus in IDUs.The results from the present study indicate that transmission of HIV-1 to IDUs can be associated with a high frequency of multiple-variant transmission and a broad range in the numbers of transmitted viruses. This wide variation in the multiplicity of HIV-1 infection in IDUs is likely due to the absence of a mucosal barrier to virus transmission (12, 19) and differences in the virus inocula (27, 29, 32, 39). The findings substantiate concerns raised in recent HIV-1 vaccine efficacy trials that different vaccine candidates may be more efficacious in preventing infection by some exposure routes than by others (7, 10, 33, 37). They further suggest that biological comparisons of molecularly cloned transmitted/founder viruses responsible for vaginal, rectal, penile, and intravenous infection could facilitate a mechanistic understanding of HIV-1 transmission and vaccine prevention (24, 44). 相似文献
TABLE 1.
Subject demographics and HIV-1 envelope analysis resultsSubject identifier | Age (yr) | Sexa | Fiebig stage | Estimated no. of days postinfectionb | CD4 count | Plasma viral load (log) | No. of SGA amplicons | Diversity of env genes (%)c | No. of transmitted/ founder viruses | |||
---|---|---|---|---|---|---|---|---|---|---|---|---|
Mean | Interquartile range | Maximumd | Model predictione | Phylogenetic estimatef | ||||||||
HDNDRPI034 | 47 | M | III | 29 | 240 | 7.88 | 163 | 1.07 | 0.55 | 3.34 | >1 | 16 |
HDNDRPI029 | 18 | F | IV | 48 | 440 | 4.34 | 29 | 0.16 | 0.15 | 0.49 | 1 | 1 |
HTM385 | 24 | M | V | 62 | 406 | 5.37 | 22 | 0.12 | 0.08 | 0.27 | 1 | 1 |
CQLDR03 | 42 | M | V | 66 | NDg | 5.01 | 21 | 0.08 | 0.08 | 0.23 | 1 | 1 |
HDNDRPI001 | 36 | M | V | 28 | 690 | 5.94 | 25 | 0.90 | 0.63 | 1.91 | >1 | 5 |
HTM319 | 39 | M | V | 68 | 520 | 4.43 | 25 | 0.77 | 0.46 | 1.54 | >1 | 3 |
HDNDRPI032 | 37 | M | V | 73 | 1,040 | 3.53 | 19 | 1.48 | 2.99 | 3.34 | >1 | 3 |
ACTDM580208 | 39 | M | VI | 93 | 387 | 4.53 | 30 | 1.17 | 0.97 | 2.64 | >1 | 3 |
ACT54869022 | 28 | M | VI | 68 | 723 | 3.43 | 27 | 0.07 | 0.04 | 0.24 | 1 | 1 |
PSL024 | 46 | M | VI | 82 | 340 | 4.46 | 21 | 0.82 | 0.63 | 1.57 | >1 | 3 |
TABLE 2.
Multiplicity of HIV-1 infection in IDU, heterosexual, and MSM subjectsCohort | Reference | Virus subtype | Total no. of subjects | Single-variant transmission | Multiple-variant transmission | P value | Odds ratio | 95% CI | Median | Range | ||
---|---|---|---|---|---|---|---|---|---|---|---|---|
No. of subjects | % of total | No. of subjects | % of total | |||||||||
Heterosexuals | Keele et al. (18) | B | 79 | 65 | 82.30 | 14 | 17.70 | 1 | 1-4 | |||
Abrahams et al. (1) | C | 69 | 54 | 78.30 | 15 | 21.70 | 1 | 1-5 | ||||
Haaland et al. (13) | A or C | 27 | 22 | 81.50 | 5 | 18.50 | 1 | 1-6 | ||||
Total | 175 | 141 | 80.60 | 34 | 19.40 | 0.008a | 6.14 | 1.37-31.27 | 1 | 1-6 | ||
MSM | Keele et al. (18) | B | 22 | 13 | 59.10 | 9 | 40.90 | 1 | 1-6 | |||
Li et al. (24) | B | 28 | 18 | 64.30 | 10 | 35.70 | 1 | 1-10 | ||||
Total | 50 | 31 | 62.00 | 19 | 38.00 | 0.294b | 2.41 | 0.50-13.20 | 1 | 1-10 | ||
IDUs | Bar | B | 10 | 4 | 40.00 | 6 | 60.00 | 3 | 1-16 |
14.
15.
Ana Roque Carmen Lopez-Joven Beatriz Lacuesta Laurence Elandaloussi Sariqa Wagley M. Dolores Furones Imanol Ruiz-Zarzuela Ignacio de Blas Rachel Rangdale Bruno Gomez-Gil 《Applied and environmental microbiology》2009,75(23):7574-7577
Presented here is the first report describing the detection of potentially diarrheal Vibrio parahaemolyticus strains isolated from cultured bivalves on the Mediterranean coast, providing data on the presence of both tdh- and trh-positive isolates. Potentially diarrheal V. parahaemolyticus strains were isolated from four species of bivalves collected from both bays of the Ebro delta, Spain.Gastroenteritis caused by Vibrio parahaemolyticus has been reported worldwide, though only sporadic cases have been reported in Europe (7, 14). The bacterium can be naturally present in seafood, but pathogenic isolates capable of inducing gastroenteritis in humans are rare in environmental samples (2 to 3%) (15) and are often not detected (10, 19, 20).The virulence of V. parahaemolyticus is based on the presence of a thermostable direct hemolysin (tdh) and/or the thermostable direct hemolysin-related gene (trh) (1, 5). Both are associated with gastrointestinal illnesses (2, 9).Spain is not only the second-largest producer in the world of live bivalve molluscs but also one of the largest consumers of bivalve molluscs, and Catalonia is the second-most important bivalve producer of the Spanish Autonomous Regions. Currently, the cultivation of bivalves in this area is concentrated in the delta region of the Ebro River. The risk of potentially pathogenic Vibrio spp. in products placed on the market is not assessed by existing legislative indices of food safety in the European Union, which emphasizes the need for a better knowledge of the prevalence of diarrheal vibrios in seafood products. The aim of this study was to investigate the distribution and pathogenic potential of V. parahaemolyticus in bivalve species exploited in the bays of the Ebro delta.Thirty animals of each species of Mytilus galloprovincialis, Crassostrea gigas, Ruditapes decussatus, and Ruditapes philippinarum were collected. They were sampled from six sites of the culture area, three in each bay of the Ebro River delta, at the beginning (40°37′112"N, 0°37′092"E [Alfacs]; 40°46′723"N, 0°43′943"E [Fangar]), middle (40°37′125"N, 0°38′570"E [Alfacs]; 40°46′666"N, 0°45′855"E [Fangar]), and end (40°37′309"N, 0°39′934"E [Alfacs]; 40°46′338"N, 0°44′941"E [Fangar]) of the culture polygon. Clams were sampled from only one site per bay as follows: in the Alfacs Bay from a natural bed of R. decussatus (40°37′44"N, 0°38′0"E) and in the Fangar Bay from an aquaculture bed of R. philippinarum (40°47′3"N, 0°43′8"E). In total, 367 samples were analyzed in 2006 (180 oysters, 127 mussels, 30 carpet shell clams, and 30 Manila clams) and 417 samples were analyzed in 2008 (178 oysters, 179 mussels, 30 carpet shell clams, and 30 Manila clams).All animals were individually processed and homogenized, and 1 ml of the homogenate was inoculated into 9 ml of alkaline peptone water (Scharlau, Spain). Following a 6-h incubation at 37°C, one loopful of the contents of each tube of alkaline peptone water was streaked onto CHROMagar vibrio plates (CHROMagar, France) and incubated for 18 h at 37°C. Mauve-purple colonies were purified, and each purified isolate was cryopreserved at −80°C (135 isolates in 2006 and 96 in 2008). From the initial homogenate portion, 100 μl was inoculated onto marine agar (Scharlau, Spain) and onto thiosulfate citrate-bile salts-sucrose agar (Scharlau, Spain) for total heterotrophic marine bacteria counts and total vibrio counts, respectively (Table (Table11).
Open in a separate windowaMg, Mytilus galloprovincialis; Cg, Crassostrea gigas; Rd, Ruditapes decussatus; Rp, R. phillipinarum; A, Alfacs; F, Fangar; ND, not determined; TCBS, thiosulfate citrate-bile salts-sucrose.Total DNA was extracted from each purified isolate using the Wizard genomic DNA purification kit (Promega), following the instructions of the manufacturer. A one-step PCR analysis was performed to identify/confirm which isolates were tl positive (species marker for V. parahaemolyticus). Further detection of the tdh or trh gene was carried out on all positive tl strains. All PCR analyses were carried out using the primers described by Bej et al. (2) with the following amplification conditions on the thermocycler (Eppendorf Mastercycler Personal): an initial denaturation at 95°C for 8 min, followed by 40 cycles of a 1-min denaturation at 94°C, annealing at 55°C for 1 min, elongation at 72° for 1 min, and a final extension of 10 min at 72°C. Positive and negative controls were included in all reaction mixtures: two positive controls, tl and tdh CAIM 1400 and trh CAIM 1772 (Collection of Aquatic Important Microorganisms [http://www.ciad.mx/caim/CAIM.html]), and negative control DNA-free molecular grade water (Sigma-Aldrich, Spain). Expected amplicons were visualized in 2% agarose gels stained with ethidium bromide.Fifty-eight isolates contained the gene tl in 2006 and 96 in 2008, which confirmed their identity as V. parahaemolyticus. In 2006, the distribution of the 58 isolates was as follows: 7 from 127 mussels, 34 from 180 oysters, and 17 from 30 R. decussatus clams. No tl-positive isolates were found in R. philippinarum. PCR analysis of the tl-positive isolates for the presence of the tdh or trh gene indicated that eight isolates contained the tdh gene and four contained the trh gene. In 2008, the source of the confirmed V. parahaemolyticus isolates was as follows: 31 from 88 oysters, 44 from 89 mussels, 9 from 30 R. decussatus clams, and 12 from 30 R. philippinarum clams. Of these, 17 were found to contain the tdh gene and 7 contained the trh gene. Two isolates (I806 and I1042) contained both toxigenic genes, tdh and trh.Putative tdh- and trh-positive PCR products were purified using the QIAquick PCR purification kit (Qiagen) following the manufacturer''s instructions and were sequenced bidirectionally by Macrogen Inc. Sequences were aligned using BioEdit (8) and analyzed using BLAST (National Center for Biotechnology Information). None of the toxigenic isolates was found positive by PCR analysis for the presence of open reading frame 8 of the phage 237 (16), a marker for the pandemic strain O3:K6.The isolates were fingerprinted by repetitive extragenic palindromic PCR (rep-PCR) as described previously (3), and the resulting electrophoretic band patterns were analyzed with the GelCompar II software (v4.5; Applied Maths). The similarity matrix was calculated with the Jaccard coefficient with a band position tolerance of 0.8%, and the dendrogram was constructed with the Ward algorithm. A high level of genomic diversity was found among the 32 toxigenic isolates characterized by rep-PCR. Three clonal groups were identified (those having identical rep-PCR band patterns) (Fig. 1a to c).Open in a separate windowFIG. 1.rep-PCR dendrogram of toxigenic isolates of V. parahaemolyticus isolated in the Ebro delta. Letters denote clonal groups of isolates.In vitro antibiotic susceptibility tests were performed using the diffusion disc test following a previously described protocol (18). The antibiotics used were gentamicin (10 μg), oxolinic acid (10 μg), amoxicillin (25 μg), polymyxin B (300 UI), vancomycin (30 μg), trimethoprim sulfamethoxazole (1.25/23.75 μg), nitrofurantoin (300 μg), doxycyclin (30 μg), ceftazidime (30 μg), streptomycin (10 μg), neomycin (30 UI), penicillin (6 μg), flumequine (30 μg), tetracycline (30 μg), ampicillin (10 μg), kanamycin (30 μg), ciprofloxacin (5 μg), and sulfonamide (300 μg). All tests were performed in duplicate. A Student t test for two samples with unequal variance was performed to compare the sensitivity of all 2006 isolates against the sensitivity of 2008 isolates for each antibiotic (Microsoft Office Excel 97-2003). Antibiogram results revealed a lower susceptibility in 2008 than in 2006, indicating a possible shift in overall susceptibility. Results from the t test indicated that significantly lower susceptibility in 2008 was detected (P ≤ 0.05; n = 36) for the following antibiotics: vancomycin, polymyxin B, ampicillin, amoxicillin, gentamicin, neomycin, trimethoprim sulfamethoxazole, nitrofurantoin, doxycyclin, ceftazidime, tetracycline, flumequine, and ciprofloxacin.The serological types for 27 strains were determined by the agglutination method using commercially available V. parahaemolyticus antisera (Denka Seiken Ltd.; Cosmos Biomedical Ltd, United Kingdom) following the manufacturer''s instructions. Potentially toxigenic V. parahaemolyticus isolates collected in 2006 were serologically heterogeneous (8 out of the 11 isolates) (Table (Table1).1). In isolates collected in 2008, results were more homogenous, with seven serotypes found among 19 isolates analyzed. The O3:K6 serotype was not detected in any of the strains analyzed, in agreement with the open reading frame 8 PCR results.The present study is the first to report the detection of potentially diarrheal V. parahaemolyticus strains isolated from cultured bivalves on Spanish Mediterranean coasts, providing data on the presence of both tdh- and trh-positive isolates. V. parahaemolyticus has previously been detected in several European countries (4, 13, 21, 22). A recent study carried out in Spain detected tdh-positive V. parahaemolyticus strains from patients who had consumed fresh oysters in a market in Galicia on the Atlantic coast of Spain (12) and potentially pathogenic V. parahaemolyticus strains have also been reported in France (17). These studies indicate that the risk of infections caused by V. parahaemolyticus in Europe is low compared to that in America or Asia (15). However, this risk could have been underestimated, since V. parahaemolyticus is not included in the current European surveillance programs, such as the European Network for Epidemiological Surveillance and Control of Communicable Diseases.Toxigenic V. parahaemolyticus strains detected in this study were genomically and serologically heterogeneous. The pandemic serotype O3:K6 was not detected, and although attempts to isolate O3:K6 from the environment and from seafood have not always been successful in previous studies reviewed by Nair and coauthors (15), this finding seems to be in agreement with the fact that no outbreak of diarrhea was observed in the area. Interestingly, isolates I806 and I1042 have been found positive for both tdh and trh in PCR tests. The coexistence of tdh and trh genes has already been reported in isolates from Japan, the United States, and Mexico (3, 6, 11, 19, 23). To our knowledge, no occurrence of an environmental isolate positive for both tdh and trh had previously been reported in Europe. All isolates tested were slightly different in their antibiotic resistance profiles. Typically, a high level of resistance could be determined. The detection of tdh- and/or trh-positive V. parahaemolyticus strains for the first time on the Mediterranean coast emphasizes the need to monitor for the presence of potentially diarrheal vibrios and bacterial gastroenteritis, and these data should be taken into consideration to revise the European legislation on the requirements for shellfish harvested for consumption in order to include the surveillance of these pathogens in Europe. 相似文献
TABLE 1.
Vibrio parahaemolyticus isolates, serotypes, and origins and total number of vibrios/heterotrophic bacteria contained in the bivalveaIsolate | Date of collection | Organism and site of origin | Temp (°C) | Salinity (‰) | Gene(s) | Serotype | Bacterial count using indicated medium (CFU ml−1) | |
---|---|---|---|---|---|---|---|---|
TCBS agar | Marine agar | |||||||
I745 | 8 August 2006 | Mg-F | 24.5 | 37 | tdh | ND | 1.5 × 104 | 1.2 × 104 |
I793 | 14 August 2006 | Cg-A | 25 | 35 | tdh | ND | 9.2 × 102 | 8.5 × 103 |
I805 | 14 August 2006 | Cg-A | 25 | 35 | tdh | O2:KUT | 7.2 × 102 | 9 × 103 |
I806 | 14 August 2006 | Cg-A | 25 | 35 | tdh and trh | O3:K33 | 1.9 × 103 | 4.6 × 103 |
I809 | 14 August 2006 | Cg-A | 25 | 35 | tdh | O2:K28 | 8 × 104 | 7.3 × 102 |
I678 | 4 July 2006 | Rd-A | 28.6 | 36 | tdh | O2:K28 | 3.1 × 105 | 2.5 × 105 |
I628 | 4 July 2006 | Rd-A | 28.6 | 36 | tdh | O4:KUT | 2.9 × 104 | 8.4 × 104 |
I775 | 8 August 2006 | Cg-A | 24.5 | 37 | tdh | ND | 4.21 × 103 | 1.1 × 104 |
I691 | 4 July 2006 | Rd-A | 28.6 | 36 | trh | O1:K32 | 2.2 × 105 | 2.6 × 105 |
I712 | 27 July 2006 | Mg-A | 29.4 | 35.5 | trh | O1:KUT | 8.6 × 103 | 8.4 × 103 |
I765 | 8 August 2006 | Cg-F | 24.5 | 37 | trh | O4:K34 | 1 × 104 | Uncountable |
I980 | 22 July 2008 | Cg-A | 26.7 | 33.5 | tdh | O1:K32 | 2.7 × 104 | 1.3 × 104 |
I981 | 22 July 2008 | Cg-A | 26.7 | 33.5 | trh | O1:KUT | 1 × 104 | 2.2 × 104 |
I993 | 22 July 2008 | Cg-A | 26.7 | 33.5 | tdh | O5:K17 | 3 × 103 | 1.1 × 104 |
I994 | 29 July 2008 | Mg-A | 27.7 | 37 | trh | O3:KUT | 3.4 × 103 | 7 × 103 |
I1031 | 5 August 2008 | Cg-F | 27.7 | 37 | tdh | O5:KUT | 5.5 × 104 | 3.3 × 104 |
I1034 | 5 August 2008 | Cg-F | 27.7 | 37 | tdh | O3:KUT | 8.7 × 104 | 4 × 104 |
I1040 | 5 August 2008 | Cg-F | 27.7 | 37 | tdh | O3:KUT | 1.6 × 104 | 3.2 × 104 |
I1042 | 5 August 2008 | Cg-F | 27.7 | 37 | tdh and trh | ND | 2.8 ×104 | 3 × 104 |
I1050 | 5 August 2008 | Cg-F | 27.7 | 37 | tdh | O1:KUT | 4.7 × 104 | 7.3 × 104 |
I1063 | 20 August 2008 | Mg-F | 25.9 | 36 | tdh | O3:KUT | 7.9 ×104 | 1.4 × 104 |
I1065 | 20 August 2008 | Mg-F | 25.9 | 36 | tdh | O2:KUT | 2.2 × 103 | 1.2 × 104 |
I1068 | 20 August 2008 | Mg-F | 25.9 | 36 | tdh | O5:KUT | 2.6 × 104 | 5.2 × 104 |
I1069 | 20 August 2008 | Mg-F | 25.9 | 36 | tdh | O3:KUT | 2.4 × 103 | 5.3 × 104 |
I1073 | 20 August 2008 | Mg-F | 25.9 | 36 | tdh | O5:KUT | 2.3 × 103 | 7.5 × 103 |
I1074 | 20 August 2008 | Mg-F | 25.9 | 36 | tdh | O3:KUT | 7.6 × 104 | 6.9 × 104 |
I1077 | 20 August 2008 | Mg-F | 25.9 | 36 | tdh | O4:KUT | 1.7 × 103 | 1.6 × 103 |
I1079 | 20 August 2008 | Mg-F | 25.9 | 36 | trh | O3:KUT | 2.5 × 103 | 1.1 × 104 |
I1092 | 20 August 2008 | Mg-F | 25.9 | 36 | tdh | ND | 1.7 × 103 | 1.6 × 103 |
I1130 | 25 August 2008 | Rd-A | 26.4 | 35 | tdh | ND | 1.7 × 104 | 3.8 × 104 |
I1143 | 25 August 2008 | Rd-A | 26.4 | 35 | tdh | ND | 1.1 × 104 | 1.9 × 104 |
I1165 | 25 August 2008 | Rd-A | 26.4 | 35 | trh | O2:KUT | 4.4 × 104 | 6.8 × 104 |
I1133 | 25 August 2008 | Rp-F | 25.5 | 36.5 | tdh | ND | 3.4 × 104 | 4 × 104 |
I1134 | 25 August 2008 | Rp-F | 25.5 | 36.5 | tdh | ND | 3.9 × 104 | 5.8 × 104 |
I1158 | 25 August 2008 | Rp-F | 25.5 | 36.5 | trh | O4:KUT | 6.6 × 104 | 4.7 × 104 |
I1161 | 25 August 2008 | Rp-F | 25.5 | 36.5 | trh | O3:KUT | 2.2 × 104 | 6.6 × 104 |
16.
Banumathi Sankaran Shilah A. Bonnett Kinjal Shah Scott Gabriel Robert Reddy Paul Schimmel Dmitry A. Rodionov Valérie de Crécy-Lagard John D. Helmann Dirk Iwata-Reuyl Manal A. Swairjo 《Journal of bacteriology》2009,191(22):6936-6949
GTP cyclohydrolase I (GCYH-I) is an essential Zn2+-dependent enzyme that catalyzes the first step of the de novo folate biosynthetic pathway in bacteria and plants, the 7-deazapurine biosynthetic pathway in Bacteria and Archaea, and the biopterin pathway in mammals. We recently reported the discovery of a new prokaryotic-specific GCYH-I (GCYH-IB) that displays no sequence identity to the canonical enzyme and is present in ∼25% of bacteria, the majority of which lack the canonical GCYH-I (renamed GCYH-IA). Genomic and genetic analyses indicate that in those organisms possessing both enzymes, e.g., Bacillus subtilis, GCYH-IA and -IB are functionally redundant, but differentially expressed. Whereas GCYH-IA is constitutively expressed, GCYH-IB is expressed only under Zn2+-limiting conditions. These observations are consistent with the hypothesis that GCYH-IB functions to allow folate biosynthesis during Zn2+ starvation. Here, we present biochemical and structural data showing that bacterial GCYH-IB, like GCYH-IA, belongs to the tunneling-fold (T-fold) superfamily. However, the GCYH-IA and -IB enzymes exhibit significant differences in global structure and active-site architecture. While GCYH-IA is a unimodular, homodecameric, Zn2+-dependent enzyme, GCYH-IB is a bimodular, homotetrameric enzyme activated by a variety of divalent cations. The structure of GCYH-IB and the broad metal dependence exhibited by this enzyme further underscore the mechanistic plasticity that is emerging for the T-fold superfamily. Notably, while humans possess the canonical GCYH-IA enzyme, many clinically important human pathogens possess only the GCYH-IB enzyme, suggesting that this enzyme is a potential new molecular target for antibacterial development.The Zn2+-dependent enzyme GTP cyclohydrolase I (GCYH-I; EC 3.5.4.16) is the first enzyme of the de novo tetrahydrofolate (THF) biosynthesis pathway (Fig. (Fig.1)1) (38). THF is an essential cofactor in one-carbon transfer reactions in the synthesis of purines, thymidylate, pantothenate, glycine, serine, and methionine in all kingdoms of life (38), and formylmethionyl-tRNA in bacteria (7). Recently, it has also been shown that GCYH-I is required for the biosynthesis of the 7-deazaguanosine-modified tRNA nucleosides queuosine and archaeosine produced in Bacteria and Archaea (44), respectively, as well as the 7-deazaadenosine metabolites produced in some Streptomyces species (33). GCYH-I is encoded in Escherichia coli by the folE gene (28) and catalyzes the conversion of GTP to 7,8-dihydroneopterin triphosphate (55), a complex reaction that begins with hydrolytic opening of the purine ring at C-8 of GTP to generate an N-formyl intermediate, followed by deformylation and subsequent rearrangement and cyclization of the ribosyl moiety to generate the pterin ring in THF (Fig. (Fig.1).1). Notably, the enzyme is dependent on an essential active-site Zn2+ that serves to activate a water molecule for nucleophilic attack at C-8 in the first step of the reaction (2).Open in a separate windowFIG. 1.Reaction catalyzed by GCYH-I, and metabolic fate of 7,8-dihydroneopterin triphosphate.A homologous GCYH-I is found in mammals and other higher eukaryotes, where it catalyzes the first step of the biopterin (BH4) pathway (Fig. (Fig.1),1), an essential cofactor in the biosynthesis of tyrosine and neurotransmitters, such as serotonin and l-3,4-dihydroxyphenylalanine (3, 52). Recently, a distinct class of GCYH-I enzymes, GCYH-IB (encoded by the folE2 gene), was discovered in microbes (26% of sequenced Bacteria and most Archaea) (12), including several clinically important human pathogens, e.g., Neisseria and Staphylococcus species. Notably, GCYH-IB is absent in eukaryotes.The distribution of folE (gene product renamed GCYH-IA) and folE2 (GCYH-IB) in bacteria is diverse (12). The majority of organisms possess either a folE (65%; e.g., Escherichia coli) or a folE2 (14%; e.g., Neisseria gonorrhoeae) gene. A significant number (12%; e.g., B. subtilis) possess both genes (a subset of 50 bacterial species is shown in Table Table1),1), and 9% lack both genes, although members of the latter group are mainly intracellular or symbiotic bacteria that rely on external sources of folate. The majority of Archaea possess only a folE2 gene, and the encoded GCYH-IB appears to be necessary only for the biosynthesis of the modified tRNA nucleoside archaeosine (44) except in the few halophilic Archaea that are known to synthesize folates, such as Haloferax volcanii, where GCYH-IB is involved in both archaeosine and folate formation (13, 44).
TABLE 1.
Distribution and candidate Zur-dependent regulation of alternative GCYH-I genes in bacteriaaOpen in a separate windowaGenes that are preceded by candidate Zur binding sites.bZur-regulated cluster is on the virulence plasmid pLVPK.cExamples of organisms with no folE genes are in boldface type.dZn-dependent regulation of B. subtilis folE2 by Zur was experimentally verified (17).Expression of the Bacillus subtilis folE2 gene, yciA, is controlled by the Zn2+-dependent Zur repressor and is upregulated under Zn2+-limiting conditions (17). This led us to propose that the GCYH-IB family utilizes a metal other than Zn2+ to allow growth in Zn2+-limiting environments, a hypothesis strengthened by the observation that an archaeal ortholog from Methanocaldococcus jannaschii has recently been shown to be Fe2+ dependent (22). To test this hypothesis, we investigated the physiological role of GCYH-IB in B. subtilis, an organism that contains both isozymes, as well as the metal dependence of B. subtilis GCYH-IB in vitro. To gain a structural understanding of the metal dependence of GCYH-IB, we determined high-resolution crystal structures of Zn2+- and Mn2+-bound forms of the N. gonorrhoeae ortholog. Notably, although the GCYH-IA and -IB enzymes belong to the tunneling-fold (T-fold) superfamily, there are significant differences in their global and active-site architecture. These studies shed light on the physiological significance of the alternative folate biosynthesis isozymes in bacteria exposed to various metal environments, and offer a structural understanding of the differential metal dependence of GCYH-IA and -IB. 相似文献17.
Feeding high levels of zinc oxide to piglets significantly increased the relative abundance of ileal Weissella spp., Leuconostoc spp., and Streptococcus spp., reduced the occurrence of Sarcina spp. and Neisseria spp., and led to numerical increases of all Gram-negative facultative anaerobic genera. High dietary zinc oxide intake has a major impact on the porcine ileal bacterial composition.Zinc oxide (ZnO) is used as a feed additive for diarrhea prophylaxis in piglets (23). However, the mode of action of ZnO is not fully understood. Besides its effects on the host (10, 30, 31), high dietary zinc levels may affect the diversity of intestinal microbial communities (2, 11, 20). The prevention of postweaning diarrhea in piglets due to high dietary ZnO intake may not be directly related to a reduction of pathogenic E. coli (8) but, rather, to the diversity of the coliform community (15). Studies on the impact of high ZnO levels on the porcine ileal bacterial community are scarce but nevertheless important, as bacterial diarrhea is initiated in the small intestine (9, 17). The small intestine is a very complex habitat with many different factors shaping the bacterial community. Studies on the ecophysiology (22) and maturation of the porcine ileal microbiota (13, 27) indicate a drastic impact directly after weaning and a gradual decline of modifications during the following 2 weeks. Thus, the time point for analysis chosen in this study (14 days postweaning) does reflect a more stable period of the ileal porcine microbiota. In this study, we used bar-coded pyrosequencing of 16S rRNA genes to gain further insight into the mode of action of pharmacological levels of ZnO in the gastrointestinal tract of young pigs.Total DNA was extracted from the ileal digesta of 40- to 42-day-old piglets using a commercial kit (Qiagen stool kit; Qiagen, Hilden, Germany) and PCR amplified with unique bar-coded primer sets targeting the V1-to-V3 and the V6-to-V8 hypervariable regions (see the supplemental material for detailed methods). The rationale behind this approach was derived from the fact that no single “universal” primer pair can completely cover a complex bacterial habitat (4, 24, 32, 33). Furthermore, these studies also show that in silico information on the coverage of selected primer sets diverges from empirical results, and hence, two hypervariable regions were chosen in this study to maximize the detection of phylogenetically diverse bacterial groups.Equimolar dilutions of all samples were combined into one master sample. Pyrosequencing was performed by Agowa (Berlin, Germany) on a Roche genome sequencer FLX system using a Titanium series PicoTiterPlate. The resulting data files were uploaded to the MG-RAST server (http://metagenomics.nmpdr.org/) (19) and processed with its SEED software tool using the RDP database (5) as the reference database. After automated sequence analysis, all sequences with less than five identical reads per sample were deleted in order to increase the confidence of sequence reads and reduce bias from possible sequencing errors (12, 16). Thus, 0.43% of all sequences were not considered (1,882 of 433,302 sequences). These sequences were assigned to a total of 238 genera, of which most only occurred in a few samples (see the supplemental material). Furthermore, all unclassified sequences were removed (8.7%; 41,467 of 474,769 sequences). Due to the use of the RDP reference database, the SEED software incorrectly assigned the majority of unclassified sequences as unclassified Deferribacterales (83%; 34,393 sequences), which were actually identified as 16S soybean or wheat chloroplasts by BLAST or as cyanobacterial chloroplasts by the RDP II seqmatch tool.The pyrosequencing results for the two primer combinations were merged by taking only sequences from the primer combination that yielded the higher number of reads for a specific sequence assignment in a sample. The remaining reads were used to calculate the relative contribution of assigned sequences to total sequence reads in a sample.The Firmicutes phylum dominated the small intestinal bacterial communities in both the control group and the group with high dietary ZnO intake, with 98.3% and 97.0% of total sequence reads, respectively. No significant influence of high dietary ZnO intake was found for the main phyla Proteobacteria (0.92% versus 1.84%), Actinobacteria (0.61% versus 0.75%), Bacteroidetes (0.15% versus 0.17%), and Fusobacteria (0.09% versus 0.12%).On the order level, a total of 20 bacterial orders were detected (data not shown). Lactobacillales dominated bacterial communities in the control and high-dietary-ZnO-intake groups, with 83.37% and 93.24% of total reads. Lactic acid bacteria are well known to dominate the bacterial community in the ileum of piglets (11, 22). No significant difference between the control group and the group with high dietary ZnO intake was observed on the order level, although high dietary ZnO intake led to a strong numerical decrease for Clostridiales (14.4 ± 24.0% [mean ± standard deviation] versus 2.8 ± 1.7%), as well as to numerical increases for Pseudomonadales (0.3 ± 0.3% versus 0.6 ± 0.6%) and Enterobacteriales (0.2 ± 0.2% versus 0.5 ± 0.6%).On the genus level, a total of 103 genera were detected. Table Table11 summarizes the main 31 genera which exceeded 0.05% of total reads (see the supplemental material for a complete list). Lactobacilli clearly dominated the bacterial communities in both trial groups, but they also were numerically lower due to high dietary ZnO intake.
Open in a separate windowan = 6 piglets per trial group. A,B, results are significantly different by Kruskal-Wallis test.bSingle sample.Significant changes due to high dietary ZnO intake were observed for other lactic acid bacteria, including Weissella spp., Leuconostoc spp., and Streptococcus spp. A significant and strong decrease was observed for Sarcina spp., which is a genus of acid-tolerant strictly anaerobic species found in the intestinal tract of piglets and other mammals (6, 28, 29). This genus thus appeared to be very sensitive to modifications induced by high dietary ZnO intake.An interesting result was observed for Gram-negative Proteobacteria, (i.e., enterobacteria and relatives). Although not statistically significant, virtually all detected proteobacteria increased numerically due to high dietary ZnO intake (Enterobacter spp., Microbacterium spp., Citrobacter spp., Neisseria spp., and Acinetobacter spp.). Apparently, enterobacteria gained colonization potential by high dietary ZnO intake. This is in good agreement with the results of studies by Hojberg et al. (11), Amezcua et al. (1), and Castillo et al. (3). Therefore, the frequently observed diarrhea-reducing effect of zinc oxide may not be directly related to a reduction of pathogenic E. coli strains. Considering a possible antagonistic activity of lactobacilli against enterobacteria (25), it can be speculated that a numerical decrease of dominant lactobacilli may lead to increased colonization with Gram-negative enterobacteria. On the other hand, specific plasmid-borne genes for resistance against heavy metals have been reported for both Gram-positive and Gram-negative bacteria present in the intestine (21, 26), and an increased resistance against Zn ions may exist for Gram-negative enterobacteria. Zinc oxide is an amphoteric molecule and shows a high solubility at acid pH. The low pH in the stomach of piglets (pH 3.5 to 4.5) transforms a considerable amount of insoluble ZnO into zinc ions (54 to 84% free Zn2+ at 150 ppm and 24 ppm ZnO, respectively) (7), and thus, high concentrations of toxic zinc ions exist in the stomach. The stomach of piglets harbors large numbers of lactic acid bacteria, especially lactobacilli. Zn ions may thus lead to a modification of the lactic acid bacterial community in the stomach, and the changes observed in the ileum could have been created in the stomach. A reduction of dominant lactobacilli may thus point to an increased adaptation potential of Gram-negative facultative anaerobes and a generally increased bacterial diversity.Additionally, the direct effects of dietary ZnO on intestinal tissues include altered expression of genes responsible for glutathione metabolism and apoptosis (30), enhanced gastric ghrelin secretion, which increases feed intake (31), and increased production of digestive enzymes (10). An analysis of the intestinal morphology was beyond the scope of this study, but although ZnO concentrations are markedly increased in intestinal tissue, the influence of ZnO on morphology is apparently not always observed (10, 14, 18). Consequently, any changes in epithelial cell turnover, feed intake, or digestive capacity may influence the composition of bacterial communities in the small intestine.In conclusion, this study has shown that high dietary zinc oxide has a major impact on ileal bacterial communities in piglets. Future studies on the impact of zinc oxide in pigs should include a detailed analysis of host responses in order to identify the cause for the observed modifications of intestinal bacterial communities. 相似文献
TABLE 1.
Bacterial genera in the ileum of piglets fed diets supplemented with 200 or 3,000 ppm ZnOGenus | Proportion (% ± SD) of ileal microbiota in groupa receiving: | |
---|---|---|
200 ppm ZnO | 3,000 ppm ZnO | |
Lactobacillus | 59.3 ± 30.6 | 40.7 ± 19.1 |
Weissella | 11.6 ± 7.8 A | 24.1 ± 8.3 B |
Sarcina | 11.4 ± 20.5 A | 0.84 ± 1.2 B |
Leuconostoc | 4.7 ± 3.2 A | 9.4 ± 3.1 B |
Streptococcus | 1.8 ± 1.6 A | 5.7 ± 5.1 B |
Lactococcus | 1.6 ± 1.5 | 2.6 ± 3.1 |
Veillonella | 0.57 ± 0.63 | 0.34 ± 0.30 |
Gemella | 0.34 ± 0.67 A | 0.45 ± 0.25 B |
Acinetobacter | 0.25 ± 0.21 | 0.44 ± 0.50 |
Clostridium | 0.25 ± 0.40 | 0.22 ± 0.21 |
Enterococcus | 0.19 ± 0.15 | 0.26 ± 0.24 |
Acidovorax | 0.14 ± 0.04 | 0.16 ± 0.19 |
Arcobacter | 0.14 ± 0.15 | 0.16 ± 0.17 |
Neisseria | 0.14b | 0.03 ± 0.01 |
Enterobacter | 0.13 ± 0.09 | 0.29 ± 0.34 |
Lachnospira | 0.12 ± 0.13 | 0.13 ± 0.03 |
Peptostreptococcus | 0.11 ± 0.10 | 0.07 ± 0.09 |
Chryseobacterium | 0.10 ± 0.07 | 0.15 ± 0.16 |
Actinomyces | 0.09 ± 0.04 | 0.15 ± 0.16 |
Anaerobacter | 0.07 ± 0.08 | 0.02 ± 0.01 |
Aerococcus | 0.07 ± 0.04 | 0.07 ± 0.04 |
Dorea | 0.07b | 0.05 ± 0.05 |
Fusobacterium | 0.06 ± 0.09 | 0.08 ± 0.11 |
Microbacterium | 0.06 ± 0.01 | 0.07 ± 0.04 |
Carnobacterium | 0.06 ± 0.02 | 0.08 ± 0.13 |
Granulicatella | 0.06 ± 0.02 | 0.09 ± 0.10 |
Staphylococcus | 0.06 ± 0.04 | 0.05 ± 0.02 |
Facklamia | 0.05 ± 0.06 | 0.03 ± 0.01 |
Comamonas | 0.05 ± 0.03 | 0.04 ± 0.02 |
Citrobacter | 0.05 ± 0.02 | 0.07 ± 0.08 |
Erysipelothrix | 0.05 ± 0.01 | 0.22 ± 0.40 |
18.
Taiki Futagami Yuki Morono Takeshi Terada Anna H. Kaksonen Fumio Inagaki 《Applied and environmental microbiology》2009,75(21):6905-6909
Halogenated organic compounds serve as terminal electron acceptors for anaerobic respiration in a diverse range of microorganisms. Here, we report on the widespread distribution and diversity of reductive dehalogenase homologous (rdhA) genes in marine subsurface sediments. A total of 32 putative rdhA phylotypes were detected in sediments from the southeast Pacific off Peru, the eastern equatorial Pacific, the Juan de Fuca Ridge flank off Oregon, and the northwest Pacific off Japan, collected at a maximum depth of 358 m below the seafloor. In addition, significant dehalogenation activity involving 2,4,6-tribromophenol and trichloroethene was observed in sediment slurry from the Nankai Trough Forearc Basin. These results suggest that dehalorespiration is an important energy-yielding pathway in the subseafloor microbial ecosystem.Scientific ocean drilling explorations have revealed that marine subsurface sediments harbor remarkable numbers of microbial cells that account for approximately 1/10 to 1/3 of all living biota on Earth (20, 25, 33). Thermodynamic calculations of pore-water chemistry suggest that subseafloor microbial activities are generally supported by nutrient and energy supplies from the seawater and/or underlying basaltic aquifers (6, 7). Although sulfate, nitrate, Fe(III), Mn(IV), and bicarbonate are known to be potential electron acceptors for anaerobic microbial respiration in marine subsurface sediments (5), the incidence of both the dissimilatory dehalorespiration pathway and microbial activity in halogenated organic substrates remains largely unknown.Previous molecular ecological studies using 16S rRNA gene sequences demonstrated that Chloroflexi is one of the most frequently detected phyla in subseafloor sediments of the Pacific Ocean margins (12-14). Some of the sequences within the Chloroflexi are closely related to sequences in the genus Dehalococcoides, which contains obligatory dehalorespiring bacteria that employ halogenated organic compounds as terminal electron acceptors (21, 29). The frequent detection of Dehalococcoides-related 16S rRNA genes from these environments implies the occurrence of dissimilatory dehalorespiration in marine subsurface sediments.In this study, we detected and phylogenetically analyzed the reductive dehalogenase homologous (rdhA) genes, key functional genes for dehalorespiration pathways, from frozen sediment core samples obtained by Ocean Drilling Program (ODP) Leg 201 (Peru margin and eastern equatorial Pacific) (7, 14); Integrated Ocean Drilling Program (IODP) Expedition 301 (Juan de Fuca Ridge flank) (8, 24); Chikyu Shakedown Expedition CK06-06 (Northwest Pacific off Japan) (20, 23); and IODP Expedition 315 (Nankai Trough Forearc Basin off Japan) (Table (Table1).1). DNA was extracted using an ISOIL bead-beating kit (Nippon Gene, Japan) and purified using a MagExtractor DNA fragment purification kit (Toyobo, Japan) according to the manufacturer''s instructions. To increase concentration, DNA was amplified by multiple displacement amplification using the phi29 polymerase supplied with a GenomiPhi kit (GE Healthcare, United Kingdom) (20). Putative rdhA genes were amplified by PCR using Ex Taq polymerase (TaKaRa, Japan) with degenerate primers RRF2 and B1R (17), dehaloF3, dehaloF4, dehaloF5, dehaloR2, dehaloR3, and dehaloR4 (32), and ceRD2S, ceRD2L, and RD7 (26) and the PCR conditions described in those studies. Amplicons of the approximate target size were gel purified and cloned into the pCR2.1 vector (Invitrogen, Japan). Sequence similarity was analyzed using FastGroupII web-based software (34), and sequences with a 95% identity were tentatively assigned to the same phylotype. Amino acid sequences were aligned by ClustalW (31), including known and putative reductive dehalogenase sequences in the genome of Dehalococcoides ethenogenes strain 195 (28), as well as several functionally characterized reductive dehalogenases from other species.
Open in a separate windowa−, PCR product of expected size not amplified; +, PCR product of expected size weakly amplified; ++, PCR product of expected size amplified and confirmed by sequencing analysis.Putative rdhA genes were successfully detected by primer set RRF2-B1R in samples from the eastern equatorial Pacific (ODP site 1226, 3.2 and 46.7 m below the seafloor [mbsf]), the Peru margin (ODP site 1227, 0.3, 16.6, and 75.1 mbsf, and ODP site 1230, 0.3 mbsf), the Juan de Fuca Ridge flank (IODP site 1301, 2.5 mbsf), offshore from the Shimokita Peninsula of Japan (CK06-06 site C9001, 1.0, 13.5, 78.5, 191.5, 216.8, and 358.6 mbsf), and the Nankai Trough Forearc Basin off the Kii Peninsula of Japan (IODP site C0002, 1.9, 9.2, 20.2, and 66.6 mbsf) (Table (Table1).1). No amplification was observed in samples from several deep horizons at sites 1227, 1230, 1301, C9001, and C0002 (Table (Table1).1). A total of 92 clones of subseafloor putative rdhA genes were sequenced and classified into 32 phylotypes (Fig. (Fig.1).1). Phylogenetic analysis revealed that all of the detected putative rdhA sequences were related to those of Dehalococcoides.Open in a separate windowFIG. 1.Phylogenetic tree based on the deduced amino acid sequences of rdhA genes, including sequences from marine subsurface sediments. Putative rdhA sequences from marine subsurface sediments (rdhA clones 1 to 32) are marked in red, while those of the Dehalococcoides genome are marked in blue. Clonal frequencies and sequence accession numbers are indicated in parentheses. Bootstrap values from 50% to 84% and 85% to 100% are indicated by open and solid circles at the branches, respectively. Asterisks indicate the following functionally characterized rdhA genes: pceA and prdA, tetrachloroethene reductive dehalogenase; tceA, trichloroethene reductive dehalogenase; vcrA and bvcA, vinyl chloride reductive dehalogenase; dcaA, 1,2-dichloroethane reductive dehalogenase; cprA, chlorophenol reductive dehalogenase; and cbrA, chlorobenzene reductive dehalogenase. The tree was constructed by a neighbor-joining (NJ) method based on an alignment of almost-complete rdhA amino acid sequences with pairwise gap deletion on MEGA version 4.0 software (30). The resulting tree was displayed using Interactive Tree Of Life (19). The scale bar represents 0.1 substitutions per amino acid position.In the alignment of the subseafloor rdhA sequences, we observed two Fe-S cluster-binding motifs as a conserved structure of previously reported reductive dehalogenases (29). The sequences were amplified with primer RRF2 containing the N-terminal twin arginine translocation (Tat) signal sequence and primer B1R containing the rdhB genes encoding a putative dehalogenase membrane anchor protein (17). Thus, the dehalogenases of subseafloor bacteria have a structural framework similar to that of known dehalogenases from terrestrial Dehalococcoides species. However, BLASTP analysis showed that similarities among subseafloor rdhA sequences and previously reported dehalogenase sequences were generally low, ranging from 33.06% to 64.27%. Some sequences were affiliated, with relatively high bootstrap values, with subseafloor rdhA clusters I and II, which are clearly distinct from the rdhA sequences of Dehalococcoides and other known species (Fig. (Fig.1).1). In addition, we were unable to detect subseafloor rdhA genes using other primer sets targeting cprA- and pceA-like genes (26, 32). These results indicate that most subseafloor rdhA genes are distinct from those reported from terrestrial environments, a trend that corroborates the results of a metagenomic survey of subseafloor microbial communities at the Peruvian site (3). However, it is worth noting that the RRF2 and B1R primers used in this study are based on the rdhA sequences present in Dehalococcoides (17) and that sequence retrieval is probably biased by primer mismatch. It is thus likely that there are still unexplored functional genes related to the dehalorespiration pathways in marine subsurface sediments.An interesting finding of the functional gene survey is that the subseafloor rdhA homologues are preferentially detected in shallow sediments. At site C9001 off Japan, the sedimentation ratio is considerably higher than at other sites (54 to 95 cm per 1,000 years) (unpublished data), and rdhA genes were successfully detected in horizons as deep as 358 mbsf (Table (Table1).1). The rdhA genes were also detected in sediments from the open ocean at site 1226, which contained very low concentrations (<0.2%) of organic matter (7). This may be because halogenated compounds are derived not only from terrestrial environments but also from the seawater overlying the sediments. In addition, a diverse range of marine organisms, such as phytoplankton, mollusks, algae, polychaetes, jellyfish, and sponges, are known to produce halogenated organic compounds (11). For example, the amount of brominated organic compounds in the ocean has been estimated at 1 to 2 million tons per year (10). Since these halogenated compounds are generally recalcitrant or not metabolizable by aerobic microorganisms in the seawater column (15), they are effectively buried in marine subsurface sediments. In fact, debromination of brominated phenols in marine, estuarine, or intertidal strait sediments has been reported (4, 9, 16, 22), and a brominated phenol-dehalogenating microbial community has been observed in the marine sponge Aplysina aerophoba, which produces bromophenolic metabolites (1).We also observed reductive dehalogenation activity in subseafloor sediment slurry from site C0002 in the Nankai Trough (Fig. (Fig.2;2; also see the supplemental material). The slurry sample was prepared by mixing sediment samples from 1.9, 4.7, 9.2, 13.4, 20.2, 30.0, 66.6, and 155.4 mbsf. During the initial incubation with 2,4,6-tribromophenol (2,4,6-TBP) for 179 days, 2,4,6-TBP was completely converted to phenol. We then supplemented the same incubation slurry with 2,4,6-TBP and once again observed dehalogenation activity (Fig. (Fig.2A).2A). During the incubation, 2,4-dibromophenol and 4-bromophenol were produced as intermediates (Fig. (Fig.2C),2C), suggesting that ortho debromination occurred in preference to para debromination, as observed previously in marine sponge habitats (1). The maximum phenol production rate during the second incubation was calculated to be 0.094 μM per 1 cm3 of sediment per day (Fig. (Fig.2A2A).Open in a separate windowFIG. 2.Dehalogenation activities of subseafloor microbes. (A) Debromination of 2,4,6-TBP in a subseafloor sediment slurry from site C0002 in the Nankai Trough Forearc Basin. Arrow indicates the timing of 2,4,6-TBP supplementation. (B) Dechlorination of TCE in the same slurry sample. Sterilized control sediment slurries did not exhibit phenol and/or cis-DCE production (data not shown). (C) Potential debromination pathway of 2,4,6-TBP (solid arrows) and (D) potential dechlorination pathway of TCE (solid arrows) observed. The pathways indicated by dashed arrows were not observed in this experiment.Using the same sediment slurry sample, we also observed dehalogenation activity of trichloroethene (TCE), a substantial pollutant in the natural environment. During an incubation lasting more than 200 days, TCE was almost entirely converted to cis-dichloroethene (cis-DCE) (Fig. (Fig.2B).2B). The subsequent dechlorination step of cis-DCE, which is presumably from cis-DCE to monochloroethene, was not observed during the incubation. The rate of cis-DCE production was calculated as 0.045 μM per 1 cm3 of sediment per day.In conclusion, the observed molecular and activity data suggest that metabolically active dehalorespiring microbes are well represented in marine subsurface sediments and that these microbes may be widely distributed in Pacific Ocean margin sediments. Given the relatively high in vitro activity rates, we expect that subseafloor dehalorespiring microbes play important ecological roles in the biogeochemical cycles of chlorine, iodine, and bromine, as well as in halogenated carbon substrates. The distribution of in situ activity rates, chemical and geophysical constraints, metabolic characteristics of the individual dehalorespiring phylotypes, and genetic and enzymatic mechanisms of the microbes remain to be clarified. Nevertheless, the findings of this study provide new evidence of microbial functioning in the subseafloor ecosystem. 相似文献
TABLE 1.
Sample locations and results of PCR amplification of rdhASampling site (expedition name) | Location | Water depth (m) | Core section | Sediment depth (mbsf) | rdh amplification resulta |
---|---|---|---|---|---|
1226 (ODP Leg 201) | Eastern equatorial Pacific | 3,297 | 1-3 | 3.2 | ++ |
6-3 | 46.7 | ++ | |||
1227 (ODP Leg 201) | Southeast Pacific off Peru | 427 | 1-1 | 0.3 | + |
3-2 | 16.6 | + | |||
5D-5 | 42.0 | − | |||
9-3 | 75.1 | + | |||
1230 (ODP Leg 201) | Southeast Pacific off Peru | 5,086 | 1-1 | 0.3 | ++ |
10-3 | 73.8 | − | |||
27-3 | 209.3 | − | |||
1301 (IODP Expedition 301) | Northeast Pacific Juan de Fuca Ridge flank off Oregon | 2,656 | 1-2 | 2.5 | + |
6-6 | 51.2 | − | |||
11-1 | 90.8 | − | |||
1D-2 | 132.5 | − | |||
C9001 (JAMSTEC Chikyu Shakedown Expedition CK06-06) | Northwest Pacific off Japan | 1,180 | 1-1 | 1.0 | ++ |
2-5 | 13.5 | ++ | |||
9-4 | 78.5 | + | |||
21-4 | 191.5 | + | |||
24-4 | 216.8 | ++ | |||
25-6 | 228.9 | − | |||
38-7 | 346.3 | − | |||
40-3 | 358.6 | + | |||
C0002 (IODP Expedition 315) | Nankai Trough Forearc Basin off Japan | 1,937 | 1-3 | 1.9 | + |
1-6 | 4.7 | − | |||
2-4 | 9.2 | + | |||
2-8 | 13.4 | − | |||
3-5 | 20.2 | + | |||
4-5 | 30.0 | − | |||
8-3 | 66.6 | + | |||
16-4 | 155.4 | − |
19.
Francisco J. Roig A. Llorens B. Fouz C. Amaro 《Applied and environmental microbiology》2009,75(8):2577-2580
This work demonstrates that Vibrio vulnificus biotype 2, serovar E, an eel pathogen able to infect humans, can become resistant to quinolone by specific mutations in gyrA (substitution of isoleucine for serine at position 83) and to some fluoroquinolones by additional mutations in parC (substitution of lysine for serine at position 85). Thus, to avoid the selection of resistant strains that are potentially pathogenic for humans, antibiotics other than quinolones must be used to treat vibriosis on farms.Vibrio vulnificus is an aquatic bacterium from warm and tropical ecosystems that causes vibriosis in humans and fish (http://www.cdc.gov/nczved/dfbmd/disease_listing/vibriov_gi.html) (33). The species is heterogeneous and has been subdivided into three biotypes and more than eight serovars (6, 15, 33; our unpublished results). While biotypes 1 and 3 are innocuous for fish, biotype 2 can infect nonimmune fish, mainly eels, by colonizing the gills, invading the bloodstream, and causing death by septicemia (23). The disease is rapidly transmitted through water and can result in significant economic losses to fish farmers. Surviving eels are immune to the disease and can act as carriers, transmitting vibriosis between farms. Interestingly, biotype 2 isolates belonging to serovar E have been isolated from human infections, suggesting that serovar E is zoonotic (2). This serovar is also the most virulent for fish and has been responsible for the closure of several farms due to massive losses of fish. A vaccine, named Vulnivaccine, has been developed from serovar E isolates and has been successfully tested in the field (14). Although the vaccine provides fish with long-term protection from vibriosis, at present its use is restricted to Spain. For this reason, in many fish farms around the world, vibriosis is treated with antibiotics, which are usually added to the food or water.Quinolones are considered the most effective antibiotics against human and fish vibriosis (19, 21, 31). These antibiotics can persist for a long time in the environment (20), which could favor the emergence of resistant strains under selective pressure. In fact, spontaneous resistances to quinolones by chromosomal mutations have been described for some gram-negative bacteria (10, 11, 17, 24, 25, 26). Therefore, improper antibiotic treatment of eel vibriosis or inadequate residue elimination at farms could favor the emergence of human-pathogenic serovar E strains resistant to quinolones by spontaneous mutations. Thus, the main objective of the present work was to find out if the zoonotic serovar of biotype 2 can become quinolone resistant under selective pressure and determine the molecular basis of this resistance.Very few reports on resistance to antibiotics in V. vulnificus have been published; most of them have been performed with biotype 1 isolates. For this reason, the first task of this study was to determine the antibiotic resistance patterns in a wide collection of V. vulnificus strains belonging to the three biotypes that had been isolated worldwide from different sources (see Table S1 in the supplemental material). Isolates were screened for antimicrobial susceptibility to the antibiotics listed in Table S1 in the supplemental material by the agar diffusion disk procedure of Bauer et al. (5), according to the standard guideline (9). The resistance pattern found for each isolate is shown in Table S1 in the supplemental material. Less than 14% of isolates were sensitive to all the antibiotics tested, and more than 65% were resistant to more than one antibiotic, irrespective of their biotypes or serovars. The most frequent resistances were to ampicillin-sulbactam (SAM; 65.6% of the strains) and nitrofurantoin (F; 60.8% of the strains), and the least frequent were to tetracycline (12%) and oxytetracycline (8%). In addition, 15% of the strains were resistant to nalidixic acid (NAL) and oxolinic acid (OA), and 75% of these strains came from fish farms (see Table S1 in the supplemental material). Thus, high percentages of strains of the three biotypes were shown to be resistant to one or more antibiotics, with percentages similar to those found in nonbiotyped environmental V. vulnificus isolates from Asia and North America (4, 27, 34). In those studies, resistance to antibiotics could not be related to human contamination. However, the percentage of quinolone-resistant strains found in our study is higher than that reported in other ones, probably due to the inclusion of fish farm isolates, where the majority of quinolone-resistant strains were concentrated. This fact suggests that quinolone resistance could be related to human contamination due to the improper use of these drugs in therapy against fish diseases, as has been previously suggested (18, 20). Although no specific resistance pattern was associated with particular biotypes or serovars, we found certain differences in resistance distribution, as shown in Table Table1.1. In this respect, biotype 3 displayed the narrowest spectrum of resistances and biotype 1 the widest. The latter biotype encompassed the highest number of strains with multiresistance (see Table S1 in the supplemental material). Within biotype 2, there were differences among serovars, with quinolone resistance being restricted to the zoonotic serovar (Table (Table11).
Open in a separate windowaCTX, cefotaxime; E, erythromycin; OT, oxytetracycline; SXT-TMP, sulfamethoxazole-trimethoprim; TE, tetracycline.The origin of resistance to quinolones in the zoonotic serovar was further investigated. To this end, spontaneous mutants of sensitive strains were selected from colonies growing within the inhibition halo around OA or NAL disks. Two strains (strain CG100 of biotype 1 and strain CECT 4604 of biotype 2, serovar E) developed isolated colonies within the inhibition zone. These colonies were purified, and maintenance of resistance was confirmed by serial incubations on medium without antibiotics. Using the disk diffusion method, CG100 was shown to be resistant to SAM and F and CECT 4604 to F (see Table S1 in the supplemental material). The MICs for OA, NAL, flumequine (UB), and ciprofloxacin (CIP) were determined by using the microplate assay according to the recommendations of the Clinical and Laboratory Standards Institute and the European Committee for Antimicrobial Susceptibility Testing of the European Society of Clinical Microbiology and Infectious Diseases (8, 12) and interpreted according to the European Committee for Antimicrobial Susceptibility Testing of the European Society of Clinical Microbiology and Infectious Diseases (13). The MICs for OA and NAL and for the fluoroquinolones UB and CIP exhibited by the mutants and their counterparts are shown in Table Table2.2. The inhibition zone diameters correlated well with MICs (data not shown). Mutants FR1, FR2, FR3, and FR4 were resistant to NAL and sensitive to the remaining quinolones, although they showed higher resistances than their parental strains (Table (Table2).2). Thus, these four mutants showed increases of 32- to 128-fold for NAL MICs, 4- to 8-fold for UB MICs, and 16-fold for CIP MICs (Table (Table2).2). The fifth mutant, FR5, was resistant to the two tested quinolones and to UB, a narrow-spectrum fluoroquinolone. This mutant, although sensitive to CIP, multiplied its MIC for this drug by 128 with respect to the parental strain (Table (Table22).
Open in a separate windowaMutations in a nucleotide (nt) that gave rise to a codon change and to a change in amino acids (aa) are indicated. NC, no change detected.bThe resistance (R) or sensitivity (S) against the antibiotic determined according to the Clinical and Laboratory Standards Institute and the European Committee for Antimicrobial Susceptibility Testing of the European Society of Clinical Microbiology and Infectious Diseases (9, 13) is indicated in parentheses.For other gram-negative pathogens, quinolone resistance relies on spontaneous mutations in the gyrA, gyrB, parC, and parE genes that occur in a specific region of the protein known as the quinolone resistance-determining region (QRDR) (1, 11, 17, 24, 25, 26, 28). To test the hypothesis that mutations in these genes could also produce quinolone resistance in V. vulnificus, the QRDRs of these genes were sequenced in the naturally resistant strains and in the two sensitive strains that had developed resistances by selective pressure in vitro. The genomic DNA was extracted (3), and the QRDRs of gyrA, gyrB, parE, and parC were amplified using the primers shown in Table Table3,3, which were designed from the published genomes of biotype 1 strains YJ016 and CMCP6 (7, 22). PCR products of the predicted size were sequenced in an ABI 3730 sequencer (Applied Biosystems). Analysis of the QRDR sequences for gyrA, gyrB, parC, and parE of the mutants and the naturally resistant strains revealed that all naturally resistant strains, except one, shared a specific mutation at nucleotide position 248 with the laboratory-induced mutants (Table (Table2).2). This mutation gave rise to a change from serine to isoleucine at amino acid position 83. The exception was a mutation in the adjacent nucleotide that gave rise to a substitution of arginine for serine at the same amino acid position (Table (Table2).2). All the isolates that were resistant to the quinolone NAL had a unique mutation in the gyrA gene, irrespective of whether resistance was acquired naturally or in the laboratory (Table (Table2).2). This result strongly suggests that a point mutation in gyrA that gives rise to a change in nucleotide position 83 can confer resistance to NAL in V. vulnificus biotypes 1 and 2 and that this mutation could be produced by selective pressure under natural conditions. gyrA mutations consisting of a change from serine 83 to isoleucine have also been described in isolates of Aeromonas from water (17) and in diseased fish isolates of Vibrio anguillarum (26). Similarly, replacement of serine by arginine at amino acid position 83 in diseased fish isolates of Yersinia ruckeri (16) suggests that this mechanism of quinolone resistance is widespread among gram-negative pathogens. In all cases, these single mutations were also related to increased resistance to other quinolones (OA) and fluoroquinolones (UB and CIP) (Table (Table2),2), although the mutants remained sensitive according to the standards of the Clinical and Laboratory Standards Institute and the European Committee for Antimicrobial Susceptibility Testing of the European Society of Clinical Microbiology and Infectious Diseases (9, 13). A total of 50% of the naturally resistant strains, all of them of biotype 1, showed additional mutations that affected parC (a change in amino acid position 113) or gyrB (changes in amino acids at positions 425 and 438) (Table (Table2).2). These strains exhibited higher MICs for OA and fluoroquinolones (Table (Table2),2), although they were still sensitive to these drugs (9, 13). Finally, one isolate of biotype 2, serovar E, which was naturally resistant to quinolones and UB, showed a mutation in parC that gave rise to a substitution of leucine for serine at amino acid position 85 (Table (Table2).2). This mutation was shared only with the laboratory-induced mutant, also a biotype 2, serovar E mutant, which was resistant to the fluoroquinolone UB. The same mutation in parC had been previously described in diseased fish isolates of V. anguillarum that were highly resistant to quinolones (28), but this had not been related to fluoroquinolone resistance in Vibrio spp. nor in other gram-negative bacteria. These results strongly suggest that resistance to fluoroquinolones in V. vulnificus is related to specific mutations in gyrA and parC and that mutations in different positions for parC or in gyrB could contribute to increased resistance to quinolones and fluoroquinolones. Our results also agree with previous studies confirming that the acquisition of higher quinolone resistance is more probable when arising from a gyrA parC double mutation than from a gyrA gyrB double mutation (29).
Open in a separate windowFinally, the evolutionary history for each protein was inferred from previously published DNA sequences of the whole genes from different Vibrio species after multiple sequence alignment with MEGA4 software (32) by applying the neighbor-joining method (30) with the Poisson correction (35). The distance tree for each whole protein showed a topology similar to the phylogenetic tree based on 16S rRNA analysis, with the two isolates of V. vulnificus forming a single group, closely related to Vibrio parahaemolyticus, Vibrio cholerae, V. anguillarum, and Vibrio harveyi (see Fig. S1A in the supplemental material). A second analysis was performed with the QRDR sequences of the different mutants and isolates of V. vulnificus (GenBank accession numbers ) to infer the intraspecies relationships (see Fig. S1B in the supplemental material). This analysis showed that QRDRs of gyrA, gyrB, parC, and parE were highly homogeneous within V. vulnificus.In summary, the zoonotic serovar of V. vulnificus can mutate spontaneously to gain quinolone resistance, under selective pressure in vitro, due to specific mutations in gyrA that involve a substitution of isoleucine for serine at amino acid position 83. This mutation appears in biotype 2, serovar E diseased-fish isolates and biotype 1 strains, mostly recovered from fish farms. An additional mutation in parC, resulting in a substitution of lysine for serine at amino acid position 85, seems to endow partial fluoroquinolone resistance on biotype 2, serovar E strains. This kind of double mutation is present in diseased-fish isolates of the zoonotic serovar but not in resistant biotype 1 isolates, which show different mutations in gyrB or in parC that increase their resistance levels but do not make the strains resistant to fluoroquinolones. Thus, antibiotics other than quinolones should be used at fish farms to prevent the emergence and spread of quinolone resistances, especially to CIP, a drug widely recommended for human vibriosis treatment. FJ379836 to FJ379927 相似文献
TABLE 1.
Percentage of resistant strains distributed by biotypes and serovarsV. vulnificus | No. of isolates | Resistance distribution (%) for indicated antibiotica
| ||||||||
---|---|---|---|---|---|---|---|---|---|---|
SAM | CTX | E | NAL | F | OT | OA | SXT-TMP | TE | ||
Biotype 1 | 49 | 75.5 | 24.5 | 14.3 | 30.6 | 83.7 | 8.2 | 30.6 | 28.6 | 8.2 |
Biotype 2 (whole) | 72 | 58.3 | 13.9 | 12.5 | 4.2 | 47.2 | 9.7 | 4.2 | 4.2 | 13.9 |
Biotype 2 | ||||||||||
Serovar E | 36 | 30.3 | 12.1 | 3 | 9.1 | 27.3 | 15.2 | 9.1 | 3 | 21.2 |
Serovar A | 23 | 100 | 9.1 | 18.2 | 0 | 77.3 | 0 | 0 | 9.1 | 4.6 |
Nontypeable | 8 | 29 | 14.3 | 25 | 0 | 57.1 | 14.3 | 0 | 0 | 14.3 |
Serovar I | 5 | 100 | 20 | 20 | 0 | 20 | 20 | 0 | 0 | 0 |
Biotype 3 | 5 | 100 | 0 | 20 | 0 | 80 | 0 | 0 | 0 | 20 |
TABLE 2.
MICs for quinolones and fluoroquinolones and mutations in gyrA, gyrB, and parC detected in naturally and artificially induced resistant strainsStrain(s) | MIC (μg ml−1) for indicated antibioticb
| Gene mutationa
| ||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
gyrA
| gyrB
| parC
| ||||||||||||||
Position
| Codon change | aa change | Position
| Codon change | aa change | Position
| Codon change | aa change | ||||||||
NAL | OA | UB | CIP | nt | aa | nt | aa | nt | aa | |||||||
CG100 | 0.5 (S) | 0.125 (S) | 0.0625 (S) | 0.0078 (S) | ||||||||||||
FR1 | 16 (R) | 1 (S) | 0.25 (S) | 0.125 (S) | 248 | 83 | AGT→ATT | S→I | NC | NC | NC | NC | NC | NC | NC | NC |
FR2 | 16 (R) | 1 (S) | 0.25 (S) | 0.125 (S) | 248 | 83 | AGT→ATT | S→I | NC | NC | NC | NC | NC | NC | NC | NC |
CECT 4604 | 0.25 (S) | 0.0625 (S) | 0.0625 (S) | 0.0078 (S) | ||||||||||||
FR3 | 32 (R) | 2 (S) | 0.5 (S) | 0.125 (S) | 248 | 83 | AGT→ATT | S→I | NC | NC | NC | NC | NC | NC | NC | NC |
FR4 | 32 (R) | 2 (S) | 0.5 (S) | 0.125 (S) | 248 | 83 | AGT→ATT | S→I | NC | NC | NC | NC | NC | NC | NC | NC |
FR5 | 256 (R) | 16 (R) | 16 (R) | 1 (S) | 248 | 83 | AGT→ATT | S→I | 1156 | 386 | GCA→ACA | A→T | 254 | 85 | TCA→TTA | S→L |
1236 | 412 | CAG→CAC | Q→H | |||||||||||||
CECT 4602 | 128 (R) | 8 (R) | 64 (R) | 1 (S) | 248 | 83 | AGT→ATT | S→I | NC | NC | NC | NC | 254 | 85 | TCA→TTA | S→L |
CECT 4603, CECT 4606, CECT 4608, PD-5, PD-12, JE | 32 (R) | 2 (S) | <1 (S) | <1 (S) | 248 | 83 | AGT→ATT | S→I | NC | NC | NC | NC | NC | NC | NC | NC |
CECT 4862 | 64 (R) | 2 (S) | 2 (S) | <1 (S) | 249 | 83 | AGT→AGA | S→R | NC | NC | NC | NC | NC | NC | NC | NC |
A2, A4, A5, A6, A7, PD-1, PD-3 | 64-128 (R) | 2 (S) | 4 (S) | <1 (S) | 248 | 83 | AGT→ATT | S→I | NC | NC | NC | NC | 338 | 113 | GCA→GTA | A→V |
V1 | 128 (R) | 4 (S) | 4 (S) | <1 (S) | 248 | 83 | AGT→ATT | S→I | 1274 | 425 | GAG→GGG | E→G | NC | NC | NC | NC |
1314 | 438 | AAC→AAA | N→K |
TABLE 3.
Oligonucleotides used in this studyPrimer | Sequence | Annealing temp (°C) | Size (bp) |
---|---|---|---|
GyrAF | GGCAACGACTGGAATAAACC | 55.8 | 416 |
GyrAR | CAGCCATCAATCACTTCCGTC | ||
ParCF | CGCAAGTTCACCGAAGATGC | 56.6 | 411 |
ParCR | GGCATCCGCAACTTCACG | ||
GyrBF | CGACTTCTGGTGACGATGCG | 57.4 | 642 |
GyrBR | GACCGATACCACAACCTAGTG | ||
ParEF | GCCAGGTAAGTTGACCGATTG | 56.8 | 512 |
ParER | CACCCAGACCTTTGAATCGTTG |
20.
Aurelio Cafaro Stefania Bellino Fausto Titti Maria Teresa Maggiorella Leonardo Sernicola Roger W. Wiseman David Venzon Julie A. Karl David O'Connor Paolo Monini Marjorie Robert-Guroff Barbara Ensoli 《Journal of virology》2010,84(17):8953-8958
The effects of the challenge dose and major histocompatibility complex (MHC) class IB alleles were analyzed in 112 Mauritian cynomolgus monkeys vaccinated (n = 67) or not vaccinated (n = 45) with Tat and challenged with simian/human immunodeficiency virus (SHIV) 89.6Pcy243. In the controls, the challenge dose (10 to 20 50% monkey infectious doses [MID50]) or MHC did not affect susceptibility to infection, peak viral load, or acute CD4 T-cell loss, whereas in the chronic phase of infection, the H1 haplotype correlated with a high viral load (P = 0.0280) and CD4 loss (P = 0.0343). Vaccination reduced the rate of infection acquisition at 10 MID50 (P < 0.0001), and contained acute CD4 loss at 15 MID50 (P = 0.0099). Haplotypes H2 and H6 were correlated with increased susceptibility (P = 0.0199) and resistance (P = 0.0087) to infection, respectively. Vaccination also contained CD4 depletion (P = 0.0391) during chronic infection, independently of the challenge dose or haplotype.Advances in typing of the major histocompatibility complex (MHC) of Mauritian cynomolgus macaques (14, 20, 26) have provided the opportunity to address the influence of host factors on vaccine studies (13). Retrospective analysis of 22 macaques vaccinated with Tat or a Tat-expressing adenoviral vector revealed that monkeys with the H6 or H3 MHC class IB haplotype were overrepresented among aviremic or controller animals, whereas macaques with the H2 or H5 haplotype clustered in the noncontrollers (12). More recently, the H6 haplotype was reported to correlate with control of chronic infection with simian immunodeficiency virus (SIV) mac251, regardless of vaccination (18).Here, we performed a retrospective analysis of 112 Mauritian cynomolgus macaques, which included the 22 animals studied previously (12), to evaluate the impact of the challenge dose and class IB haplotype on the acquisition and severity of simian/human immunodeficiency virus (SHIV) 89.6Pcy243 infection in 45 control monkeys and 67 monkeys vaccinated with Tat from different protocols (Table (Table11).
Open in a separate windowaAll animals were inoculated with the indicated dose of Tat plasmid DNA (pCV-tat [8], adenovirus-tat [Ad-tat] [27]) or protein, Gag protein, or empty vectors (pCV-0, adenovirus [Ad]) by the indicated route. Doses are in micrograms unless indicated otherwise.bAlum, aluminum phosphate (4); RIBI oil-in-water emulsions containing squalene, bacterial monophosphoryl lipid A, and refined mycobacterial products (4); Iscom, immune-stimulating complex (4); H1D are biocompatible anionic polymeric microparticles used for vaccine delivery (10, 12, 25a).cs.c., subcutaneous; i.m., intramuscular; i.d., intradermal; i.n., intranasal; i.t., intratracheal.dAll animals were inoculated intravenously with the indicated dose of the same SHIV89.6.Pcy243 stock.eAccording to the virological outcome upon challenge, monkeys were grouped as aviremic (A), controllers (C), or viremic (V).fBecause of the short follow-up, controller status could not be determined and all infected monkeys of the ISS-TG protocol were therefore considered viremic.gNA, not applicable. 相似文献
TABLE 1.
Summary of treatment, challenge dose, and outcome of infection in cynomolgus monkeysProtocol code | No. of monkeys | Immunogen (dose)a | Adjuvantb | Schedule of immunization (wk) | Routec | Challenged (MID50) | Virological outcomee | Reference(s) or source | ||
---|---|---|---|---|---|---|---|---|---|---|
A | C | V | ||||||||
ISS-ST | 6 | Tat (10) | Alum or RIBI | 0, 2, 6, 12, 15, 21, 28, 32, 36 | s.c., i.m. | 10 | 4 | 1 | 1 | 4, 17 |
ISS-ST | 1 | Tat (6) | None | 0, 5, 12, 17, 22, 27, 32, 38, 42, 48 | i.d. | 10 | 1 | 0 | 0 | 4, 17 |
ISS-PCV | 3 | pCV-tat (1 mg) | Bupivacaine + methylparaben | 0, 2, 6, 11, 15, 21, 28, 32, 36 | i.m. | 10 | 3 | 0 | 0 | 6 |
ISS-ID | 3 | Tat (6) | none | 0, 4, 8, 12, 16, 20, 24, 28, 39, 43, 60 | i.d. | 10 | 1 | 1 | 1 | B. Ensoli, unpublished data |
ISS-TR | 6 | Tat (10) | Alum-Iscom | 0, 2, 6, 11, 16, 21, 28, 32, 36 | s.c., i.d., i.m. | 10 | 4 | 2 | 0 | Ensoli, unpublished |
ISS-TGf | 3 | Tat (10) | Alum | 0, 4, 12, 22 | s.c. | 15 | 0 | 3 | Ensoli, unpublished | |
ISS-TG | 3 | Tatcys22 (10) | Alum | 15 | 0 | 3 | Ensoli, unpublished | |||
ISS-TG | 4 | Tatcys22 (10) + Gag (60) | Alum | 15 | 0 | 4 | Ensoli, unpublished | |||
ISS-TG | 4 | Tat (10) + Gag (60) | Alum | 15 | 0 | 4 | Ensoli, unpublished | |||
ISS-MP | 3 | Tat (10) | H1D-Alum | 0, 4, 12, 18, 21, 38 | s.c., i.m. | 15 | 0 | 2 | 1 | Ensoli, unpublished |
ISS-MP | 3 | Tat (10) | Alum | s.c. | 15 | 0 | 0 | 3 | Ensoli, unpublished | |
ISS-GS | 6 | Tat (10) | H1D-Alum | 0, 4, 12, 18, 21, 36 | s.c., i.m. | 15 | 1 | 3 | 2 | Ensoli, unpublished |
NCI-Ad-tat/Tat | 7 | Ad-tat (5 × 108 PFU), Tat (10) | Alum | 0, 12, 24, 36 | i.n., i.t., s.c. | 15 | 2 | 3 | 2 | Ensoli, unpublished |
NCI-Tat | 9 | Tat (6 and 10) | Alum/Iscom | 0, 2, 6, 11, 15, 21, 28, 32, 36 | s.c., i.d., i.m. | 15 | 2 | 4 | 3 | 12 |
ISS-NPT | 3 | pCV-tat (1 mg) | Bupivacaine + methylparaben-Iscom | 0, 2, 8, 13, 17, 22, 28, 46, 71 | i.m. | 20 | 0 | 0 | 3 | Ensoli, unpublished |
ISS-NPT | 3 | pCV-tatcys22 (1 mg) | Bupivacaine + methylparaben-Iscom | 0, 2, 8, 13, 17, 22, 28, 46, 71 | i.m. | 20 | 1 | 1 | 1 | |
Total vaccinated | 67 | 19 | 17 | 31 | ||||||
Naive | 11 | None | None | NAg | NA | 10 or 15 | 1 | 3 | 7 | |
Control | 34 | None, Ad, or pCV-0 | Alum, RIBI, H1D, Iscom or bupivacaine + methylparaben-Iscom | s.c., i.d., i.n., i.t., i.m. | 10, 15, or 20 | 5 | 13 | 16 | ||
Total controls | 45 | 6 | 16 | 23 | ||||||
Total | 112 | 25 | 33 | 54 |