共查询到18条相似文献,搜索用时 15 毫秒
1.
This paper analyzes the DNA code of several species in the perspective of information content. For that purpose several concepts and mathematical tools are selected towards establishing a quantitative method without a priori distorting the alphabet represented by the sequence of DNA bases. The synergies of associating Gray code, histogram characterization and multidimensional scaling visualization lead to a collection of plots with a categorical representation of species and chromosomes. 相似文献
2.
Fabio Coppedè Francesca Migheli Angela Lopomo Alessandra Failli Annalisa Legitimo Rita Consolini Gabriella Fontanini Elisa Sensi Adele Servadio Massimo Seccia Giuseppe Zocco Massimo Chiarugi Roberto Spisni Lucia Migliore 《Epigenetics》2014,9(4):621-633
We evaluated the promoter methylation levels of the APC, MGMT, hMLH1, RASSF1A and CDKN2A genes in 107 colorectal cancer (CRC) samples and 80 healthy adjacent tissues. We searched for correlation with both physical and pathological features, polymorphisms of folate metabolism pathway genes (MTHFR, MTRR, MTR, RFC1, TYMS, and DNMT3B), and data on circulating folate, vitamin B12 and homocysteine, which were available in a subgroup of the CRC patients. An increased number of methylated samples were found in CRC respect to adjacent healthy tissues, with the exception of APC, which was also frequently methylated in healthy colonic mucosa. Statistically significant associations were found between RASSF1A promoter methylation and tumor stage, and between hMLH1 promoter methylation and tumor location. Increasing age positively correlated with both hMLH1 and MGMT methylation levels in CRC tissues, and with APC methylation levels in the adjacent healthy mucosa. Concerning gender, females showed higher hMLH1 promoter methylation levels with respect to males. In CRC samples, the MTR 2756AG genotype correlated with higher methylation levels of RASSF1A, and the TYMS 1494 6bp ins/del polymorphism correlated with the methylation levels of both APC and hMLH1. In adjacent healthy tissues, MTR 2756AG and TYMS 1494 6bp del/del genotypes correlated with APC and MGMT promoter methylation, respectively. Low folate levels were associated with hMLH1 hypermethylation. Present results support the hypothesis that DNA methylation in CRC depends from both physiological and environmental factors, with one-carbon metabolism largely involved in this process. 相似文献
3.
4.
5.
Wen-Liang Li Mei-Sheng Xiao Deng-Feng Zhang Dandan Yu Run-Xiang Yang Xiao-Yan Li Yong-Gang Yao 《Gene》2014
Colorectal cancer (CRC) is one of the leading causes of death around the world. Its genetic mechanism was intensively investigated in the past decades with findings of a number of canonical oncogenes and tumor-suppressor genes such as APC, KRAS, and TP53. Recent genome-wide association and sequencing studies have identified a series of promising oncogenes including IDH1, IDH2, DNMT3A, and MYD88 in hematologic malignancies. However, whether these genes are involved in CRC remains unknown. In this study, we screened the hotspot mutations of these four genes in 305 CRC samples from Han Chinese by direct sequencing. mRNA expression levels of these genes were quantified by quantitative real-time PCR (RT-qPCR) in paired cancerous and paracancerous tissues. Association analyses between mRNA expression levels and different cancerous stages were performed. Except for one patient harboring IDH1 mutation p.I99M, we identified no previously reported hotspot mutations in colorectal cancer tissues. mRNA expression levels of IDH1, DNMT3A, and MYD88, but not IDH2, were significantly decreased in the cancerous tissues comparing with the paired paracancerous normal tissues. Taken together, the hotspot mutations of IDH1, IDH2, DNMT3A, and MYD88 gene were absent in CRC. Aberrant mRNA expression of IDH1, DNMT3A, and MYD88 gene might be actively involved in the development of CRC. 相似文献
6.
Susana Isabel Ferreira Luís Miguel Pires José Ferrão Joaquim Sá Armando Serra Isabel Marques Carreira 《Gene》2013
Fragile X syndrome is caused by the expansion of an unstable CGG repeat in the 5′UTR of FMR1 gene. The occurrence of mosaicism is not uncommon, especially in male patients, whereas in females it is not so often reported. Here we report a female foetus that was subject to prenatal diagnosis, because of her mother being a premutation carrier. The foetus was identified as being a mosaic for an intermediate allele and a full mutation of FMR1 gene, in the presence of a normal allele. The mosaic status was confirmed in three different tissues of the foetus – amniotic fluid, skin biopsy and blood – the last two obtained after pregnancy termination. Karyotype analysis and X-chromosome STR markers analysis do not support the mosaicism as inheritance of both maternal alleles. Oligonucleotide array-CGH excluded an imbalance that could contain the primer binding site with a different repeat size. The obtained results give compelling evidence for a postzygotic expansion mechanism where the foetus mosaic pattern originated from expansion of the mother's premutation into a full mutation and consequent regression to an intermediate allele in a proportion of cells. These events occurred in early embryogenesis before the commitment of cells into the different tissues, as the three tested tissues of the foetus have the same mosaic pattern. The couple has a son with Fragile X mental retardation syndrome and choose to terminate this pregnancy after genetic counselling. 相似文献
7.
Natalie K. Thomas 《Experimental cell research》2010,316(7):1241-446
Extracellular translocation of the polysaccharide, hyaluronan (HA) has been thought to be mediated via its transmembrane synthetic enzyme, hyaluronan synthase (HAS) but recent studies have indicated that the ATP-Binding-Cassette (ABC) transporter, MRP5 contributes to this process. Liberated and cell-associated HA contributes to breast cancer initiation and progression, and therefore the inhibition of ABC transporters and consequently HA transport could provide therapeutic benefit in the treatment of breast cancer. Quantitation of ABC transporter genes, MRP1-5, BCRP and MDR1 were determined in six breast cancer cell lines selected for their differential HA synthetic rates. Low endogenous expression of transporters was detected but no significant correlation existed between ABC transporter and HAS gene expression or HA production. A dose titration of up to ten times the IC50 of ten small molecule ABC transporter inhibitors did not significantly inhibit HA export in four breast cancer cell lines. Unlike the changes observed after inhibition of HA synthesis by the characterised inhibitor 4-MU, inhibition of ABC transporters did not alter the cell morphology, HA glycocalyx or the intracellular quantity or localisation of HA. Collectively these data indicate that ABC transporters do not contribute to the extracellular transport of HA in breast cancer, supporting a role for the hyaluronan synthase in translocation. 相似文献
8.
Epigenetic regulation is important for maintaining gene expression patterns in multicellular organisms. The Polycomb Group (PcG) proteins form several complexes with important and deeply conserved epigenetic functions in both the plant and animal kingdoms. The plant Polycomb Repressive Complex 2 (PRC2) contains four core proteins, Enhancer of Zeste (E(z)), Suppressor of Zeste 12 (Su(z)12), Extra Sex Combs (ESC), and Multicopy Suppressor of IRA 1 (MSI1), and functions in many developmental transitions. In some plant species, including rice and Arabidopsis, duplications in the core PRC2 proteins allow the formation of PRC2s with distinct developmental functions. In addition, members of the plant specific VEL PHD family have been shown to associate with the PRC2 complex in Arabidopsis and may play a role in targeting the PRC2 to specific loci. Here we examine the evolution and expression of the PRC2 and VEL PHD families in Aquilegia, a member of the lower eudicot order Ranunculales and an emerging model for the investigation of plant ecology, evolution and developmental genetics. We find that Aquilegia has a relatively simple PRC2 with only one homolog of Su(z)12, ESC and MSI1 and two ancient copies of E(z), AqSWN and AqCLF. Aquilegia has four members of the VEL PHD family, three of which appear to be closely related to Arabidopsis proteins known to associate with the PRC2. The PRC2 and VEL PHD family proteins are expressed at a relatively constant level throughout Aquilegia vulgaris development, with the VEL PHD family and MSI1 expressed at higher levels during and after vernalization and in the inflorescence. Both AqSWN and AqCLF are expressed in Aquilegia endosperm but neither copy is imprinted. 相似文献
9.
Abeer Hammoudi Fei Song Karen R. Reed Rosalind E. Jenkins Valerie S. Meniel Alastair J.M. Watson D. Mark Pritchard Alan R. Clarke John R. Jenkins 《Biochemical and biophysical research communications》2013
Colorectal cancer (CRC) is the fourth most common cause of cancer-related death worldwide. Accurate non-invasive screening for CRC would greatly enhance a population’s health. Adenomatous polyposis coli (Apc) gene mutations commonly occur in human colorectal adenomas and carcinomas, leading to Wnt signalling pathway activation. Acute conditional transgenic deletion of Apc in murine intestinal epithelium (AhCre+Apcfl/fl) causes phenotypic changes similar to those found during colorectal tumourigenesis. This study comprised a proteomic analysis of murine small intestinal epithelial cells following acute Apc deletion to identify proteins that show altered expression during human colorectal carcinogenesis, thus identifying proteins that may prove clinically useful as blood/serum biomarkers of colorectal neoplasia. Eighty-one proteins showed significantly increased expression following iTRAQ analysis, and validation of nine of these by Ingenuity Pathaway Analysis showed they could be detected in blood or serum. Expression was assessed in AhCre+Apcfl/fl small intestinal epithelium by immunohistochemistry, western blot and quantitative real-time PCR; increased nucelolin concentrations were also detected in the serum of AhCre+Apcfl/fl and ApcMin/+ mice by ELISA. Six proteins; heat shock 60 kDa protein 1, Nucleolin, Prohibitin, Cytokeratin 18, Ribosomal protein L6 and DEAD (Asp-Glu-Ala-Asp) box polypeptide 5,were selected for further investigation. Increased expression of 4 of these was confirmed in human CRC by qPCR. In conclusion, several novel candidate biomarkers have been identified from analysis of transgenic mice in which the Apc gene was deleted in the intestinal epithelium that also showed increased expression in human CRC. Some of these warrant further investigation as potential serum-based biomarkers of human CRC. 相似文献
10.
Genetic mutation in cytochrome c oxidase subunit III gene (MT-CO3) could influence the kinetics of cytochrome c oxidase (COX), which catalyzes oxygen transport capacity in oxidative phosphorylation. However, the potential relationship between MT-CO3 variants and high-altitude adaptation remains poorly understood in Tibetan chicken. Here, we sequenced MT-CO3 gene of 125 Tibetan chickens and 144 Chinese domestic chickens in areas at a low elevation (below 1000 m). Eight single nucleotide polymorphisms (SNPs) were detected; and five of them (m.10081A>G, m.10115G>A, m.10270G>A, m.10336A>G and m.10447C>T) shared by Tibetan chicken and lowland chicken with the significant difference in their respective allele frequencies. Nine haplotypes (H1–H9) were finally defined. Among them, haplotype H4 was positively associated with high-altitude adaptation whereas haplotypes H6, H7 and H8 had negative association with high-altitude adaptation. The Median-joining profile suggested that haplotype H5 had the ancestral position to the other haplotypes but had no significant relationship with high-altitude adaptation. However, there was only m.10081A>G mutation differed from haplotype H4 and H5. Results also suggested that chickens with A allele at m.10081A>G, had over 2.6 times than those with G allele in the probability of the ability to adapt hypoxia. It suggests that the synonymous mutation m.10081A>G may be a prerequisite for shaping high-altitude adaptation-specific haplotypes. 相似文献
11.
12.
Claudia Cano-Ramírez María Fernanda López Ana K. Cesar-Ayala Verónica Pineda-Martínez Brian T. Sullivan Gerardo Zúñiga 《Gene》2013
Bark beetles oxidize the defensive monoterpenes of their host trees both to detoxify them and convert them into components of their pheromone system. This oxidation is catalyzed by cytochrome P450 enzymes and occurs in different tissues of the insect, including the gut (i.e., the site where the beetle's pheromones are produced and accumulated) and the antennae (i.e., the olfactory organs used for perception of airborne defensive monoterpenes as well as other host-associated compounds and pheromones). We identified ten new CYP genes in the pine beetle Dendroctonus rhizophagus in either antennae or gut tissue after stimulation with the vapors of major host monoterpenes α-pinene, β-pinene and 3-carene. Five genes belong to the CYP4 family, four to the CYP6 family and one to the CYP9 family. Differential expression of almost all of the CYP genes was observed between sexes, and within these significant differences among time, stimuli, anatomical region, and their interactions were found upon exposure to host monoterpenes. Increased expression of cytochrome P450 genes suggests that they play a role in the detoxification of monoterpenes released by this insect's host trees. 相似文献
13.
Hua Wang Yan Fang Zhongzan Bao Xing Jin Wenjuan Zhu Lipeng Wang Teng Liu Haipeng Ji Haiying Wang Shiqing Xu Yanghu Sima 《Gene》2014
Elucidating the mechanisms underlying the response and resistance to high-temperature stress in the Lepidoptera is essential for understanding the effect of high-temperature on the regulation of gene expression. A tag (CATGAACGTGAAGAGATTCAG) matching the predicted gene BGIBMGA005823-TA in SilkDB identified the most significant response to high-temperature stress in a screen of the heat-treated digital gene expression library of Bombyx mori (B. mori) (Unpublished data). BLAST and RACE showed that the gene is located on chromosome 5 and has an open reading frame (ORF) of 741 bp. Phylogenetic analysis found that B. mori small heat shock protein 27.4 (BmHSP27.4) is in an evolutionary branch separate from other small heat shock proteins. Expression analysis showed that BmHsp27.4 is highly expressed in brain, eyes and fat bodies in B. mori. Its mRNA level was elevated at high-temperature and this increase was greater in females. The ORF without the signal peptide sequence was cloned into vector pET-28a(+), transformed and over-expressed in Escherichia coli Rosetta (DE3). Western blotting and immunofluorescence analysis with a polyclonal antibody, confirmed that the level of protein BmHSP27.4 increased at a high-temperature, in accordance with its increased mRNA level. In this study, BmHsp27.4 was identified as a novel B. mori gene with an important role in response to high-temperature stress. 相似文献
14.
John Hsieh Kristin S. Koutmou Markos Koutmos Carol A. Fierke 《Journal of molecular biology》2010,400(1):38-383
Metal ions interact with RNA to enhance folding, stabilize structure, and, in some cases, facilitate catalysis. Assigning functional roles to specifically bound metal ions presents a major challenge in analyzing the catalytic mechanisms of ribozymes. Bacillus subtilis ribonuclease P (RNase P), composed of a catalytically active RNA subunit (PRNA) and a small protein subunit (P protein), catalyzes the 5′-end maturation of precursor tRNAs (pre-tRNAs). Inner-sphere coordination of divalent metal ions to PRNA is essential for catalytic activity but not for the formation of the RNase P·pre-tRNA (enzyme-substrate, ES) complex. Previous studies have demonstrated that this ES complex undergoes an essential conformational change (to the ES? conformer) before the cleavage step. Here, we show that the ES? conformer is stabilized by a high-affinity divalent cation capable of inner-sphere coordination, such as Ca(II) or Mg(II). Additionally, a second, lower-affinity Mg(II) activates cleavage catalyzed by RNase P. Structural changes that occur upon binding Ca(II) to the ES complex were determined by time-resolved Förster resonance energy transfer measurements of the distances between donor-acceptor fluorophores introduced at specific locations on the P protein and pre-tRNA 5′ leader. These data demonstrate that the 5′ leader of pre-tRNA moves 4 to 6 Å closer to the PRNA·P protein interface during the ES-to-ES? transition and suggest that the metal-dependent conformational change reorganizes the bound substrate in the active site to form a catalytically competent ES? complex. 相似文献
15.
16.
Nogueira A Catarino R Faustino I Nogueira-Silva C Figueiredo T Lombo L Hilário-Silva I Pereira D Medeiros R 《Gene》2012,504(2):279-283
Introduction
Cervical cancer is one of the most common cancers diagnosed in women worldwide. Mammalian cells are constantly exposed to a wide variety of genotoxic agents from both endogenous and exogenous sources. The RAD51 protein is required for meiotic and mitotic recombination and plays a central role in homology-dependent recombinational repair of double-strand breaks (DSBs). Given the functional relevance of the DNA repair system on carcinogenesis, potential associations between genetic polymorphisms of DNA repair genes, cancer risk and response to therapy have been intensively evaluated. This is the first study evaluating the role of the RAD51 G172T genetic variants in cancer prognosis and clinical outcome of cervical cancer patients.Material and methods
We analyzed RAD51 G172T polymorphism genotypes in cervical cancer patients who underwent a platinum-based chemotherapy in combination with radiotherapy. Genotyping was performed by Taqman™ Allelic Discrimination methodology.Results and discussion
Concerning the overall survival rates found using Kaplan–Meier method and Log Rank Test, we observed that the mean survival rates were statistically different according to the patients RAD51 genotypes. The group of patients carrying the T allele present a higher mean survival rate than the other patients (102.3 months vs. 86.4 months, P = 0.020). Using the Cox regression analysis, we found an increased overall survival time for T-carrier patients, when compared with GG genotype, with tumor stage, age and presence of lymph nodes as covariates [hazard ratio (HR), 0.373; 95% CI, 0.181–0.770; P = 0.008]. Among patients (n = 193), RAD51 genotype frequency distributions were not under the influence of clinicopathologic characteristics, namely, treatment response (P = 0.508), recurrence (P = 0.150) and tumor stage (P = 0.250).Conclusions
This is the first study evaluating the role of the RAD51 G172T genetic variants in cancer prognosis and clinical outcome of cervical cancer patients. Our results indicate an influence of the RAD51 genetic variants in overall survival of cervical cancer. Thereby, RAD51 G172T genotypes may provide additional prognostic information in cervical cancer patients who underwent cisplatin-based chemotherapy in combination with radiotherapy. 相似文献17.
Although the wheat hybrids have often shown higher grain yields, the physiological basis of the higher yields remains unknown. Previous studies suggest that tolerance to photoinhibition in the hybrid may be one of the physiological bases (Yang et al., 2006, Plant Sci 171:389-97). The objective of this study was to further investigate the possible mechanism responsible for tolerance to photoinhibition in the hybrid. Photosystem II (PSII) photochemistry, the xanthophyll cycle, and antioxidative defense system were compared between the hybrid and its parents subjected to high light stress (1500 μmol m−2 s−1). The analyses of oxygen-evolving activity, chlorophyll fluorescence, and protein blotting demonstrated that the higher tolerance in the hybrid than in its parents was associated with its higher tolerance of PSII to photoinhibition. High light induced an increase in non-photochemical quenching, and this increase was greater in the hybrid than in its parents. There were no differences in the pool size of the xanthophyll cycle between the hybrid and its parents. The content of violaxanthin decreased significantly, whereas the content of zeaxanthin + antherxanthin increased considerably during high light treatments. However, the decrease in violaxanthin content and the increase in zeaxanthin + antherxanthin content were greater in the hybrid than in its parents. High light resulted in a significant accumulation of H2O2, O2− and catalytic Fe, and this accumulation was less in the hybrid than in its parents. High light induced a significant increase in the activities of superoxide dismutase, catalase, ascorbate peroxidase, glutathione reductase, dehydroascorbate reductase, and monodehydroascorbate reductase, and these increases were greater in the hybrid than its parents. These results suggest that the higher tolerance to photoinhibition in the hybrid may be associated with its higher capacity for antioxidative defense metabolism and the xanthophyll cycle. 相似文献
18.
Molecular and structural analysis of C4-specific PEPC isoform from Pennisetum glaucum plays a role in stress adaptation 总被引:1,自引:0,他引:1
As an activator of adenylate cyclase, the neuropeptide Pituitary Adenylate Cyclase Activating Peptide (PACAP) impacts levels of cyclic AMP, a key second messenger available in brain cells. PACAP is involved in certain adult behaviors. To elucidate PACAP interactions, a compendium of microarrays representing mRNA expression in the adult mouse whole brain was pooled from the Phenogen database for analysis. A regulatory network was computed based on mutual information between gene pairs using gene expression data across the compendium. Clusters among genes directly linked to PACAP, and probable interactions between corresponding proteins were computed. Database “experts” affirmed some of the inferred relationships. The findings suggest ADCY7 is probably the adenylate cyclase isoform most relevant to PACAP's action. They also support intervening roles for kinases including GSK3B, PI 3-kinase, SGK3 and AMPK. Other high-confidence interactions are hypothesized for future testing. This new information has implications for certain behavioral and other disorders. 相似文献