Vaccinia virus telomeres: interaction with the viral I1, I6, and K4 proteins

The 192-kb linear DNA genome of vaccinia virus has covalently closed hairpin termini that are extremely AT rich and contain 12 extrahelical bases. Vaccinia virus telomeres have previously been implicated in the initiation of viral genome replication; therefore, we sought to determine whether the telomeres form specific protein-DNA complexes. Using an electrophoretic mobility shift assay, we found that extracts prepared from virions and from the cytoplasm of infected cells contain telomere binding activity. Four shifted complexes were detected using hairpin probes representing the viral termini, two of which represent an interaction with the "flip" isoform and two with the "flop" isoform. All of the specificity for protein binding lies within the terminal 65-bp hairpin sequence. Viral hairpins lacking extrahelical bases cannot form the shifted complexes, suggesting that DNA structure is crucial for complex formation. Using an affinity purification protocol, we purified the proteins responsible for hairpin-protein complex formation. The vaccinia virus I1 protein was identified as being necessary and sufficient for the formation of the upper doublet of shifted complexes, and the vaccinia virus I6 protein was shown to form the lower doublet of shifted complexes. Competition and challenge experiments confirmed that the previously uncharacterized I6 protein binds tightly and with great specificity to the hairpin form of the viral telomeric sequence. Incubation of viral hairpins with extracts from infected cells also generates a smaller DNA fragment that is likely to reflect specific nicking at the apex of the hairpin; we show that the vaccinia virus K4 protein is necessary and sufficient for this reaction. We hypothesize that these telomere binding proteins may play a role in the initiation of vaccinia virus genome replication and/or genome encapsidation.     

Replication and resolution of cloned poxvirus telomeres in vivo generates linear minichromosomes with intact viral hairpin termini.

The covalently closed terminal hairpins of the linear duplex-DNA genomes of the orthopoxvirus vaccinia and the leporipoxvirus Shope fibroma virus (SFV) have been cloned as imperfect palindromes within circular plasmids in yeast cells and recombination-deficient Escherichia coli. The viral telomeres inserted within these recombinant plasmids are equivalent to the inverted-repeat structures detected as telomeric replicative intermediates during poxvirus replication in vivo. Although the telomeres of vaccinia and SFV show little sequence homology, the termini from both viral genomes exist as AT-rich terminal hairpins with extrahelical bases and alternate "flip-flop" configurations. Using an in vivo replication assay in which circular plasmid DNA was transfected into poxvirus-infected cells, we demonstrated the efficient replication and resolution of the cloned imperfect palindromes to bona fide hairpin termini. The resulting linear minichromosomes, which were readily purified from transfected cells, were shown by restriction enzyme mapping and by electron microscopy to have intact covalently closed hairpin termini at both ends. In addition, staggered unidirectional deletion derivatives of both the cloned vaccinia and SFV telomeric palindromes localized an approximately 200-base-pair DNA region in which the sequence organization was highly conserved and which was necessary for the resolution event. These data suggest a conserved mechanism of the resolution of poxvirus telomeres.     

Resolution of linear minichromosomes with hairpin ends from circular plasmids containing vaccinia virus concatemer junctions

The junctions, separating unit-length genomes in intracellular concatemeric forms of vaccinia virus DNA, are duplex copies of the hairpin loops that form the ends of mature DNA molecules present in infectious virus particles. Circular E. coli plasmids with palindromic junction fragments were replicated in vaccinia virus-infected cells and resolved into linear minichromosomes with vector DNA in the center and vaccinia virus DNA hairpins at the two ends. Resolution did not occur when the concatemer joint was less than 250 bp or when plasmids were transfected into uninfected cells, indicating requirements for a specific DNA structure and viral trans-acting factors. These studies indicate that concatemers can serve as replicative intermediates and account for the generation of flip-flop sequence variation of the hairpins at the ends of the mature vaccinia virus genome.     

Efficient resolution of replicated poxvirus telomeres to native hairpin structures requires two inverted symmetrical copies of a core target DNA sequence.

The terminal hairpin sequences of the linear double-stranded DNA genome of the leporipoxvirus Shope fibroma virus (SFV) has been cloned in Saccharomyces cerevisiae and in recombination-deficient Escherichia coli as a palindromic insert within circular plasmid vectors. This sequence configuration is equivalent to the inverted repeat structure detected as a telomeric replicative intermediate during poxvirus replication in vivo. Previously, it has been shown that when circular plasmids containing this palindromic insert were transfected into SFV-infected cells, efficient replication and resolution generated linear minichromosomes with bona fide viral hairpin termini (A. M. DeLange, M. Reddy, D. Scraba, C. Upton, and G. McFadden, J. Virol. 59:249-259, 1986). To localize the minimal target DNA sequence required for efficient resolution, a series of staggered unidirectional deletions were constructed at both ends of the inverted repeat. Analyses of the resolution efficiencies of the various clones indicate that up to 240 base pairs (bp) centered at the symmetry axis were required for maximal resolution to minichromosomes. To investigate the role of the AT-rich central axis sequences, which in SFV include 8 nonpalindromic bp, a unique AflII site at the symmetry axis was exploited. Bidirectional deletions extending from this AflII site and insertions of synthetic oligonucleotides into one of the deletion derivatives were constructed and tested in vivo. The efficiency with which these plasmids resolved to linear minichromosomes with hairpin termini has enabled us to define the minimal target DNA sequence as two inverted copies of an identical DNA sequence between 58 and 76 bp in length. The nonpalindromic nucleotides, which, after resolution, constitute the extrahelical residues characteristic of native poxviral telomeres, were not required for resolution. The close resemblance of the SFV core target sequence to the analogous region from the orthopoxvirus vaccinia virus is consistent with a conserved mechanism for poxviral telomere resolution.     

Molecular cloning and sequence of the concatemer junction from vaccinia virus replicative DNA. Viral nuclease cleavage sites in cruciform structures

The concatemer junction from replicative forms of vaccinia virus DNA was cloned into plasmid vectors and shown to be a precise duplex copy of the viral terminal hairpin structure, with each strand corresponding to one of the alternative sequence isomers. The plasmids were relaxed circles with extruded cruciforms representing two copies of the vaccinia telomere hairpin structure. Head-to-head dimers containing two copies of the vaccinia virus concatemer junction were observed to contain only one set of stem-loop structures per molecule, suggesting that the initial formation of a small cruciform, and not branch migration, was the rate-limiting step in cruciform formation. The plasmids containing the concatemer junction were converted into nicked circular, linear and cross-linked linear molecules by a nuclease isolated from vaccinia virions. The region-specific cleavage near the border of the hairpin loop and the formation of DNA cross-links in some of the molecules is consistent with the nuclease acting as a nicking-closing enzyme that participates in the resolution of mature termini from replicative concatemer intermediates.     

The mismatched nucleotides encoded in vaccinia virus flip-and-flop hairpin telomeres serve an essential role in virion maturation

Poxvirus genomes consist of a linear duplex DNA that ends in short inverted and complementary hairpin structures. These elements also encode loops and mismatches that likely serve a role in genome packaging and perhaps replication. We constructed mutant vaccinia viruses (VACV) where the native hairpins were replaced by altered forms and tested effects on replication, assembly, and virulence. Our studies showed that structure, not sequence, likely determines function as one can replace an Orthopoxvirus (VACV) hairpin with one copied from a Leporipoxvirus with no effect on growth. Some loops can be deleted from VACV hairpins with little effect, but VACV bearing too few mismatches grew poorly and we couldn’t recover viruses lacking all mismatches. Further studies were conducted using a mutant bearing only one of six mismatches found in wild-type hairpins (SΔ1Δ3–6). This virus grew to ~20-fold lower titers, but neither DNA synthesis nor telomere resolution was affected. However, the mutant exhibited a particle-to-PFU ratio 10-20-fold higher than wild-type viruses and p4b/4b core protein processing was compromised, indicating an assembly defect. Electron microscopy showed that SΔ1Δ3–6 mutant development was blocked at the immature virus (IV) stage, which phenocopies known effects of I1L mutants. Competitive DNA binding assays showed that recombinant I1 protein had less affinity for the SΔ1Δ3–6 hairpin than the wild-type hairpin. The SΔ1Δ3–6 mutant was also attenuated when administered to SCID-NCR mice by tail scarification. Mice inoculated with viruses bearing wild-type hairpins exhibited a median survival of 30–37 days, while mice infected with SΔ1Δ3–6 virus survived >70 days. Persistent infections favor genetic reversion and genome sequencing detected one example where a small duplication near the hairpin tip likely created a new loop. These observations show that mismatches serve a critical role in genome packaging and provide new insights into how VACV “flip and flop” telomeres are arranged.     

The role of DNA-PKcs and artemis in opening viral DNA hairpin termini in various tissues in mice

A subset of cellular DNA hairpins at double-strand breaks is processed by DNA-dependent protein kinase catalytic subunit (DNA-PKcs)- and Artemis-associated endonuclease. DNA hairpin termini of adeno-associated virus (AAV) are processed by DNA repair machinery; however, how and what cellular factors are involved in the process remain elusive. Here, we show that DNA-PKcs and Artemis open AAV inverted terminal repeat (ITR) hairpin loops in a tissue-dependent manner. We investigated recombinant AAV (rAAV) genome metabolism in various tissues of DNA-PKcs- or Artemis-proficient or -deficient mice. In the absence of either factor, ITR hairpin opening was impaired, resulting in accumulation of double-stranded linear rAAV genomes capped with covalently closed hairpins at termini. The 5' end of 3-base hairpin loops of the ITR was the primary target for DNA-PKcs- and Artemis-mediated cleavage. In the muscle, heart, and kidney, DNA-PKcs- and Artemis-dependent hairpin opening constituted a significant pathway, while in the liver, undefined alternative pathways effectively processed hairpins. In addition, our study revealed a Holliday junction resolvase-like activity in the liver that cleaved T-shaped ITR hairpin shoulders by making nicks at diametrically opposed sites. Thus, our approach furthers our understanding of not only rAAV biology but also fundamental DNA repair systems in various tissues of living animals.     

Vaccinia virus J1R protein: a viral membrane protein that is essential for virion morphogenesis

Vaccinia virus, a member of the poxvirus family, contains a conserved J1R open reading frame that encodes a late protein of 17.8 kDa. The 18-kDa J1R protein is associated mainly with the membrane fraction of intracellular mature virus particles. This study examines the biological function of J1R protein in the vaccinia virus life cycle. A recombinant vaccinia virus was constructed to conditionally express J1R protein in an isopropyl-beta-D-galactopyranoside (IPTG)-inducible manner. When J1R is not expressed during vaccinia virus infection, the virus titer is reduced approximately 100-fold. In contrast, J1R protein is not required for viral gene expression, as indicated by protein pulse-labeling. J1R protein is also not required for DNA processing, as the resolution of the concatemer junctions of replicated viral DNA was detected without IPTG. A deficiency of J1R protein caused a severe delay in the processing of p4a and p4b into mature core proteins 4a and 4b, indicating that J1R protein participates in virion morphogenesis. Infected cells grown in the absence of IPTG contained very few intracellular mature virions in the cytoplasm, and enlarged viroplasm structures accumulated with viral crescents attached at the periphery. Abundant intermediate membrane structures of abnormal shapes were observed, and many immature virions were either empty or partially filled, indicating that J1R protein is important for DNA packaging into immature virions. J1R protein also coimmunoprecipited with A45R protein in infected cells. In summary, these results indicate that vaccinia virus J1R is a membrane protein that is required for virus growth and plaque formation. J1R protein interacts with A45R protein and performs an important role during immature virion formation in cultured cells.     

Cloning of the vaccinia virus telomere in a yeast plasmid vector

The vaccinia virus DNA telomere, which contains a covalently closed hairpin structure, has been cloned in a yeast plasmid vector. Restriction mapping indicates that the cloned vaccinia telomere is maintained in yeast not in its native hairpin configuration but as an inverted repeat structure, within a circular plasmid, with the sequences of the viral hairpin now at the axis of symmetry of an imperfect palindrome. As such, the cloned telomere resembles the telomeric replicative intermediate observed during vaccinia virus DNA replication. Small deletions and duplications in the viral inverted repeats of different clones suggest a model in which the observed circular plasmids were generated in yeast by the replication of hybrid linear DNA molecules consisting of the linearized yeast vector flanked by two hairpin-containing vaccinia termini.     

Mutational analysis of the resolution sequence of vaccinia virus DNA: essential sequence consists of two separate AT-rich regions highly conserved among poxviruses.

In replicative forms of vaccinia virus DNA, the unit genomes are connected by palindromic junction fragments that are resolved into mature viral genomes with hairpin termini. Bacterial plasmids containing the junction fragment for vaccinia virus or Shope fibroma virus were converted into linear minichromosomes of vector sequence flanked by poxvirus hairpin loops after transfection into infected cells. Analysis of a series of symmetrical deletion mutations demonstrated that in vaccinia virus the presence of the DNA sequence ATTTAGTGTCTAGAAAAAAA on both sides of the apical segment of the concatemer junction is crucial for resolution. To determine the precise architecture of the resolution site, a series of site-directed mutations within this tract of nucleotides were made and the relative contribution of each nucleotide to the efficaciousness of resolution was determined. The nucleotide sequence necessary for the resolution of the vaccinia virus concatemer junction, (A/T)TTT(A/G)N7-9AAAAAAA, is highly conserved among poxviruses and found proximal to the hairpin loop in the genomes of members of the Leporipoxvirus, Avipoxvirus, and Capripoxvirus genera.     

Identification of the DNA sequences encoding the large subunit of the mRNA-capping enzyme of vaccinia virus.

The DNA sequences encoding the large subunit of the mRNA-capping enzyme of vaccinia virus were located on the viral genome. The formation of an enzyme-guanylate covalent intermediate labeled with [alpha-32P]GTP allowed the identification of the large subunit of the capping enzyme and was used to monitor the appearance of the enzyme during the infectious cycle. This assay confirmed that after vaccinia infection, a novel 84,000-molecular-weight polypeptide corresponding to the large subunit was rapidly synthesized before viral DNA replication. Hybrid-selected cell-free translation of early viral mRNA established that vaccinia virus encoded a polypeptide identical in molecular weight with the 32P-labeled 84,000-molecular-weight polypeptide found in vaccinia virions. Like the authentic capping enzyme, this virus-encoded cell-free translation product bound specifically to DNA-cellulose. A comparison of the partial proteolytic digestion fragments generated by V8 protease, chymotrypsin, and trypsin demonstrated that the 32P-labeled large subunit and the [35S]methionine-labeled cell-free translation product were identical. The mRNA encoding the large subunit of the capping enzyme was located 3.1 kilobase pairs to the left of the HindIII D restriction fragment of the vaccinia genome. Furthermore, the mRNA was determined to be 3.0 kilobases in size, and its 5' and 3' termini were precisely located by S1 nuclease analysis.     

Molecular cloning of the terminal hairpin of vaccinia virus DNA as an imperfect palindrome in an Escherichia coli plasmid

The genome of vaccinia virus is a linear duplex molecule of approximately 185 kb with hairpins at each end that link the complementary strands. The hairpins, which exist in two forms that are inverted and complementary in sequence, were isolated as XbaI restriction fragments and converted to a linear intermolecular duplex structure by denaturation and reannealing. The latter was then stably cloned as a 142-bp imperfect palindrome in an Escherichia coli plasmid. The insert was excised from the plasmid and the palindrome was extended on both sides by ligating it to the adjacent vaccinia virus DNA segment. The resulting fragment was cloned as a 278-bp imperfect palindrome. Restriction endonuclease analysis and DNA sequencing indicated the absence of any deletions or rearrangements. After excision from the plasmid, the palindrome was converted by heating and rapid cooling to the original two hairpin forms. In this manner, large quantities of vaccinia virus telomeres may be obtained for physical and biochemical studies.     

Resolution of vaccinia virus DNA concatemer junctions requires late-gene expression.

Vaccinia virus replicates in the cytoplasm of infected cells, generating transient replicative intermediates containing the DNA for the terminal sequences as concatemeric junctions. The processing of the terminal sequences for a series of vaccinia virus conditional lethal mutants at the nonpermissive temperature was analyzed by restriction enzyme digestion and Southern blot hybridization of DNA isolated from infected cells. Three phenotypes were observed: DNA replication negative (Rep-), DNA replication positive but concatemer resolution negative (Rep+ Res-), and DNA replication positive and concatemer resolution positive (Rep+ Res+). Interestingly, all six Rep+ Res- mutants from separate complementation groups were defective in late protein synthesis. Isatin beta-thiosemicarbazone, a drug that blocks late protein synthesis, also prevented resolution of concatemers. Orthogonal field gel electrophoresis of the DNA generated by the late defective mutants revealed a distribution of linear genome multimers. The multimers were processed into mature monomers after a shift to the permissive temperature in the presence of cytosine arabinoside for all the Rep+ Res- mutants except ts22, an irreversible mutant which cleaves RNA late in infection (R.F. Pacha and R.C. Condit, J. Virol. 56:395-403, 1985). Genome formation can be divided into two stages: DNA replication, which generates concatemers, and resolution, which processes concatemers into monomers with hairpin termini. Early viral genes are required for the former, and late viral genes are required for the latter.     

Identification of temperature-sensitive mutants of vaccinia virus that are defective in conversion of concatemeric replicative intermediates to the mature linear DNA genome

Pulsed-field gel electrophoresis was used to screen temperature-sensitive mutants of vaccinia virus for the ability to convert replicated viral DNA into mature linear 185-kilobase hairpin-terminated genomes. Of 30 mutually noncomplementing mutants tested, 5 displayed a temperature-sensitive defect in the resolution of the telomere fusion configuration within concatemeric replicative intermediates, resulting in a failure to convert such intermediates to the linear monomeric genome. Adjacent genomic units in the concatemeric arrays generated in these mutants were arranged in both tandem and inverted orientations. The observation that four of the five mutants had a severe general defect in the synthesis of the late class of viral proteins suggests that at least one late protein is directly required to resolve the telomere fusion intermediate to hairpin termini. The identification of such telomere resolution proteins should be facilitated by genetic and molecular characterization of resolution-defective mutants, such as C63, in which late protein synthesis is not severely affected.     

Some enzymatic activities associated with purified parapoxvirions.

Purified virions of milker's nodule virus, a parapoxvirus, were shown to contain an RNA polymerase, a nucleotide phosphohydrolase, and a protein kinase associated with or encapsulated within the DNA-containing core of the virus. In vitro, the activated viral RNA polymerase transcribed only 7 to 8% of the genome, in the form of 8S to 14S polyadenylated RNA molecules which were complementary to sequences present in milker's nodule virus DNA but not vaccinia virus DNA or DNA prepared from the host cells in which the virus was propagated. Sodium dodecyl sulfate-polyacrylamide gel electrophoretic analysis showed that in vitro, the activated viral protein kinase phosphorylated viral polypeptides of 95, 60, 33.5, 15, and 13.8 kilodaltons.     

Vaccinia mature virus fusion regulator A26 protein binds to A16 and G9 proteins of the viral entry fusion complex and dissociates from mature virions at low pH

Vaccinia mature virus enters cells through either endocytosis or plasma membrane fusion, depending on virus strain and cell type. Our previous results showed that vaccinia virus mature virions containing viral A26 protein enter HeLa cells preferentially through endocytosis, whereas mature virions lacking A26 protein enter through plasma membrane fusion, leading us to propose that A26 acts as an acid-sensitive fusion suppressor for mature virus (S. J. Chang, Y. X. Chang, R. Izmailyan R, Y. L. Tang, and W. Chang, J. Virol. 84:8422-8432, 2010). In the present study, we investigated the fusion suppression mechanism of A26 protein. We found that A26 protein was coimmunoprecipitated with multiple components of the viral entry-fusion complex (EFC) in infected HeLa cells. Transient expression of viral EFC components in HeLa cells revealed that vaccinia virus A26 protein interacted directly with A16 and G9 but not with G3, L5 and H2 proteins of the EFC components. Consistently, a glutathione S-transferase (GST)-A26 fusion protein, but not GST, pulled down A16 and G9 proteins individually in vitro. Together, our results supported the idea that A26 protein binds to A16 and G9 protein at neutral pH contributing to suppression of vaccinia virus-triggered membrane fusion from without. Since vaccinia virus extracellular envelope proteins A56/K2 were recently shown to bind to the A16/G9 subcomplex to suppress virus-induced fusion from within, our results also highlight an evolutionary convergence in which vaccinia viral fusion suppressor proteins regulate membrane fusion by targeting the A16 and G9 components of the viral EFC complex. Finally, we provide evidence that acid (pH 4.7) treatment induced A26 protein and A26-A27 protein complexes of 70 kDa and 90 kDa to dissociate from mature virions, suggesting that the structure of A26 protein is acid sensitive.     

Presence of protein at the termini of intracellular adenovirus type 5 DNA.

Adenovirus type 5 contains linear double-stranded DNA with protein covalently attached to the ends of the molecules. The presence of protein at the termini of intracellular viral DNA in adenovirus type 5-infected cells was investigated at different stages during the replication process. The intracellular viral DNA was isolated from the nuclei by lysis in 4 M guanidine hydrochloride. Electrophoresis on agarose gels of HsuI restriction enzyme fragments and sucrose gradient centrifugation were used to detect protein on intracellular viral DNA. After uncoating parental DNA still contains protein attached to the termini of the viral genome. Replicating and mature progeny viral DNA can also be isolated in the form of DNA-protein complexes. These complexes exhibit the same properties as the DNA-protein complex isolated from purified virions. These results suggest that the protein at the termini of intracellular viral DNA is identical to the protein attached to the 5'-ends of the DNA extracted from virions and that it is possibly involved in the replication of viral DNA.     

The vaccinia virus I1 protein is essential for the assembly of mature virions.

The product of the vaccinia virus I1 gene was characterized biochemically and genetically. This 35-kDa protein is conserved in diverse members of the poxvirus family but shows no homology to nonviral proteins. We show that recombinant I1 binds to both single-stranded and double-stranded DNA in a sequence-nonspecific manner in an electrophoretic mobility shift assay. The protein is expressed at late times during infection, and approximately 700 copies are encapsidated within the virion core. To determine the role of the I1 protein during the viral life cycle, a inducible viral recombinant in which the I1 gene was placed under the regulation of the Escherichia coli lac operator/repressor was constructed. In the absence of isopropyl-beta-D-thiogalactopyranoside, plaque formation was abolished and yields of infectious, intracellular virus were dramatically reduced. Although all phases of gene expression and DNA replication proceeded normally during nonpermissive infections, no mature virions were produced. Electron microscopic analysis confirmed the absence of mature virion assembly but revealed that apparently normal immature virions accumulated. Thus, I1 is an encapsidated DNA-binding protein required for the latest stages of vaccinia virion morphogenesis.     

The structure of a putative scaffolding protein of immature poxvirus particles as determined by electron microscopy suggests similarity with capsid proteins of large icosahedral DNA viruses

Orf virus, the prototype parapoxvirus, is responsible for contagious ecthyma in sheep and goats. The central region of the viral genome codes for proteins highly conserved among vertebrate poxviruses and which are frequently essential for viral proliferation. Analysis of the recently published genome sequence of orf virus revealed that among such essential proteins, the protein orfv075 is an orthologue of D13, the rifampin resistance gene product critical for vaccinia virus morphogenesis. Previous studies showed that D13, arranged as "spicules," is necessary for the formation of vaccinia virus immature virions, a mandatory intermediate in viral maturation. We have determined the three-dimensional structure of recombinant orfv075 at approximately 25-A resolution by electron microscopy of two-dimensional crystals. orfv075 organizes as trimers with a tripod-like main body and a propeller-like smaller domain. The molecular envelope of orfv075 shows unexpectedly good agreement to that of a distant homologue, VP54, the major capsid protein of Paramecium bursaria Chlorella virus type 1. Our structural analysis suggests that orfv075 belongs in the double-barreled capsid protein family found in many double-stranded DNA icosahedral viruses and supports the hypothesis that the nonicosahedral poxviruses and the large icosahedral DNA viruses are evolutionarily related.