Sequence context of the T-DNA border repeat element determines its relative activity during T-DNA transfer to plant cells

Summary We present a detailed analysis of the function of the right and left T-DNA border regions of the nopaline Ti plasmid of Agrobacterium tumefaciens. An avirulent deletion of the right border of the nopaline Ti plasmid (pGV3852) was used as an acceptor for 14 different T-DNA border constructs. The functional activities of these constructs were assayed by their ability to restore virulence, i.e. transformation on inoculated plants. Tumorigenicities were measured in several independent experiments over a 2 year period and the statistical significance of their relative levels was evaluated. The data indicate: (i) the entire sequence of the 25 bp direct repeat of the T-DNA is required to provide an efficient substrate for mediating T-DNA transfer events; deletion derivatives of either the conserved or the vaiable domain of the repeat are defective in T-DNA transfer; (ii) while the 25 bp direct repeat alone can promote the T-DNA transfer, the flanking sequences of the repeats enhance (on the right) or attenuate (on the left) their activity; and (iii) tumorigenicity measurements vary depending on the plant assay system: potato discs are more sensitive than wounded tobacco leaves in detecting differences in T-DNA border activity.     

Right 25 bp terminus sequence of the nopaline T-DNA is essential for and determines direction of DNA transfer from agrobacterium to the plant genome

We have determined which sequences at the right border of the T-DNA region of the nopaline C58 Ti plasmid are required for transfer and/or integration of the T-DNA into the plant cell genome. The results indicate that the 25 bp T-DNA terminus repeat sequence, TGACAGGATATATTGGCGGGTAAAC, is directly responsible for T-DNA transfer; furthermore, this sequence is directional in its mode of action. A transfer-negative nononcogenic Ti plasmid derivative, pGV3852, was constructed, in which 3 kb covering the right T-DNA border region was substituted for by pBR322 sequences. The pBR322 sequences in pGV3852 provide a site for homologous recombination with pBR-derived plasmids containing sequences to assay for transfer activity. First, a 3.3 kb restriction fragment overlapping the deleted region in pGV3852 was shown to restore transfer activity. Second, a sequence of only 25 bp, the T-DNA terminus sequence, was shown to be sufficient to restore normal transfer activity. The transfer-promoting sequences are most active when reinserted in one orientation, that normally found in the Ti plasmid.     

Genetic analysis of integration mediated by single T-DNA borders.

Transformation of plant cells by the T-DNA of the Ti plasmid of Agrobacterium tumefaciens depends in part upon a sequence adjacent to the right T-DNA end. When this sequence is absent, the T-DNA is almost avirulent; when it is present, DNA between it and the left T-DNA border region becomes integrated in plants. To investigate further this process of DNA transfer and integration, we introduced the right border region and the nopaline synthase (nos) gene of plasmid pTiC58 into a variety of new positions around Ti plasmids. The border region functioned when separated from the remainder of the T-DNA by almost 50 kilobases. It also worked when placed outside of the T-DNA region where there were no known left-border sequences with which to interact. Indeed, the nos gene could be transferred to plants even when no other Ti plasmid sequences were present on the same plasmid. These results may indicate that the sequence requirements for the left borders are not as stringent as those for the right borders. In addition, mutants with an extra copy of the right border region within their T-DNA were found to transfer or integrate only parts of the bacterial T-DNA region. It is possible that abnormally placed T-DNA borders interfere with the normal process of DNA transfer, integration, or both.     

Function of heterologous and pseudo border repeats in T region transfer via the octopine virulence system of Agrobacterium tumefaciens

The successful transfer of the Ti plasmid T region to the plant cell is mediated by its 24 bp border repeats. Processing of the T-region prior to transfer to the plant cell is started at the right border repeat and is stimulated by a transfer enhancer sequence called overdrive. Left and right border repeats differ somewhat in nucleotide sequence; moreover, the repeats of different Ti and Ri plasmids are slightly different. Our data indicate that these differences do not have a significant influence on border activity. However, the overdrive sequence is essential for the efficient transfer of a T region via an octopine transfer system. Our data suggest that an overdrive sequence must also be present next to the right border repeats of the nopaline Ti plasmid and the agropine of octopine and nopaline Ti plasmids express some differences in T-DNA processing activities. of cotopine and nopaline Ti plasmids express some differences in T-DNA processing activities.Furthermore, we demonstrate that certain pseudo border repeats, sequences that resemble the native 24 bp border repeat and naturally occur within the octopine Ti plasmid T-region, are able to mediate T region transfer to the plant cell, albeit with much reduced efficiency as compared to wild-type border repeats.     

Gene note. Complete nucleotide sequence of the T-DNA region of the plant tumour-inducing Agrobacterium tumefaciens Ti plasmid pTiC58

The complete nucleotide sequence has been determined of the T-DNA region from the plant tumour-inducing Agrobacterium tumefaciens nopaline Ti plasmid pTiC58. The T-DNA itself consists of 24 782 bp flanked by two direct 25 bp repeats, the border sequences. In addition, 3622 bp located at the left and 1070 bp at the right of the T-DNA borders were sequenced. Twenty-two open reading frames that code for proteins larger than 125 amino acids have been identified.Key words: Agrobacterium tumefaciens, sequence, T-DNA.      

Transgene integration in aspen: structures of integration sites and mechanism of T-DNA integration

To obtain insight into the mechanism of transferred DNA (T-DNA) integration in a long-lived tree system, we analysed 30 transgenic aspen lines. In total, 27 right T-DNA/plant junctions, 20 left T-DNA/plant junctions, and 10 target insertions from control plants were obtained. At the right end, the T-DNA was conserved up to the cleavage site in 18 transgenic lines (67%), and the right border repeat was deleted in nine junctions. Nucleotides from the left border repeat were present in 19 transgenic lines out of 20 cases analysed. However, only four (20%) of the left border ends were conserved to the processing end, indicating that the T-DNA left and right ends are treated mechanistically differently during the T-DNA integration process. Comparison of the genomic target sites prior to integration to the T-DNA revealed that the T-DNA inserted into the plant genome without any notable deletion of genomic sequence in three out of 10 transgenic lines analysed. However, deletions of DNA ranging in length from a few nucleotides to more than 500 bp were observed in other transgenic lines. Filler DNAs of up to 235 bp were observed on left and/or right junctions of six transgenic lines, which in most cases originated from the nearby host genomic sequence or from the T-DNA. Short sequence similarities between recombining strands near break points, in particular for the left T-DNA end, were observed in most of the lines analysed. These results confirm the well-accepted T-DNA integration model based on single-stranded annealing followed by ligation of the right border which is preserved by the VirD2 protein. However, a second category of T-DNA integration was also identified in nine transgenic lines, in which the right border of the T-DNA was partly truncated. Such integration events are described via a model for the repair of genomic double-strand breaks in somatic plant cells based on synthesis-dependent strand-annealing. This report in a long-lived tree system provides major insight into the mechanism of transgene integration.     

Overdrive, a T-DNA transmission enhancer on the A. tumefaciens tumour-inducing plasmid

During crown gall tumorigenesis a specific segment of the Agrobacterium tumefaciens tumour-inducing (Ti) plasmid, the T-DNA, integrates into plant nuclear DNA. Similar 23-bp direct repeats at each end of the T region signal T-DNA borders, and T-DNA transmission (transfer and integration) requires the right-hand direct repeat. A chemically synthesized right border repeat in its wild-type orientation promotes T-DNA transmission at a low frequency; Ti plasmid sequences which normally flank the right repeat greatly stimulate the process. To identify flanking sequences required for full right border activity, we tested the activity of a border repeat surrounded by different amounts of normal flanking sequences. Efficient T-DNA transmission required a conserved sequence (5' TAAPuTPy-CTGTPuT-TGTTTGTTTG 3') which lies to the right of the two known right border repeats. In either orientation, a synthetic oligonucleotide containing this conserved sequence greatly stimulated the activity of a right border repeat, and a deletion removing 15 bp from the right end of this sequence destroyed it stimulatory effect. Thus, wild-type T-DNA transmission required both the 23-bp right border repeat and a conserved flanking sequence which we call overdrive.     

Agrobacterium-mediated barley (Hordeum vulgare L.) transformation using green fluorescent protein as a visual marker and sequence analysis of the T-DNA∝barley genomic DNA junctions

Agrobacterium-mediated barley transformation promises many advantages compared to alternative gene transfer methods, but has so far been established in only a few laboratories. We describe a protocol that facilitates rapid establishment and optimisation of Agrobacterium-mediated transformation for barley by instant monitoring of the transformation success. The synthetic green fluorescent protein (sgfpS65T) reporter gene was introduced in combination with thehpt selectable marker gene into immature embryos of barley (Hordeum vulgare L.) by cocultivation with Agrobacterium tumefaciens strain AGLO harboring binary vector pYF133. Using green fluorescent protein (GFP) as a non-destructive visual marker allowed us to identify single-cell recipients of T-DNA at an early stage, track their fate and evaluate factors that affect T-DNA delivery. GFP screening was combined with a low level hygromycin selection. Consequently, transgenic plantlets ready to transfer to soil were obtained within 50 days of explant culture. Southern blot- and progeny segregation analyses revealed a single copy T-DNA insert in more than half of the transgenic barley plants. T-DNA/barley genomic DNA junctions were amplified and sequenced. The right T-DNA ends were highly conserved and clustered around the first 4 nucleotides of the right 25 bp border repeat, while the left T-DNA ends were more variable, located either in the left 25 bp border repeat or within 13 bp from the left repeat. T-DNAs were transferred from Agrobacterium to barley with exclusion of vector sequence suggesting a similar molecular T-DNA transfer mechanism as in dicotyledonous plants.     

Integration of Agrobacterium T-DNA into a tobacco chromosome: Possible involvement of DNA homology between T-DNA and plant DNA

Summary We established tobacco tumour cell lines from crown galls induced by Agrobacterium. Restriction fragments containing T-DNA/plant DNA junctions were cloned from one of the cell lines, which has a single copy of the T-DNA in a unique region of its genome. We also isolated a DNA fragment that contained the integration target site from nontransformed tobacco cells. Nucleotide sequence analyses showed that the right and left breakpoints of the T-DNA mapped ca. 7.3 kb internal to the right 25 by border and ca. 350 by internal to the left border respectively. When the nucleotide sequences around these breakpoints were compared with the sequence of the target, significant homology was seen between the region adjacent to the integration target site and both external regions of the T-DNA breakpoints. In addition, a short stretch of plant DNA in the vicinity of the integration site was deleted. This deletion seems to have been promoted by homologous recombination between short repeated sequences that were present on both sides of the deleted stretch. Minor rearrangements, which included base substitutions, insertions and deletions, also took place around the integration site in the plant DNA. These results, together with previously reported results showing that in some cases sequences homologous to those in T-DNA are present in plant DNA regions adjacent to left recombinational junctions, indicate that sequence homology between the incoming T-DNA and the plant chromosomal DNA has an important function in T-DNA integration. The homology may promote close association of both termini of a T-DNA molecule on a target sequence; then TDNA may in some cases be integrated by a mechanism at least in part analogous to homologous recombination.Shogo Matsumoto is on leave from Biochemical Research Institute, Nippon Menard Cosmetic Co., Ltd, Ogaki, Gifu-ken 503, Japan     

Molecular characterization of T-DNA integration sites in transgenic birch

The integration and structure of a transgene locus can have profound effects on the level and stability of transgene expression. We screened 28 transgenic birch (Betula platyphylla Suk.) lines transformed with an insect-resistance gene (bgt) using Agrobacterium tumefaciens. Among the transgenic plants, the copy number of transgene varied from one to four. A rearrangement or partial deletion had occurred in the process of T-DNA integration. T-DNA repeat formation, detected by reverse primer PCR, was found among randomly screened transgenic lines. Sequencing of the junctions between the T-DNA inserts revealed deletions of 19–589 bp and an additional 45 bp filler DNA sequence was inserted between the T-DNA repeats at one junction. Micro-homologous sequences (1–6 bp) were observed in the junctions between the T-DNA inserts. Using SiteFinding-PCR, a relatively high percentage of AT value was found for the flanking regions. Deletion of the right border repeat was observed in 12/18 of the T-DNA/plant junctions analyzed. The number of nucleotides deleted varied from 3 to 712. Deletions of 17–89 bp were observed in all left T-DNA/plant junctions analyzed. A vector backbone DNA sequence in the transgene loci was also detected using primer pairs outside the left and right T-DNA borders. Approximately 89.3% of the lines contained some vector backbone DNA. These observations revealed that it is important to check the specificity of the integration. A mechanism of T-DNA transport and integration is proposed for this long-lived tree species.     

Direct repeats of T-DNA integrated in tobacco chromosome: characterization of junction regions

Plant transformation via Agrobacterium frequently results in formation of multiple copy T-DNA arrays at one target site of the chromosome. The T-DNA copies are arranged in repeats, direct or inverted around one of the T-DNA borders. A Ti plasmid-derived transformation vector has been constructed enabling direct selection of transformants carrying at least two linked copies of T-DNA in the same orientation. The selection is based on expression of a promoterless neomycin phosphotransferase gene on one T-DNA copy from a promoter located on the other T-DNA copy. After co-cultivation of tobacco protoplasts with Agrobacterium, as many as 30% of regenerated transformed plants carried directly repeated T-DNA copies. The junction regions between two T-DNAs were amplified and 13 amplified fragments were cloned and sequenced. The involvement of T-DNA left and right border sequences in direct repeat junctions was determined. In some junctions, additional filler DNA was detected. The length of filler DNA varied from a few up to almost 300 bp. The longer filler DNAs from two clones were found to be T-DNA fragments in direct or reverse orientation. We discuss the recently suggested models for T-DNA integration and propose that the formation of direct repeats in genomes does not necessarily result from ligation of intermediates (i.e. T-strands), but more likely from the co-integration of several intermediates into one target site.     

The opine synthase genes carried by Ti plasmids contain all signals necessary for expression in plants

Signals necessary for in vivo expression of Ti plasmid T-DNA-encoded octopine and nopaline synthase genes were studied in crown gall tumors by constructing mutated genes carrying various lengths of sequences upstream of the 5' initiation site of their mRNAs. Deletions upstream of position -294 did not interfere with expression of the octopine synthase gene while those extending upstream of position -170 greatly reduced the gene expression. The estimated size of the octopine synthase promoter is therefore 295 bp. The maximal length of 5' upstream sequences involved in the in vivo expression of the nopaline synthase gene is 261 bp. Our results also demonstrated that Ti plasmid-derived sequences contain all signals essential for expression of opine synthase genes in plants. Expression of these genes, therefore, is independent of the direct vicinity of the plant DNA sequences and is not activated by formation of plant DNA and T-DNA border junction.     

Analysis of T-DNA-mediated translational β-glucuronidase gene fusions

Three random translational -glucuronidase (gus) gene fusions were previously obtained in Arabidopsis thaliana, using Agrobacterium-mediated transfer of a gus coding sequence without promoter and ATG initiation site. These were analysed by IPCR amplification of the sequence upstream of gus and nucleotide sequence analysis. In one instance, the gus sequence was fused, in inverse orientation, to the nos promoter sequence of a truncated tandem T-DNA copy and translated from a spurious ATG in this sequence. In the second transgenic line, the gus gene was fused to A. thaliana DNA, 27 bp downstream an ATG. In this line, a large deletion occurred at the target site of the T-DNA. In the third line, gus is fused in frame to a plant DNA sequence after the eighth codon of an open reading frame encoding a protein of 619 amino acids. This protein has significant homology with animal and plant (receptor) serine/threonine protein kinases. The twelve subdomains essential for kinase activity are conserved. The presence of a potential signal peptide and a membrane-spanning domain suggests that it may be a receptor kinase. These data confirm that plant genes can be tagged as functional translational gene fusions.     

Overdrive is a T-region transfer enhancer which stimulates T-strand production in Agrobacterium tumefaciens.

Introduction of a left or right synthetic border repeat together with the overdrive sequence in an octopine Ti-plasmid deletion mutant, lacking the right border, resulted in the complete restoration of the oncogenicity of the mutant strain. However introduction of a border repeat without the overdrive, only restored oncogenicity partially. The overdrive sequence turned out to be able to stimulate the synthetic border mediated T-region transfer, independent of its orientation and position relative to the border repeat. Furthermore the distance between border repeat and overdrive could be enlarged, without a loss of overdrive activity. Here we enlarged the distance between the two sequences up to 6714bp. These results were confirmed by estimating the amount of single stranded T-DNA molecules from induced agrobacteria, containing the various border constructs.     

DNA rearrangement associated with the integration of T-DNA in tobacco: an example for multiple duplications of DNA around the integration target

Transferred DNA (T-DNA) of the tumor-inducing (Ti) plasmid is transferred from Agrobacterium tumefaciens to plant cells and is stably integrated into the plant nuclear genome. By the inverse polymerase chain reaction DNA fragments were amplified that contained the T-DNA/plant DNA junctions from the total DNA of a transgenic tobacco plant that had a single copy of the T-DNA in a repetitive region of its genome. A DNA fragment containing the target site was amplified from the total DNA of non-transformed tobacco by the polymerase chain reaction using high-stringency conditions. Comparison of the nucleotide sequence of the target site with those of the T-DNA/plant DNA junctions revealed that various duplications of short stretches of nucleotide sequences around the target and in the incoming T-DNA had accompanied the integration of the T-DNA. A deletion of 16 bp at the target site was also found and the target site was similar, in terms of nucleotide sequence, to regions around the breakpoints of the T-DNA. This finding provides a clear example of the occurrence of complex rearrangements during the integration of T-DNA.