Studies on formation and stability of the d[G(AG)5]* d[G(AG)5]·d[C(TC)5] and d[G(TG)5]* d[G(AG)5]· d[C(TC)5] triple helices

We have targeted the d[G(AG)₅] · d[C(TC)₅] duplex for triplex formation at neutral pH with either d[G(AG)₅] or d[G(TG)₅]. Using a combination of gel electrophoresis, uv and CD spectra, mixing and melting curves, along with DNase I digestion studies, we have investigated the stability of the 2:1 pur*pur · pyr triplex, d[G(AG)₅] * d[G(AG)₅] · d[C(TC)₅], in the presence of MgCl₂. This triplex melts in a monophasic fashion at the same temperature as the underlying duplex. Although the uv spectrum changes little upon binding of the second purine strand, the CD spectrum shows significant changes in the wavelength range 200–230 nm and about a 7 nm shift in the positive band near 270 nm. In contrast, the 1:1:1 pur/pyr*pur · pyr triplex, d[G(TG)₅] * d[G(AG)₅] · d[C(TC)₅], is considerably less stable thermally, melting at a much lower temperature than the underlying duplex, and possesses a CD spectrum that is entirely negative from 200 to 300 nm. Ethidium bromide undergoes a strong fluorescence enhancement upon binding to each of these triplexes, and significantly stabilizes the pur/pyr*pur · pyr triplex. The uv melting and differential scanning calorimetry analysis of the alternating sequence duplex and pur*pur · pyr triplex shows that they are lower in thermodynamic stability than the corresponding 10-mer d(G₃A₄G₃) · d(C₃T₄C₃) duplex and its pur*pur · pyr triplex under identical solution conditions. © 1997 John Wiley & Sons, Inc.     

Ionic microenvironmental effects on triplex DNA stabilization: Cationic counterion effects on poly(dT)·poly(dA)·poly(dT)

The structure and conformation of nucleic acids are influenced by metal ions, polyamines, and the microenvironment. In poly(purine) · poly(pyrimidine) sequences, triplex DNA formation is facilitated by metal ions, polyamines and other ligands. We studied the effects of mono- and di-valent metal ions, and ammonium salts on the stability of triple- and double-stranded structures formed from poly(dA) and poly(dT) by measuring their respective melting temperatures. In the presence of metal ions, the absorbance versus temperature profile showed two transitions: T_m1 for triplex to duplex and single stranded DNA, and T_m2 for duplex DNA melting to single stranded DNA. Monovalent cations (Li⁺, Na⁺, K⁺, Rb⁺, Cs⁺ and ₄NH⁺${{\text{NH}}_4}^{+}$) promoted triplex DNA at concentrations ≥150 mM. T_m1 varied from 49.8 °C in the presence of 150 mM Li⁺ to 30.6 °C in the presence of 150 mM K⁺. ₄NH⁺${{\text{NH}}_4}^{+}$ was very effective in stabilizing triplex DNA and its efficacy decreased with increasing substitution of the hydrogen atoms with methyl, ethyl, propyl and butyl groups. As in the case of monovalent cations, a concentration-dependent increase in T_m1 was observed with divalent ions and triplex DNA stabilization decreased in the order: Mg²⁺ > Ca²⁺ > Sr²⁺ > Ba²⁺. All positively charged cations increased the melting temperature of duplex DNA. Values of Δn (number of ions released) on triplex DNA melting were 0.46 ± 0.06 and 0.18 ± 0.02, respectively, for mono- and di-valent cations, as calculated from 1/T_m1 versus ln[M^+,2+] plots. The corresponding values for duplex DNA were 0.25 ± 0.02 and 0.12 ± 0.02, respectively, for mono- and di-valent cations. Circular dichroism spectroscopic studies showed distinct conformational changes in triplex DNA stabilized by alkali metal and ammonium ions. Our results might be useful in developing triplex forming oligonucleotide based gene silencing techniques.     

New aspects of the interaction of the antibiotic coralyne with RNA: coralyne induces triple helix formation in poly(rA)?poly(rU)

The interaction of coralyne with poly(A)•poly(U), poly(A)•2poly(U), poly(A) and poly(A)•poly(A) is analysed using spectrophotometric, spectrofluorometric, circular dichroism (CD), viscometric, stopped-flow and temperature-jump techniques. It is shown for the first time that coralyne induces disproportionation of poly(A)•poly(U) to triplex poly(A)•2poly(U) and single-stranded poly(A) under suitable values of the [dye]/[polymer] ratio (C_D/C_P). Kinetic, CD and spectrofluorometric experiments reveal that this process requires that coralyne (D) binds to duplex. The resulting complex (AUD) reacts with free duplex giving triplex (UAUD) and free poly(A); moreover, ligand exchange between duplex and triplex occurs. A reaction mechanism is proposed and the reaction parameters are evaluated. For C_D/C_P> 0.8 poly(A)•poly(U) does not disproportionate at 25°C and dye intercalation into AU to give AUD is the only observed process. Melting experiments as well show that coralyne induces the duplex disproportionation. Effects of temperature, ionic strength and ethanol content are investigated. One concludes that triplex formation requires coralyne be only partially intercalated into AUD. Under suitable concentration conditions, this feature favours the interaction of free AU with AUD to give the AUDAU intermediate which evolves into triplex UAUD and single-stranded poly(A). Duplex poly(A)•poly(A) undergoes aggregation as well, but only at much higher polymer concentrations compared to poly(A)•poly(U).     

Studies of DNA dumbbells. V. A DNA triplex formed between a 28 base-pair DNA dumbbell substrate and a 16 base linear single strand

CD spectra and melting curves were collected for a 28 base-pair DNA fragment in the form of a DNA dumbbell (linked on both ends by T₄ single-strand loops) and the same DNA sequence in the linear form (without end loops). The central 16 base pairs (bp) of the 28-bp duplex region is the poly(pu) sequence: 5′-AGGAAGGAGGAAAGAG-3′. Mixtures of the dumbbell and linear DNAs with the 16-base single-strand sequence 5′-TCCTTCCTCCTTTCTC-3′ were also prepared and studied. At 22°C, CD measurements of the mixtures in 950 mM NaCl, 10 mM sodium acetate, 1 mM EDTA, pH 5.5, at a duplex concentration of 1.8 μM, provided evidence for triplex formation. Spectroscopic features of the triplexes formed with either a dumbbell or linear substrate were quite similar. Melting curves of the duplex molecules alone and in mixtures with the third strand were collected as a function of duplex concentration from 0.16 to 2.15 μM. Melting curves of the dumbbell alone and mixtures with the third strand were entirely independent of DNA concentration. In contrast, melting curves of the linear duplex alone or mixed with the third strand were concentration dependent. At identical duplex concentrations, the dumbbell alone melts ～20°C higher than the linear duplex. The curve of the linear duplex displayed a significant pretransition probably due to end fraying. On melting curves of mixtures of the dumbbell or linear duplex with the third strand, a low temperature transition with much lower relative hyperchromicity change (～ 5%) was observed. This transition was attributed to the melting of a new molecular species, e.g., the triplex formed between the duplex and single-strand DNA molecules. In the case of the dumbbell/single-strand mixture, these melting transitions of the triplex and the dumbbell were entirely resolvable. In contrast, the melting transitions of the linear duplex and the triplex overlapped, thereby preventing their clear distinction. To analyze the data, a three-state equilibrium model is presented. The analysis utilizes differences in relative absorbance vs temperature curves of dumbbells (or linear molecules) alone and in mixtures with the third strand. From the model analysis a straightforward derivation of f_T(T), the fraction of triplex as a function of temperature, was obtained. Analysis of f_T vs temperature curves, in effect melting curves of the triplexes, provided evaluation of thermodynamic parameters of the melting transition. For the triplex formed with the dumbbell substrate, the total transition enthalpy is ΔH_T = 118.4 ± 12.8 kcal/mol (7.4 ± 0.8 kcal/mol per triplet unit) and the total transition entropy is ΔS_T = 344 ± 36.8 cal/K · mol (eu) (21.5 ± 2.3 eu per triple unit). The transition curves of the triplex formed with the linear duplex substrate displayed two distinct regions. A broad pretransition region from f_T = 0 to 0.55 and a higher, sharper transition above f_T = 0.55. The transition parameters derived from the lower temperature region of the curve are ΔH′_T = 44.8 ± 9.6 kcal/mol and ΔS′_T = 112 ± 33.6 eu (or ΔH′ = 2.8 ± 0.6 kcal/mol and ΔS′ = 7.0 ± 2.1 eu per triplet). These values are probably too small to correspond to actual melting of the triplex but instead likely reveal effects of end fraying of the duplex substrate on triplex stability. Transition parameters of the upper transition are ΔH′_T = 128.0 ± 2.3 kcal/mol and ΔS′_T = 379.2 ± 6.4 eu (ΔH′ = 8.0 ± 0.2 kcal/mol and ΔS′ = 23.7 ± 0.4 eu per triplet) in good agreement (within experimental error) with the transition parameters of the triplex formed with the dumbbell substrate. Supposing this upper transition reflects actual dissociation of the third strand from the linear duplex substrate this triplex is comparable in thermodynamic stability to the triplex formed with a dumbbell substrate. Even so, the biphasic melting character of the linear triplex obscures the whole analysis, casting doubt on its absolute reliability. Apparently triplexes formed with a dumbbell substrate offer technical advantages over triplexes formed from linear or hairpin duplex substrates for studies of DNA triplex stability. © 1993 John Wiley & Sons, Inc.     

Diverse modes of 5′‐[4‐(aminoiminomethyl)phenyl]‐[2,2′‐bifuran]‐5‐carboximidamide (DB832) interaction with multi‐stranded DNA structures

The modes of binding of 5′‐[4‐(aminoiminomethyl)phenyl]‐[2,2′‐Bifuran]‐5‐carboximidamide (DB832) to multi‐stranded DNAs: human telomere quadruplex, monomolecular R‐triplex, pyr/pur/pyr triplex consisting of 12 T*(T·A) triplets, and DNA double helical hairpin were studied. The optical adsorption of the ligand was used for monitoring the binding and for determination of the association constants and the numbers of binding sites. CD spectra of DB832 complexes with the oligonucleotides and the data on the energy transfer from DNA bases to the bound DB832 assisted in elucidating the binding modes. The affinity of DB832 to the studied multi‐stranded DNAs was found to be greater (K_ass ≈ 10⁷M^?1) than to the duplex DNA (K_ass ≈ 2 × 10⁵M^?1). A considerable stabilizing effect of DB832 binding on R‐triplex conformation was detected. The nature of the ligand tight binding differed for the studied multi‐stranded DNA depending on their specific conformational features: recombination‐type R‐triplex demonstrated the highest affinity for DB832 groove binding, while pyr/pur/pyr TTA triplex favored DB832 intercalation at the end stacking contacts and the human telomere quadruplex d[AG₃(T₂AG₃)₃] accommodated the ligand in a capping mode. Additionally, the pyr/pur/pyr TTA triplex and d[AG₃(T₂AG₃)₃] quadruplex bound DB832 into their grooves, though with a markedly lesser affinity. DB832 may be useful for discrimination of the multi‐sranded DNA conformations and for R‐triplex stabilization. © 2009 Wiley Periodicals, Inc. Biopolymers 93: 8–20, 2010. This article was originally published online as an accepted preprint. The “Published Online” date corresponds to the preprint version. You can request a copy of the preprint by emailing the Biopolymers editorial office at biopolymers@wiley.com     

Controlling nucleic acid secondary structure by intercalation: effects of DNA strand length on coralyne-driven duplex disproportionation

Small molecules that intercalate in DNA and RNA are powerful agents for controlling nucleic acid structural transitions. We recently demonstrated that coralyne, a small crescent-shaped molecule, can cause the complete and irreversible disproportionation of duplex poly(dA)·poly(dT) into triplex poly(dA)·poly(dT)·poly(dT) and a poly(dA) self- structure. Both DNA secondary structures that result from duplex disproportionation are stabilized by coralyne intercalation. In the present study, we show that the kinetics and thermodynamics of coralyne-driven duplex disproportionation strongly depend on oligonucleotide length. For example, disproportionation of duplex (dA)₁₆·(dT)₁₆ by coralyne reverts over the course of hours if the sample is maintained at 4°C. Coralyne-disproportioned (dA)₃₂· (dT)₃₂, on the other hand, only partially reverts to the duplex state over the course of days at the same temperature. Furthermore, the equilibrium state of a (dA)₁₆·(dT)₁₆ sample in the presence of coralyne at room temperature contains three different secondary structures [i.e. duplex, triplex and the (dA)₁₆ self-structure]. Even the well-studied process of triplex stabilization by coralyne binding is found to be a length-dependent phenomenon and more complicated than previously appreciated. Together these observations indicate that at least one secondary structure in our nucleic acid system [i.e. duplex, triplex or (dA)_n self-structure] binds coralyne in a length-dependent manner.     

The Parallel and Antiparallel Triplex Formation and Stability of Self Complementary Oligonucleotides Containing 2′-Fluoro-arabinosyl Thymine and 5-Methyl-2′-Deoxycytidine

Abstract

We examined the effects of 1–(2-deoxy -2-fluoro-β-D-arabinofuranosyl)-thymine (or FMAU, a potent antiviral nucleoside) on the stability of duplex and triplexes. When compared the stability of the self-complementary 5′-A₅T₅ duplex with 5′-A₅X₅ (X = FMAU), duplex containing FMAU has much higher melting temperature (T_m). 5′-A₆T₅T₃X₃T₅F₃X₃ and T₃X₃T₅A₆T₅F₃X₃ form the parallel and antiparallel triplexes T₃X₃: A₆:X₃X₃, respectively. The former exhibited the typical T:A:T triplex behavior with only one melting temperature at 70 °C and 45 °c in 1.0 M and 0.2 M NaCl solution, respectively, whereas the latter has two T_m values at 56 °C and 28 °C in 1.0 M solution. FMAU clearly stabilize the triplex structure as A₆T₂₂ which forms the parallel triplex T₆:A₆:T₆ has also only one T_m at 54 °C and 37 °C in high and iow salt concentration solutions, respectively. A 31mer 5′-TCCTCCTTTTTTAGGAGGATTTTTTGGTGGT and 5′-TCCTCCTTTTTTAGGAGGATTTTTTX'X'TX'X'T (X' = 2′-deoxy-5-methylcytidine) were prepared to study their triplex forming potential. The former was found to have a week interaction of the Watson-Crick duplex with the mismatched third-strand at all pH. The latter formed a stable triplex at lower pH consistent with required protonation on the 5-methylcytosine base. For these studies we developed a simple PC desktop spreadsheet program to calculate the first derivative profile of the melting curve data.

This paper is dedicated to Prof. Jacques H. van Boom on the occasion of his 60th birthday.     

Calorimetric and spectroscopic studies of aminoglycoside binding to AT-rich DNA triple helices

Calorimetric and fluorescence techniques were used to characterize the binding of aminoglycosides-neomycin, paromomycin, and ribostamycin, with 5′-dA₁₂-x-dT₁₂-x-dT₁₂-3′ intramolecular DNA triplex (x = hexaethylene glycol) and poly(dA)·2poly(dT) triplex. Our results demonstrate the following features: (1) UV thermal analysis reveals that the T_m for triplex decreases with increasing pH value in the presence of neomycin, while the T_m for the duplex remains unchanged. (2) The binding affinity of neomycin decreases with increased pH, although there is an increase in observed binding enthalpy. (3) ITC studies conducted in two buffers (sodium cacodylate and MOPS) yield the number of protonated drug amino groups (Δn) as 0.29 and 0.40 for neomycin and paromomycin interaction with 5′-dA₁₂-x-dT₁₂-x-dT₁₂-3′, respectively. (4) The specific heat capacity change (ΔC_p) determined by ITC studies is negative, with more negative values at lower salt concentrations. From 100 mM to 250 mM KCl, the ΔC_p ranges from −402 to −60 cal/(mol K) for neomycin. At pH 5.5, a more positive ΔC_p is observed, with a value of −98 cal/(mol K) at 100 mM KCl. ΔC_p is not significantly affected by ionic strength. (5) Salt dependence studies reveal that there are at least three amino groups of neomycin participating in the electrostatic interactions with the triplex. (6) FID studies using thiazole orange were used to derive the AC₅₀ (aminoglycoside concentration needed to displace 50% of the dye from the triplex) values. Neomycin shows a seven fold higher affinity than paromomycin and eleven fold higher affinity than ribostamycin at pH 6.8. (7) Modeling studies, consistent with UV and ITC results, show the importance of an additional positive charge in triplex recognition by neomycin. The modeling and thermodynamic studies indicate that neomycin binding to the DNA triplex depends upon significant contributions from charge as well as shape complementarity of the drug to the DNA triplex Watson–Hoogsteen groove.     

Studies of DNA dumbbells. IV. Preparation and melting of a DNA dumbbell with the 16 base-pair sequence 5′G-T-A-T-C-C-C-T-C-T-G-G-A-T-A-C3′ linked on the ends by dodecyl chains

The preparation and melting of a 16 base-pair duplex DNA linked on both ends by C¹²H²⁴ (dodecyl) chains is described. Absorbance vs temperature curves (optical melting curves) were measured for the dodecyl-linked molecule and the same duplex molecule linked on the ends instead by T₄ loops. Optical melting curves of both molecules were measured in 25, 55, and 85 mM Na⁺ and revealed, regardless of [Na ⁺], the duplex linked by dodecyl loops is more stable by at least 6°C than the same duplex linked by T₄ loops. Experimental curves in each salt environment were analyzed in terms of the two-state and multistate theoretical models. In the two-state, or van't Hoff analysis, the melting transition is assumed to occur in an all-or-none manner. Thus, the only possible states accessible to the molecule throughout the melting transition are the completely intact duplex and the completely melted duplex or minicircle. In the multistate analysis no assumptions regarding the melting transition are required and the statistical occurrence of every possible partially melted state of the duplex is explicitly considered. Results of the analysis revealed the melting transitions of both the dodecyl-linked molecule and the dumbbell with T₄ end loops are essentially two state in 25 and 55 mM Na⁺. In contrast, significant deviations from two-state behavior were observed in 85 m MNa⁺. From our previously published melting data of DNA dumbbells with T_n end loops where n = 2, 3, 4, 6, 8, 10, 14 [T. M. Paner, M. Amaratunga, and A. S. Benight, (1992) Biopolymers, Vol. 32, pp. 881–892] and the dumbbell with T₄ end loops of this study, a plot of d(T_m)/d ln [Na⁺] was constructed. Extrapolation of this data to n = 1 intersects with the value of d (T_m)/d ln [Na⁺] obtained for the alkyl-linked dumbbell, suggesting the salt-dependent stability of the alkyl-linked molecule behaves as though the duplex of this molecule were linked by end loops comprised of a single T residue. © 1993 John Wiley & Sons, Inc.     

Novel Hoogsteen-like Bases for Recognition of the C-G Base Pair by DNA Triplex Formation

Effective sequence-specific recognition of duplex DNA is possible by triplex formation with natural oligonucleotides via Hoogsteen H-bonding. However, triplex formation is in practice limited to pyrimidine oligonucleotides that bind duplex A-T or G-C base pair DNA sequences specifically at homopurine sites in the major groove as T·A-T and C⁺ ·G-C triplets. Here we report the successful modelling of novel unnatural nucleosides that recognize the C-G DNA base pair by Hoogsteen-like major groove interaction. These novel Hoogsteen nucleotides are examined within model A-type and B-type conformation triplex structures since the DNA triplex can be considered to incorporate A-type and/or B-type configurational properties. Using the same deoxyribose-phosphodiester and base-deoxyribose dihedral angle configuration, a triplet comprised of a C-G base pair and the novel Hoogsteen nucleotide, Y2, replaces the central T·A-T triplet in the triplex. The presence of any structural or energetic perturbations due to the central triplet in the energy-minimized triplex is assessed with respect to the unmodified energy minimized (T·A-T)₁₁ starting structures. Incorporation of this novel triplet into both A-type and B-type natural triplex structures provokes minimal change in the configuration of the central and adjacent triplets.     

Binding of novel 9-O–N-aryl/arylalkyl amino carbonyl methyl berberine analogs to poly(U)-poly(A)·poly(U) triplex and comparison to the duplex poly(A)-poly(U)

Interaction of the 9-O–N-aryl/arylalkyl amino carbonyl methyl substituted analogs of the anticancer isoquinoline alkaloid berberine with RNA triplex, poly(U)-poly(A)·poly(U) has been studied in comparison to the duplex poly(A)-poly(U), using multiple biophysical techniques. Spectrophotometric and spectrofluorimetric studies established the non-cooperative binding mode of all the analogs with both the duplex and the triplex. However, berberine exhibited cooperative binding with poly(A)-poly(U) and non-cooperative binding with poly(U)-poly(A)·poly(U). Analog BER1 showed the highest affinity to both the duplex and the triplex followed by BER2 and BER3. The overall binding affinity varied as BER1 > BER2 > BER3 > BER. The magnitude of the quantum efficiency values (Q > 1) revealed that energy was transferred from the bases of the triplex and the duplex to the analogs. Comparative ferrocyanide quenching and viscosity studies unambiguously established a stronger intercalative geometry of the analogs to both the triplex and the duplex in comparison to berberine. Circular dichroism studies revealed that the alkaloids perturbed the conformation of both RNA helices. The binding of all the alkaloids was found to be exothermic from isothermal titration studies. Binding of the analogs was highly entropy driven while that of berberine was enthalpy dominated. The results presented here reveal strong and specific binding of these new berberine analogs to the RNA triplex and duplex and highlight the remarkable influence of the 9-substitution on the interaction profile.     

The formation pathway of i-motif tetramers

The i-motif is a four-stranded structure formed by two intercalated parallel duplexes containing hemiprotonated C•C⁺ pairs. In order to describe the sequence of reactions by which four C-rich strands associate, we measured the formation and dissociation rates of three [TC_n]₄ tetramers (n = 3, 4 and 5), their dissociation constant and the reaction order for tetramer formation by NMR. We find that TC_n association results in the formation of several tetramers differing by the number of intercalated C•C⁺ pairs. The formation rates of the fully and partially intercalated species are comparable but their lifetimes increase strongly with the number of intercalated C•C⁺ pairs, and for this reason the single tetramer detected at equilibrium is that with optimal intercalation. The tetramer half formation times vary as the power −2 of the oligonucleotide concentration indicating that the reaction order for i-motif formation is 3. This observation is inconsistent with a model supposing association of two preformed duplex and suggests that quadruplex formation proceeds via sequential strand association into duplex and triplex intermediate species and that triplex formation is rate limiting.     

Variable chain conformations of renatured β‐glucan in dimethylsulfoxide/water mixture

We have firstly demonstrated the renaturation process of dissociated single chains of lentinan (s‐LNT) and the variable conformations of the renatured LNT (r‐LNT). The results from ultrasensitive differential scanning calorimetry and circular dichroism revealed that the variable structures including perfect triple helix, defective triple helix containing duplex segment, and single chains occurred in the renaturation of s‐LNT, depending on the renaturation time, solvent composition, molecular weight, and the mode of renaturation. When water was added into s‐LNT/dimethylsulfoxide (DMSO) to reach 95% (v/v), the classic low‐temperature intra‐triple‐helical conformational transition at ～10^°C (T₁) appeared within 4 h, indicative of a rapid reconstruction of triple helical structure. Besides, one newly endothermic peak at ～43^°C (T₂) simultaneously occurred, which was first ascribed to the melting of duplex segment in the imperfect triplex. The duplex stretches disappeared when DMSO reached 50%, in which single chains coexisted with triplex. Moreover, the duplex segment disappeared by slowly dropping water into s‐LNT/DMSO. This work suggested that the structure of r‐LNT could be controllable, and provided important information for their successful development and application in polymer and life science. © 2012 Wiley Periodicals, Inc. Biopolymers 97:988–997, 2012.     

Binding properties of Ru(II) polypyridyl complexes with poly(U)·poly(A)*poly(U) triplex: the ancillary ligand effect on third-strand stabilization

The binding properties of [RuL₂(mip)]²⁺ {where L is 1,10-phenanthroline (phen) or 4,7-dimethyl-1,10-phenanthrollne (4,7-dmp) and mip is 2′-(3″,4″-methylenedioxyphenyl)imidazo[4′,5′-f][1,10]phenanthroline} with regard to the triplex RNA poly(U)·poly(A)*poly(U) were investigated using various biophysical techniques and quantum chemistry calculations. In comparison with [Ru(4,7-dmp)₂(mip)]²⁺, remarkably higher binding affinity of [Ru(phen)₂(mip)]²⁺ for the triplex RNA poly(U)·poly(A)*poly(U) was achieved by changing the ancillary ligands. The stabilization of the Hoogsteen-base-paired third strand was improved by about 10.9 °C by [Ru(phen)₂(mip)]²⁺ against 6.6 °C by [Ru(4,7-dmp)₂(mip)]²⁺. To the best of our knowledge, [Ru(phen)₂(mip)]²⁺ is the first metal complex able to raise the third-strand stabilization of poly(U)·poly(A)*poly(U) from 37.5 to 48.4 °C. The results reveal that the ancillary ligands have an important effect on third-strand stabilization of the triplex RNA poly(U)·poly(A)*poly(U) when metal complexes contain the same intercalative ligands.     

DNA structural features responsible for sequence-dependent binding geometries of Hoechst 33258

The complexes of Hoechst 33258 with poly[d(A-T)₂], poly[d(I-C)₂], poly[d(G-C)₂], and poly[d(G-m⁵C)₂] were studied using linear dichroism, CD, and fluorescence spectroscopies. The Hoechst-poly[d(I-C)₂] complex, in which there is no guanine amino group protruding in the minor groove, exhibits spectroscopic properties that are very similar to those of the Hoechst-poly[d(A-T)₂] complex. When bound to both of these polynucleotides, Hoechst exhibits an average orientation angle of near 45° relative to the DNA helix axis for the long-axis polarized low-energy transition, a relatively strong positive induced CD, and a strong increase in fluorescence intensity—leading us to conclude that this molecule also binds in the minor groove of poly[d(I-C)₂]. By contrast, when bound to poly[d(G-C)₂] and poly[d(G-m⁵C)₂], Hoechst shows a distinctively different behavior. The strongly negative reduced linear dichroism in the ligand absorption region is consistent with a model in which part of the Hoechst chromophore is intercalculated between DNA bases. From the low drug:base ratio onset of excitonic effects in the CD and fluorescence emission spectra, it is inferred that another part of the Hoechst molecule may sit in the major groove of poly[d(G-C)₂] and poly[d(G-m⁵C)₂] and preferentially stacks into dimers, though this tendency is strongly reduced for the latter polynucleotide. Based on these results, the importance of the interactions of Hoechst with the exocyclic amino group of guanine and the methyl group of cytosine in determining the binding modes are discussed. © 1996 John Wiley & Sons, Inc.     

Investigation of DNA Binding Modes for a Symmetrical Cyanine Dye Trication: Effect of DNA Sequence and Structure

Abstract

The DNA binding behavior of a tricationic cyanine dye (DiSC₃₊(5)) was studied using the [Poly(dA-dT)]₂, [Poly(dI-dC)]₂ and Poly(dA)?Poly(dT) duplex sequences and the Poly(dA) ?2Poly(dT) triplex. Optical spectroscopy and viscometry results indicate that the dye binds to the triplex structure by intercalation, to the nonalternating Poly(dA)?Poly(dT) duplex through minor groove binding and to the alternating [Poly(dA-dT)]₂ duplex by a combination of two binding modes: intercalation at low concentration and dimerization within the minor groove at higher concentration. Dimerization occurs at lower dye concentrations for the [Poly(dI-dC)]₂ sequence, consistent with our previous investigations on an analogous monocationic cyanine dye. [Seifert, J.L., et al. (1999) J. Am. Chem. Soc. 121, 2987–2995] These studies illustrate the diversity of DNA binding modes that are available to a given ligand structure.     

Protoberberine Alkaloids Berberine,Palmatine, and Coralyne Binding to Poly(dT)⋅(Poly(dA)⋅Poly(dT)) Triplex: Comparative Structural Aspects and Energetics Profiles of the Interaction

The interaction of bioactive protoberberine alkaloids berberine, palmatine, and coralyne with the DNA triplex poly(dT)⋅(poly(dA)⋅poly(dT)) was studied using biophysical and calorimetric techniques. All three alkaloids bound the triplex cooperatively. Berberine and palmatine predominantly stabilized the triplex structure, while coralyne stabilized both triplex and duplex structures as inferred from optical thermal melting profiles. Fluorescence quenching, polarization, and viscometric studies hinted at an intercalative mode of binding for the alkaloids to the triplex, coralyne being more strongly intercalated compared to partial intercalation of berberine and palmatine. The overall affinity of coralyne was two order higher (2.29×10⁷ M ⁻¹) than that of berberine (3.43×10⁵ M ⁻¹) and palmatine (2.34×10⁵ M ⁻¹). Isothermal titration calorimetric studies revealed that the binding to the triplex was favored by negative enthalpy change (ΔH=−3.34 kcal/mol) with favorable entropy contribution (TΔS = 4.07 kcal/mol) for berberine, favored by almost equal negative enthalpy (ΔH =−3.88 kcal/mol) and entropy changes (TΔS = 3.37 kcal/mol) for palmatine, but driven by large enthalpy contributions (ΔH =−25.62 kcal/mol and TΔS =−15.21 kcal/mol) for coralyne. These results provide new insights on the binding of isoquinoline alkaloids to the DNA triplex structure.     

Different Effects of Nonintercalative Antitumor Drugs on DNA Triple Helix Stability: SN-18071 Promotes Triple Helix Formation

Abstract

The interaction of the nonintercalating bisquaternary ammonium heterocyclic drugs SN- 18071 and SN-6999 with a DNA triple helix has been studied using thermal denaturation and CD spectroscopy. Our data show, that both minor groove binders can bind to the triple helix of poly(dA)-2poly(dT) under comparable ionic conditions, but they influence the stability of the triplex relative to the duplex structure of poly(dA)-poly(dT) in a different manner. SN- 18071, a ligand devoid of forming hydrogen bonds, can promote triplex formation and thermally stabilizes it up to 500 mM Na+ concentration. SN-6999 destabilizes the triplex to duplex equibilirium whereas it stabilizes the duplex. The binding constant of SN-18071 is found to be greater than that to the duplex. The stabilizing effect of SN-18071 is explained by electrostatic inetractions of three ligand molecules with the three grooves of the triple stranded structure. From the experiments it is concluded that SN-6999 binds to the triplex minor groove thereby destabilizing the triplex similar as previously reported for netropsin.     

A Practical Synthesis of N1-Methyl-2′-deoxy-ψ-uridine (ψ-Thymidine) and Its Incorporation into G-Rich Triple Helix Forming Oligonucleotides

Abstract

A convenient synthesis of N1-methyl-2′-deoxy-ψ-uridine (ψ-thymidine, ψT, 7a) has been accomplished in good yield. The structural conformation of 7a was derived by 2D NMR and 1D NOE experiments. The nucleoside 7a has been incorporated into G-rich triplex forming oligonucleotides (TFOs) by solid-support, phosphoramidite method. The triplex forming capabilities of the modified TFOs (S4, S5 and S6) containing ψT has been evaluated in antiparallel motif with a target duplex (duplex-31) 5′d(CTGAGACCGGGAAGGAGGAAGGGCCAGTGAC)3′-5′d(GACTCTGGCCCTTCCTCCTTCCCGGTCACTG)3′(D1) at pH 7.6. The triplex formation of modified homopyrimidine-oligomers (S1, S2 and S3) has also been studied in parallel motif with a duplex-10 (A₁₀:T₁₀) at pH 7.0.     

Binding geometries of triple helix selective benzopyrido [4,3-b]indole ligands complexed with double- and triple-helical polynucleotides

The binding modes of three benzopyrido [4,3-b]indole derivatives (and one benzo[-f]pyrido [4-3b] quinoxaline derivative) with respect to double helical poly(dA) · poly(dT) and poly[d(A-T)]₂ and triple-helical poly(dA) · 2poly(dT) have been investigated using linear dichroism (LD) and CD: (I) 3-methoxy-11-amino-BePI where BePI = (7H-8-methyl-benzo[e]pyrido [4,3-b]indole), (II) 3-methoxy-11-[(3′-amino) propylamino]-BePI, (III) 3-methoxy-7-[(3′-diethylamino)propylamino] BgPI where BgPI = (benzo[g]pyrido[4,3-b]indole), and (IV) 3-methoxy-11-[(3′-amino)propylamino] B f P Q where B f P Q = {benzo[-f]pyrido[4-3b]quinoxaline}. The magnitudes of the reduced LD of the electronic transitions of the polynucleotide bases and of the bound ligands are generally very similar, suggesting an orientation of the plane of the ligands' fused-ring systems preferentially perpendicular to the helix axis. The LD results suggest that all of the ligands are intercalated for all three polynucleotides. The induced CD spectrum of the BePI chromophore in the (II-BePI)-poly[d(A-T)]₂ complex is almost a mirror image of that for the (I-BePI)-poly(dA) · poly(dT) and (I-BePI)-poly(dA) · 2poly(dT) complexes, suggesting an antisymmetric orientation of the BePI moiety upon intercalation in poly[d(A-T)]₂ compared to the other polynucleotides. The induced CD of I-BePI bound to poly(dA) · 2poly(dT) suggests a geometry that is intermediate between that of its other two complexes. The concluded intercalative binding as well as the conformational variations between the different BePI complexes are of interest in relation to the fact that BePI derivatives are triplex stabilizers. © 1997 John Wiley & Sons, Inc. Biopoly 42: 101–111, 1997