Functional characterization of a Chrysanthemum dichrum stress-related promoter

A 1,474-bp stress-inducible CdDREBa promoter was identified from Chrysanthemum dichrum, revealing several candidate stress-related cis-acting elements (MYC-box, MYB site, GT-1, and W-box) within it. In Arabidopsis leaf tissues transformed with a CdDREBa promoter-β-glucuronidase (GUS) gene fusion, serially 5'-deleted CdDREBa promoters were differentially activated by cold and salinity. Histochemical and quantitative assays of GUS expression allowed us to localize a critical part of the promoter located between upstream 430 and 351 nt. This 80-bp fragment enhanced GUS expression under salinity stress when fused to -90/+8 CaMV 35S minimal promoter. Further promoter internal-deletion assays indicated that a low temperature-responsive element was located between positions -430 and -390, and a salinity inducible one between -385 and -351. Our results showed that there was a novel stress-related critical region except for the known cis-acting element (MYC-box, GT-1) in CdDREBa promoter.     

Epstein-Barr virus nuclear antigen 2 transactivates latent membrane protein LMP1.

Several lines of evidence are compatible with the hypothesis that Epstein-Barr virus (EBV) nuclear antigen 2 (EBNA-2) or leader protein (EBNA-LP) affects expression of the EBV latent infection membrane protein LMP1. We now demonstrate the following. (i) Acute transfection and expression of EBNA-2 under control of simian virus 40 or Moloney murine leukemia virus promoters resulted in increased LMP1 expression in P3HR-1-infected Burkitt's lymphoma cells and the P3HR-1 or Daudi cell line. (ii) Transfection and expression of EBNA-LP alone had no effect on LMP1 expression and did not act synergistically with EBNA-2 to affect LMP1 expression. (iii) LMP1 expression in Daudi and P3HR-1-infected cells was controlled at the mRNA level, and EBNA-2 expression in Daudi cells increased LMP1 mRNA. (iv) No other EBV genes were required for EBNA-2 transactivation of LMP1 since cotransfection of recombinant EBNA-2 expression vectors and genomic LMP1 DNA fragments enhanced LMP1 expression in the EBV-negative B-lymphoma cell lines BJAB, Louckes, and BL30. (v) An EBNA-2-responsive element was found within the -512 to +40 LMP1 DNA since this DNA linked to a chloramphenicol acetyltransferase reporter gene was transactivated by cotransfection with an EBNA-2 expression vector. (vi) The EBV type 2 EBNA-2 transactivated LMP1 as well as the EBV type 1 EBNA-2. (vii) Two deletions within the EBNA-2 gene which rendered EBV transformation incompetent did not transactivate LMP1, whereas a transformation-competent EBNA-2 deletion mutant did transactivate LMP1. LMP1 is a potent effector of B-lymphocyte activation and can act synergistically with EBNA-2 to induce cellular CD23 gene expression. Thus, EBNA-2 transactivation of LMP1 amplifies the biological impact of EBNA-2 and underscores its central role in EBV-induced growth transformation.     

EBNA-2 transactivates a lymphoid-specific enhancer in the BamHI C promoter of Epstein-Barr virus.

Among the few Epstein-Barr virus (EBV) genes expressed during latency are the Epstein-Barr nuclear antigens (EBNAs), at least one of which contributes to the ability of the virus to transform B lymphocytes. We have analyzed a promoter located in the BamHI-C fragment of EBV which is responsible for the expression of EBNA-1 in some cell lines. Deletion analysis of a 1.4-kb region 5' of the RNA start site has identified a 700-bp fragment that is required for optimal promoter activity in latently infected B lymphocytes, as shown by promoter constructs linked to the chloramphenicol acetyltransferase reporter gene. This fragment is also able to enhance activity, in an orientation-independent manner, of the simian virus 40 early promoter linked to the chloramphenicol acetyltransferase gene. The enhancer element has some constitutive activity in EBV-negative lymphoid cells, which is increased in the presence of the EBNA-2 gene product. Further deletions have shown that the EBNA-2-responsive region requires a 98-bp region that contains a degenerate octamer-binding motif. In epithelial cells there was no enhancer activity regardless of the presence of EBNA-2. These results demonstrate that BamHI-C promoter activity may be dependent not on an enhancer contained in the ori-P, as was previously assumed, but rather on EBNA-2 transactivation of this more proximal enhancer located in the upstream region of the BamHI C promoter itself.     

The RR1 gene of herpes simplex virus type 1 is uniquely trans activated by ICP0 during infection.

As has been demonstrated for herpes simplex virus type 2, we show in this report that the herpes simplex virus type 1 ribonucleotide reductase large subunit (RR1) gene is trans activated in transient transfection assays by VP16 and ICP0 but not by ICP4. Deletion analysis demonstrated that responsiveness to induction to VP16 resides in an octamer/TAATGARAT sequence of the RR1 promoter and that the TATA box alone is sufficient to provide induction by ICP0. The induction of the RR1 gene by ICP0 but not by ICP4 suggested that it might be possible to identify the cis-acting element(s) responsive to ICP4 in an ICP4-inducible promoter. To this end, a series of chimeric promoters containing various portions of the regulatory sequences of the RR1 promoter and thymidine kinase (TK) promoter were constructed. The TK promoter is trans activated by both ICP0 and ICP4 in transient transfection assays and by ICP4 in infection. The data show that replacing the RR1 TATA region with the TK TATA region permits ICP4 inducibility even if the rest of the RR1 promoter elements remain intact. To test whether the RR1 gene is induced by ICP0 during infection, four mutant viruses were constructed. (i) TAATGARAT+ has the wild-type RR1 promoter driving chloramphenicol acetyltransferase (CAT) and the RR2 promoter driving the lacZ gene. The RR2 gene codes for the small subunit of the ribonucleotide reductase and is expressed as a beta gene. (ii) TAATGARAT- has a triple-base change in the octamer/TAATGARAT element which renders it unresponsive to VP16 trans activation, eliminating that portion of the activation of the RR1 gene. (iii) TAATGARAT- delta alpha 0 has a deletion of the alpha 0 gene. (iv) TAATGARAT- delta alpha 4 has a deletion of the alpha 4 gene. Infections were carried out in Vero cells at a multiplicity of infection of 10 per cell; cells were assayed for CAT and beta-galactosidase (beta-Gal) activities and for virus yields. The first two infections gave strong CAT and beta-Gal activities and high yields of progeny virus. Infection with the third virus showed no CAT activity but did produce high levels of beta-Gal activity and virus progeny. The fourth infection resulted in strong CAT activity but no beta-Gal activity or progeny virus. The data demonstrated that the RR1 promoter was activated in the absence of ICP4 but not in the absence of ICP0 in these infections.(ABSTRACT TRUNCATED AT 400 WORDS)     

A negative regulatory element (base pairs -204 to -177) of the EICP0 promoter of equine herpesvirus 1 abolishes the EICP0 protein's trans-activation of its own promoter

The early EICP0 protein is a powerful trans-activator that activates all classes of equine herpesvirus 1 (EHV-1) promoters but, unexpectedly, trans-activates its own promoter very weakly. Transient transfection assays that employed constructs harboring deletions within the EICP0 promoter indicated that EICP0 cis-acting sequences within bp -224 to -158 relative to the first ATG abolished the EICP0 protein's trans-activation of its own promoter. When inserted into the promoters of other EHV-1 genes, this sequence also downregulated activation of the immediate-early IE(-169/+73), early thymidine kinase TK(-215/+97), and late glycoprotein K gK(-83/+14) promoters, indicating that the cis-acting sequence (-224 to -158) downregulated expression of representative promoters of all classes of EHV-1 genes and contains a negative regulatory element (NRE). To define the cis-acting element(s), three synthetic oligonucleotides (Na [bp -224 to -195], Nb [bp -204 to -177], and Nc [bp -185 to -156]) were synthesized and cloned upstream of the EICP0(-157/-21) promoter. Of the three synthetic sequences, only the Nb oligonucleotide caused the downregulation of the EICP0 promoter. The NRE was identified as a 28-bp element to lie at -204 to -177 that encompassed the sequence of ([-204]AGATACAGATGTTCGATAAATTGGAACC[-177]). Gel shift assays performed with mouse L-M, rabbit RK-13, and human HeLa cell nuclear extracts and gamma-(32)P-labeled wild-type and mutant NREs demonstrated that a ubiquitous nuclear protein(s) (NRE-binding protein, NREBP) binds specifically to a sequence (bp -193 to -183) in the NRE. The NREBP is also present in the nucleus of EHV-1-infected cells; however, the amount of NREBP in EHV-1-infected L-M cells that bound to the Nb oligonucleotide was reduced compared to that in uninfected L-M cells. Transient transfection assays showed that deletions or mutations within the NREBP-binding site abolished the NRE activity of the EICP0 promoter. These results suggested that the NREBP may mediate the NRE activity of the EICP0 promoter and may function in the coordinate expression of EHV-1 genes.     

Epstein-Barr virus latent membrane protein (LMP1) and nuclear proteins 2 and 3C are effectors of phenotypic changes in B lymphocytes: EBNA-2 and LMP1 cooperatively induce CD23.

Latent Epstein-Barr virus (EBV) infection and growth transformation of B lymphocytes is characterized by EBV nuclear and membrane protein expression (EBV nuclear antigen [EBNA] and latent membrane protein [LMP], respectively). LMP1 is known to be an oncogene in rodent fibroblasts and to induce B-lymphocyte activation and cellular adhesion molecules in the EBV-negative Burkitt's lymphoma cell line Louckes. EBNA-2 is required for EBV-induced growth transformation; it lowers rodent fibroblast serum dependence and specifically induces the B-lymphocyte activation antigen CD23 in Louckes cells. These initial observations are now extended through an expanded study of EBNA- and LMP1-induced phenotypic effects in a different EBV-negative B-lymphoma cell line, BJAB. LMP1 effects were also evaluated in the EBV-negative B-lymphoma cell line BL41 and the EBV-positive Burkitt's lymphoma cell line, Daudi (Daudi is deleted for EBNA-2 and does not express LMP). Previously described EBNA-2- and LMP1-transfected Louckes cells were studied in parallel. EBNA-2, from EBV-1 strains but not EBV-2, induced CD23 and CD21 expression in transfected BJAB cells. In contrast, EBNA-3C induced CD21 but not CD23, while no changes were evident in vector control-, EBNA-1-, or EBNA-LP-transfected clones. EBNAs did not affect CD10, CD30, CD39, CD40, CD44, or cellular adhesion molecules. LMP1 expression in all cell lines induced growth in large clumps and expression of the cellular adhesion molecules ICAM-1, LFA-1, and LFA-3 in those cell lines which constitutively express low levels. LMP1 expression induced marked homotypic adhesion in the BJAB cell line, despite the fact that there was no significant increase in the high constitutive BJAB LFA-1 and ICAM-1 levels, suggesting that LMP1 also induces an associated functional change in these molecules. LMP1 induction of these cellular adhesion molecules was also associated with increased heterotypic adhesion to T lymphocytes. The Burkitt's lymphoma marker, CALLA (CD10), was uniformly down regulated by LMP1 in all cell lines. In contrast, LMP1 induced unique profiles of B-lymphocyte activation antigens in the various cell lines. LMP1 induced CD23 and CD39 in BJAB; CD23 in Louckes; CD39 and CD40 in BL41; and CD21, CD40, and CD44 in Daudi. In BJAB, CD23 surface and mRNA expression were markedly increased by EBNA-2 and LMP1 coexpression, compared with EBNA-2 or LMP1 alone. This cooperative effect was CD23 specific, since no such effect was observed on another marker, CD21.(ABSTRACT TRUNCATED AT 400 WORDS)     

Host cell-dependent regulation of growth transformation-associated Epstein-Barr virus antigens in somatic cell hybrids.

We have analyzed the expression of the three major known growth transformation-associated Epstein-Barr virus (EBV) proteins, EBNA-1, EBNA-2, and latent membrane protein (LMP), in a series of somatic cell hybrids derived from the fusion of EBV-carrying Burkitt lymphoma (BL) lines with EBV-positive or EBV-negative B-cell lines. Independently of the cell phenotype, EBNA-1 was invariably coexpressed in all EBV-carrying hybrids. In hybrids between EBV-carrying, LMP-positive and LMP-negative Burkitt lymphoma lines, LMP was expressed, indicating positive control. Two EBV-negative lymphoma lines, Ramos and BJAB, differed in their ability to express LMP after B95-8 virus-induced conversion and after hybridization with Raji cells. BJAB was permissive while Ramos was nonpermissive for LMP, although both expressed EBNA-2. The EBNA-2-deleted P3HR-1 virus gave the same pattern of LMP expression in these two cells. Our findings indicate that the expression of EBNA-1, EBNA-2, and LMP is regulated by independent mechanisms.     

Constitutive and interleukin-1 (IL-1)-inducible factors interact with the IL-1-responsive element in the IL-6 gene.

The interleukin-6 (IL-6) promoter is rapidly and transiently activated with other cytokines, including IL-1, tumor necrosis factor, and platelet-derived growth factor, as well as phorbol esters and agents that increase intracellular cyclic AMP. In this study, we have investigated cis-acting regulatory elements and trans-acting factors responsible for IL-1-induced IL-6 gene expression. Studies on the 5' deletion mutants of the human IL-6 gene suggested that the IL-1-responsive element was mapped within the IL-6 promoter region (-180 to -123) which was homologous to the c-fos serum-responsive enhancer element. Gel retardation assay identified two types of nuclear factors that bound to this region, one constitutive and the other inducible. These two factors recognized a 14-base-pair (bp) palindromic sequence, ACATTGCACAATCT. Furthermore, three copies of this 14-bp palindrome conferred IL-1 responsiveness to the basal enhancerless IL-6 promoter, indicating that a 14-bp-dyad symmetry sequence was an IL-1-responsive element in the IL-6 gene.     

Identification and characterization of the cis-elements regulating the rat AMOG (adhesion molecule on glia)/Na,K-ATPase beta 2 subunit gene.

We have identified a positive regulatory cis-acting element of the adhesion molecule on glia (AMOG)/Na,K-ATPase beta 2 subunit gene as GAGGCGGGG at position -87 to -79 by transient transfection assay using B103 cells (rat neuroblastoma cell line). The newly identified AMOG regulatory element (AMRE) enhanced the promoter activity in a mutually compensating manner with the Sp1 element at position -147 to -142. AMRE acts as a positive regulatory element not only in B103 cells but also in 3Y1 (rat embryo cell line) cells to roughly the same extent and in MDCK (canine kidney cell line) cells to a lesser extent. AMRE also enhances other gene promoters, such as myelin basic protein (MBP) and herpes simplex virus (HSV) thymidine kinase (TK) gene promoters. The element is not a typical enhancer element because when it is introduced downstream of the HSV TK promoter, it has no enhancing activity.