共查询到20条相似文献,搜索用时 15 毫秒
1.
We analyzed the Hr gene of a hairless mouse strain of unknown origin (HR
strain, http://animal.nibio.go.jp/e_hr.html) to determine whether the strain shares a
mutation with other hairless strains, such as HRS/J and Skh:HR-1, both of which have an
Hrhr allele. Using PCR with multiple pairs of primers
designed to amplify multiple overlapping regions covering the entire Hr
gene, we found an insertion mutation in intron 6 of mutant Hr genes in HR
mice. The DNA sequence flanking the mutation indicated that the mutation in HR mice was
the same as that of Hrhr in the HRS/J strain. Based on the
sequence, we developed a genotyping method using PCR to determine zygosities. Three
primers were designed: S776 (GGTCTCGCTGGTCCTTGA), S607 (TCTGGAACCAGAGTGACAGACAGCTA), and
R850 (TGGGCCACCATGGCCAGATTTAACACA). The S776 and R850 primers detected the
Hrhr allele (275-bp amplicon), and S607 and R850
identified the wild-type Hr allele (244-bp amplicon). Applying PCR using
these three primers, we confirmed that it is possible to differentiate among homozygous
Hrhr (longer amplicons only), homozygous wild-type
Hr(shorter amplicons only), and heterozygous (both amplicons) in HR and
Hos:HR-1 mice. Our genomic analysis indicated that the HR, HRS/J, and Hos:HR-1 strains,
and possibly Skh:HR-1 (an ancestor of Hos:HR-1) strain share the same
Hrhr gene mutation. Our genotyping method will facilitate
further research using hairless mice, and especially immature mice, because pups can be
genotyped before their phenotype (hair coat loss) appears at about 2 weeks of age. 相似文献
2.
One of the phenotypic effects of mutation in the Hr gene in mice is disintegration of hair follicles and their degeneration into open funnel-shaped structures (utricles) opened
on skin surface and cysts located in the depth of the dermis. The aim of the current study consists in analysis of the process
of reparative regeneration of skin in homozygotous mice with one of the mutant alleles of the Hr gene— Hr
hr
. It is shown that epithelial cells that constitute the inner pavement of cysts take part in the process of epithelization
of deep skin wounds. This indicates that the competence of ectodermal cells in relation to inductive signals from injured
skin remains in Hr
hr
homozygote mice, in spite of the significant anatomic abnormalities of the hair follicles. 相似文献
3.
N-ethyl- N-nitrosourea (ENU) mutagenesis screens have been successful for identifying genes that affect important biological processes
and diseases. However, for heart-related phenotypes, these screens have been employed exclusively for developmental phenotypes,
and to date no adult cardiomyopathy-causing genes have been discovered through a mutagenesis screen. To identify novel disease-causing
and disease-modifying genes for cardiomyopathy, we performed an ENU recessive mutagenesis screen in adult mice. Using noninvasive
echocardiography to screen for abnormalities in cardiac function, we identified a heritable cardiomyopathic phenotype in two
families. To identify the chromosomal regions where the mutations are localized, we used a single nucleotide polymorphism
(SNP) panel for genetic mapping of mouse mutations. This panel provided whole-genome linkage information and identified the
mutagenized candidate regions at the proximal end of chromosome 1 (family EN1), and at the distal end of chromosome 15 (family
EN25). We have identified 94 affected mice in family EN1 and have narrowed the candidate interval to 1 Mb. We have identified
20 affected mice in family EN25 and have narrowed the candidate interval to 12 Mb. The identification of the genes responsible
for the observed phenotype in these families will be strong candidates for disease-causing or disease-modifying genes in patients
with heart failure.
Electronic supplementary material The online version of this article (doi:) contains supplementary material, which is available to authorized users. 相似文献
4.
AbstractHaptoglobin gene knockout mice and wild-type controls were infected with Plasmodium berghei ANKA or Plasmodium chabaudi. The peak parasitaemia and parasite burden were higher in Hp -/- mice than in Hp +/+ mice. The increase in spleen weight following malaria infection was smaller in Hp -/- mice than in Hp +/+ animals. The occurrence of cerebral malaria in P. berghei ANKA infection was not different in Hp gene knockout mice and their controls. 相似文献
5.
The Hairless nuclear receptor co‐repressor is required for hair follicle regeneration during the hair cycle. The classical HairlessHr/HairlessHr mouse mutant loses all hair between 2 and 3 weeks of age. As the mice age, their trunk skin develops epidermal pigmentation, a feature of human skin which is not found in normal haired mice. In this report, we present a new, dominant mouse mutation, Pied, which arose within a colony of HairlessHr/HairlessHr mice and causes freckle‐like macules on the skin. The Pied macules require HairlessHr homozygosity to form and are composed of localized clusters of epidermal melanocytes. Through linkage analysis, we find that the Pied mutation is a 1914 base pair loss‐of‐function deletion in the Adam10 zinc metalloprotease gene. The pathways that specifically maintain long‐term pigmentation patterns in adults are not well understood. We have identified Adam10 as an inhibitor of melanocyte expansion in adult skin. 相似文献
6.
AbstractHaptoglobin (Hp), a conserved plasma glycoprotein, forms very stable soluble complexes with free plasma haemoglobin. Haemoglobin binding by haptoglobin is thought to be important in the rapid hepatic clearance of haemoglobin from the plasma and in the inhibition of glomerular filtration of haemoglobin. It is thought to reduce haemoglobin-induced renal damage during haemolysis. To evaluate these functions, Hp knockout (Hp -/-) mice were created. The Hp -/- mouse was generated by a standard gene replacement technique in mouse embryonic stem cells. These mice were evaluated with and without haemolysis using several parameters: mortality, haemoglobin clearance, renal tissue damage and function.Hp -/- mice were viable but had a small, significant reduction in postnatal viability. The lack of Hp did not impair clearance of free plasma haemoglobin. Induction of severe haemolysis by phenylhydrazine caused extensive haemoglobin precipitation in the renal tubular cells. However, haemoglobin precipitation in the kidney was not increased in Hp -/- mice. Nevertheless, Hp -/- mice were more susceptible to phenylhydrazine with a mortality rate of 55% in Hp -/- mice versus 18% in Hp +/+ mice. In general, phenylhydrazine-treated Hp -/- mice suffered greater tissue damage, as evidenced by the induction of a hepatic acute phase response, resulting in increased plasma 1-acidic glycoprotein (AGP) levels and higher plasma malonaldehyde (MDA) and 4-hydroxy-2(E)-nonenal (HNE) levels. Gross pathological analysis indicated that the kidney was the most affected tissue in phenylhydrazine-treated Hp -/- and Hp +/+ mice, and Hp -/- mice were more severely affected. They had lower mitotic indices in their kidneys, higher basal levels of renal lipid peroxidation, as evidenced by levels of malonaldehyde and 4-hydroxy-2(E)-nonenal (MDA/HNE) and elevated levels of 8-hydroxyguanine (but not other products of oxidative DNA damage). There also was increased induction of haem oxygenase-1. The more severe renal damage in Hp -/- mice was also evident in the delayed erythropoietin gene expression and poorer renal clearance of [ 3H]-inulin. The reduction in glomerular filtration function in Hp +/+ and Hp -/- mice could be restored to baseline by vasodilators (prazosin or diazoxide), implicating renal vasoconstriction as a major mechanism of acute renal failure during induced haemolysis.These data suggest that Hp plays a pivotal role in reducing renal oxidative damage during haemolysis. 相似文献
7.
The Kluyveromyces lactis UDP-GlcNAc transporter (KlMnn2-2p) is responsible for the biosynthesis of N-glycans containing N-acetylglucosamine. A putative gene of Hansenula polymorpha encoding a KlMnn2-2p homologue, Hp MNN2-2, was identified and investigated for its function. The deletion mutant strain of Hp MNN2-2 (Hp mnn2-2Δ) showed increased sensitivity to geneticin, hygromycin B, and tunicamycin. However, the Hp mnn2-2Δ strain exhibited increased resistance to Calcofluor white, an inhibitor of chitin biosynthesis, along with a reduced chitin
content. The localization of HpMnn2-2p at the endoplasmic reticulum-enriched membrane, different from the Golgi localization
of a K. lactis homologue, further supports the involvement of HpMnn2-2p in cell wall chitin biosynthesis. 相似文献
8.
We have identified a novel base substitution at codon 247 in the -chain of the haptoglobin 2 ( Hp2) allele in a Ghanaian with the Hp0 (ahaptoglobinemic) phenotype. The heterozygous TC substitution caused reduced expression of the protein when the mutant was transfected into COS7 cells. The base substitution resulted in a missense change of the non-polar amino acid isoleucine to the polar amino acid threonine at a position in the -chain that is highly conserved among several species. We had previously identified a mutation in the Hp gene promoter region for the same individual, which gives her genotype as –61C Hp2/–61C Hp2(I247T). Since the –61C mutation also leads to low Hp expression, the genotype represents the first and most definitive ahaptoglobinemic case reported in Africa. 相似文献
9.
The salt-tolerance gene rstB under the control of the cauliflower mosaic virus 35S promoter was used as a selectable marker gene in the Agrobacterium tumefaciens-mediated transformation of tobacco ( Nicotiana tabacum cv. Xanthi). The selective agent for plant regeneration was tolerance to 170 mM sodium chloride. The highest selection efficiency
was 83.3%. No obvious differences in selection efficiencies were observed when those obtained using the standard selectable
marker gene hpt and a selection regime of 10 mg l −1 hygromycin. Transgenic events were confirmed by PCR, Southern blot, RT-PCR and green fluorescent protein studies. The rstB transgenic plants showed improved salt tolerance and a normal phenotype. Based on these results, we suggest that the rstB gene may be used as a promising selectable marker and an alternative to the antibiotic- or herbicide-resistance genes in
plant transformation.
Electronic supplementary material The online version of this article (doi:) contains supplementary material, which is available to authorized users. 相似文献
12.
Phosphoethanolamine N-methyltransferase (PEAMT) is involved in choline biosynthesis in plants. The 5′ untranslated region (UTR) of several PEAMT genes was found to contain an upstream open reading frame (uORF). We generated transgenic Arabidopsis calli that expressed a chimeric gene constructed by fusing the 5′ UTR of the Arabidopsis PEAMT gene ( AtNMT1) upstream of the β-glucuronidase gene. The AtNMT1 uORF was found to be involved in declining levels of the chimeric gene mRNA and repression of downstream β-glucuronidase gene translation in the calli when the cells were treated with choline. Further, we discuss the role of the uORF. 相似文献
13.
PurposeThis study explored a novel homological analysis method for prognostic prediction in lung cancer patients. Materials and methodsThe potential of homology-based radiomic features (HFs) was investigated by comparing HFs to conventional wavelet-based radiomic features (WFs) and combined radiomic features consisting of HFs and WFs (HWFs), using training (n = 135) and validation (n = 70) datasets, and Kaplan–Meier analysis. A total of 13,824 HFs were derived through homology-based texture analysis using Betti numbers, which represent the topologically invariant morphological characteristics of lung cancer. The prognostic potential of HFs was evaluated using statistically significant differences (p-values, log-rank test) to compare the survival curves of high- and low-risk patients. Those patients were stratified into high- and low-risk groups using the medians of the radiomic scores of signatures constructed with an elastic-net-regularized Cox proportional hazard model. Furthermore, deep learning (DL) based on AlexNet was utilized to compare HFs by stratifying patients into the two groups using a network that was pre-trained with over one million natural images from an ImageNet database. ResultsFor the training dataset, the p-values between the two survival curves were 6.7 × 10 −6 (HF), 5.9 × 10 −3 (WF), 7.4 × 10 −6 (HWF), and 1.1 × 10 −3 (DL). The p-values for the validation dataset were 3.4 × 10 −5 (HF), 6.7 × 10 −1 (WF), 1.7 × 10 −7 (HWF), and 1.2 × 10 −1 (DL). ConclusionThis study demonstrates the excellent potential of HFs for prognostic prediction in lung cancer patients. 相似文献
15.
The present study reports an analysis of the distribution of Hp polymorphism in Sardinia carried out on a sample of 871 individuals.
The samples are examined according to the division by provinces and by historical-geographical regions. In both cases the
phenotype Hp 2-1 has high frequency and a North-South trend. The Hp *1 is the most common gene in every part of Sardinia. In general the distribution of Hp in Sardinia is not significantly heterogeneous
in our sample, although presenting a discreet variability.
The synthesis of our data and of the data available in literature shows some historical-geographical areas, especially in the central north of the island, with particularly high Hp *1 frequency (Baronie Siniscola and Orosei, Barbagie Ollorai and Belvì and Planargia; Sarrabus in the South).
Similar high values of Hp *1 have been highlighted in some groups of population in the Mediterranean basin, characterized by a certain geographical and/or
cultural isolation. 相似文献
16.
Single-stranded DNA (ssDNA)-binding protein (SSB) plays an important role in DNA replication, recombination, and repair. SSB consists of an N-terminal ssDNA-binding domain with an oligonucleotide/oligosaccharide binding fold and a flexible C-terminal tail involved in protein-protein interactions. SSB from Helicobacter pylori ( HpSSB) was isolated, and the ssDNA-binding characteristics of HpSSB were analyzed by fluorescence titration and electrophoretic mobility shift assay. Tryptophan fluorescence quenching was measured as 61%, and the calculated cooperative affinity was 5.4 × 10 7 M − 1 with an ssDNA-binding length of 25-30 nt. The crystal structure of the C-terminally truncated protein ( HpSSBc) in complex with 35-mer ssDNA [ HpSSBc-(dT) 35] was determined at a resolution of 2.3 Å. The HpSSBc monomer folds as an oligonucleotide/oligosaccharide binding fold with a Y-shaped conformation. The ssDNA wrapped around the HpSSBc tetramer through a continuous binding path comprising five essential aromatic residues and a positively charged surface formed by numerous basic residues. 相似文献
17.
We investigated malaria-associated pathology in mice co-infected with Heligmosomoides polygyrus ( Hp) and Plasmodium chabaudi AS ( Pc). Despite higher peak parasitemia, co-infected wild-type (WT) C57BL/6 mice displayed similar body weight losses, malarial anaemia, and tissue damage but less severe hypothermia and hypoglycaemia, and earlier reticulocytosis than Pc-infected WT mice. Co-infected STAT6 −/− mice, deficient in nematode-induced Th2 responses, experienced similar peak parasitemias and generally suffered malaria-associated pathology to a similar degree as co-infected WT mice. These data indicate a complex relationship amongst helminths, malaria and host immune responses resulting in modulation of some but not all aspects of malaria-associated pathology. 相似文献
18.
β-N-Acetylglucosaminidases (GlcNAcases) are important for many biological functions and industrial applications. In this study, a glycoside hydrolase family 20 GlcNAcase from Shinella sp. JB10 was expressed in Escherichia coli BL21 (DE3). Compared to many GlcNAcases, the purified recombinant enzyme (rJB10Nag) exhibited a higher specificity activity (538.8 µmol min−1 mg−1) or V
max (1030.0 ± 82.1 µmol min−1 mg−1) toward p-nitrophenyl β-N-acetylglucosaminide and N,N′-diacetylchitobiose (specificity activity of 35.4 µmol min−1 mg−1) and a higher N-acetylglucosaminide tolerance (approximately 50% activity in 70.0 mM N-acetylglucosaminide). The degree of synergy on enzymatic degradation of chitin by a commercial chitinase and rJB10Nag was as high as 2.35. The enzyme was tolerant to most salts, especially 3.0–15.0% (w/v) NaCl and KCl. These biochemical characteristics make the JB10 GlcNAcase a candidate for use in many potential applications, including processing marine materials and the bioconversion of chitin waste. Furthermore, the enzyme has the highest proportions of alanine (16.5%), glycine (10.5%), and random coils (48.8%) with the lowest proportion of α-helices (24.9%) among experimentally characterized GH 20 GlcNAcases from other organisms. 相似文献
20.
Using gene targeting by homologous recombination in Ceratodon purpureus, we were able to knock out four phytochrome photoreceptor genes independently and to analyze their function with respect
to red light dependent phototropism, polarotropism, and chlorophyll content. The strongest phenotype was found in knock-out
lines of a newly described phytochrome gene termed CpPHY4 lacking photo- and polarotropic responses at moderate fluence rates. Eliminating the atypical phytochrome gene CpPHY1, which is the only known phytochrome-like gene containing a putative C-terminal tyrosine kinase-like domain, affects red
light-induced chlorophyll accumulation. This result was surprising, since no light dependent function was ever allocated to
this unusual gene.
Electronic supplementary material The online version of this article (doi:) contains supplementary material, which is available to authorized users.
Accession number for CpPHY4: EU122393. 相似文献
|