Tumorigenic poxviruses: construction of the composite physical map of the Shope fibroma virus genome.

The sites for the restriction enzymes BamHI, Bg/I, HindIII, PstI, PvuII, and SstI on the linear DNA genome of Shope fibroma virus, a tumorigenic poxvirus of rabbits, have been determined by digestions of the cloned BamHI and HindIII restriction fragments and by hybridization of 32P-labeled cloned fragments to Southern blots of Shope fibroma virus DNA cleaved partially or completely with the various enzymes. The linear genome is shown to be 160 kilobases in length and to possess terminal inverted repeat sequences of between 12.2 and 12.5 kilobases extending inwards from the cross-linked DNA telomeres. The fine map of the Shope fibroma virus terminal inverted repeats has been constructed and shown to be distinctly different from that of members of the orthopoxvirus group, such as vaccinia, by the absence of detectable tandemly repeated sequences near the termini and by the lack of detectable sequence homology with vaccinia termini.     

Sequence homologies of diverse length tandem repetitions near ends of vaccinia virus genome suggest unequal crossing over.

The 180,000 base pair (bp), covalently closed, linear duplex DNA genome of vaccinia virus contains a 10,000 bp inverted terminal repetition within which are one set of 13 and one set of 18 tandem 70 bp repeating units. A 967 bp segment containing the innermost 70 bp repeat and an adjacent region notable for a scarcity of restriction endonuclease sites has been sequenced. This was facilitated by the cloning of TaqI and partial TaqI fragments in pBR322. We found that the innermost 70 bp repeat overlaps one of two adjacent 125 bp repeats, following which are eight repeats of 54 bp, parts of 54 bp and 70 bp repeats, and four consecutive 6 to 7 bp repeats. The 70, 125, and 54 bp repeating units have extensive sequence homologies and redundancies that suggest evolution by unequal crossing over. Schemes whereby unequal crossovers of 54 bp repeats lead to a recombinant segment 86% homologous to the 125 bp repeat and unequal crossovers of 125 bp repeats lead to a recombinant segment 94% homologous to the 70 bp repeat were considered. This propensity for sequence divergence should provide a useful marker for comparing the relatedness of poxviruses.     

Nucleotide sequence required for resolution of the concatemer junction of vaccinia virus DNA.

The mature form of the vaccinia virus genome consists of a linear, 185,000-base-pair (bp) DNA molecule with a 10,000-bp inverted terminal repetition and incompletely base-paired 104-nucleotide hairpin loops connecting the two strands at each end. In concatemeric forms of intracellular vaccinia virus DNA, the inverted terminal repetitions of adjacent genomes form an imperfect palindrome. The apex of this palindrome corresponds in sequence to the double-stranded form of the hairpin loop. Circular plasmids containing palindromic concatemer junction fragments of 250 bp or longer are converted into linear minichromosomes with hairpin ends when they are transfected into vaccinia virus-infected cells, providing a model system with which to study the resolution process. To distinguish between sequence-specific and structural requirements for resolution, plasmids with symmetrical insertions, deletions, and oligonucleotide-directed mutations within the concatemer junction were constructed. A sequence (ATTTAGTGTCTAGAAAAAAA) located on both sides of the apex segment was found to be critical for resolution. Resolution was more efficient when additional nucleotides, TGTG, followed the run of A residues. Both the location and sequence of the proposed resolution signal are highly conserved among poxviruses.     

Molecular cloning of the terminal hairpin of vaccinia virus DNA as an imperfect palindrome in an Escherichia coli plasmid

The genome of vaccinia virus is a linear duplex molecule of approximately 185 kb with hairpins at each end that link the complementary strands. The hairpins, which exist in two forms that are inverted and complementary in sequence, were isolated as XbaI restriction fragments and converted to a linear intermolecular duplex structure by denaturation and reannealing. The latter was then stably cloned as a 142-bp imperfect palindrome in an Escherichia coli plasmid. The insert was excised from the plasmid and the palindrome was extended on both sides by ligating it to the adjacent vaccinia virus DNA segment. The resulting fragment was cloned as a 278-bp imperfect palindrome. Restriction endonuclease analysis and DNA sequencing indicated the absence of any deletions or rearrangements. After excision from the plasmid, the palindrome was converted by heating and rapid cooling to the original two hairpin forms. In this manner, large quantities of vaccinia virus telomeres may be obtained for physical and biochemical studies.     

Hybridization selection and cell-free translation of mRNA''s encoded within the inverted terminal repetition of the vaccinia virus genome

Early polypeptides encoded within the 10,000-base pair terminally repeated region of the vaccinia virus genome were mapped by cell-free translation of mRNA that was selected by hybridization to restriction fragments and to separated strands of a recombinant lambda phage. The results, which were confirmed by hybrid arrest of translation, indicated that polypeptides of 7,500 (7.5K), 19,000 (19K), and 42,000 (42K) daltons mapped at approximately 3.2 to 4.3, 6.5 to 7.2, and 7.2 to 8.3 kilobase pairs from the end of the genome, respectively. mRNA's for the 42K and 7.5K polypeptides were transcribed towards the end of the genome, whereas mRNA for the 19K polypeptide was transcribed in the opposite direction. Including polyadenylic acid tails, the lengths of the mRNA's for the 7.5K, 19K, and 42K polypeptides, determined by gel electrophoresis of denatured RNA, hybridization selection, and cell-free translation, were approximately 1,200, 680, and 1,280 nucleotides, respectively. mRNA's for the 42K and 19K polypeptides were only about 100 nucleotides longer than the minimums required to code for their respective polypeptides, whereas mRNA for the 7.5K polypeptide contained 900 nucleotides of untranslated sequence. This long untranslated portion of the latter mRNA was probably located near the 3' end, because this gene was only inactivated by high doses of UV irradiation. This small target size also excluded certain models for RNA processing involving formation of the mRNA's for the 42K and 7.5K polypeptides from a common promoter. Rabbitpox virus, which has an inverted terminal repetition approximately half that of vaccinia virus, was also shown to encode mRNA's that hybridized to the cloned terminal segment of vaccinia virus DNA.     

Inverted terminal repeats in rabbit poxvirus and vaccinia virus DNA.

In both rabbit poxvirus and vaccinia virus DNA have demonstrated an identical distribution of eight HinfI. The length of the terminal repeats was found to be 3.4 to 3.6 megadaltons (Mdaltons) for rabbit poxvirus DNA and 7.4 to 8.0 Mdaltons for vaccinia virus DNA. Maps of the HinfI restriction sites within isolated EcoRI end fragments of rabbit poxvirus and vaccinia virus DNA PHAVE DEMONSTRATED AN IDENTICAL DISTRIBUTION OF EIGHT HinfI sites in an internal part (approximately 2 Mdaltons) of the EcoRI end fragments of the two genomes.     

Molecular analysis of a novel tandemly organized repetitive DNA sequence in<Emphasis Type="Italic">Citrus limon</Emphasis> (L.) Burm

Repetitive sequences constitute a significant component of most eukaryotic genomes, and the isolation and characterization of repetitive DNA sequences provide an insight into the organization of the genome of interest. Here, we report the isolation and molecular analysis of a novel tandemly organized repetitive DNA sequence from the genome of Citrus limon. Digestion of C. limon DNA with Hinf I produced a prominent fragment of approximately 300 bp. Southern blotting revealed a ladder composed of DNA fragments that were multimers of the 300-bp Hinf I band. Thus, Hinf I digestion revealed a novel satellite, which we have called the C. limon satellite DNA 300 (CL300). Sequence analysis shows significant homology between a portion of the CL300 monomer and the transposase box of an En/Spm-like element. The CL300 satellite was also detected in grapefruit, sour orange, trifoliate orange and kumquat. These results suggest that the CL300 repeat is an ancient satellite, and we propose that a significant portion originated by amplification of a genomic region containing the En/Spm-like transposase element.     

Genomic organization of telomeric and subtelomeric sequences of Leishmania (Leishmania) amazonensis

Telomeres are DNA-protein complexes that protect linear chromosomes from degradation and fusions. Telomeric DNA is repetitive and G-rich, and protrudes towards the end of the chromosomes as 3'G-overhangs. In Leishmania spp., sequences adjacent to telomeres comprise the Leishmania conserved telomere associated sequences (LCTAS) that are around 100 bp long and contain two conserved sequence elements (CSB1 and CSB2), in addition to non-conserved sequences. The aim of this work was to study the genomic organization of Leishmania (Leishmania) amazonensis telomeric/subtelomeric sequences. Leishmania amazonensis chromosomes were separated in a single Pulsed Field Gel Electrophoresis (PFGE) gel as 25 ethidium bromide-stained bands. All of the bands hybridized with the telomeric probe (5'-TTAGGG-3')3 and with probes generated from the conserved subtelomeric elements (CSB1, CSB2). Terminal restriction fragments (TRF) of L. amazonensis chromosomes were analyzed by hybridizing restriction digested genomic DNA and chromosomal DNA separated in 2D-PFGE with the telomeric probe. The L. amazonensis TRF was estimated to be approximately 3.3 kb long and the telomeres were polymorphic and ranged in size from 0.2 to 1.0 kb. Afa I restriction sites within the conserved CSB1 elements released the telomeres from the rest of the chromosome. Bal 31-sensitive analysis confirmed the presence of terminal Afa I restriction sites and served to differentiate telomeric fragments from interstitial internal sequences. The size of the L. amazonensis 3' G-overhang was estimated by non-denaturing Southern blotting to be approximately 12 nt long. Using similar approaches, the subtelomeric domains CSB1 and CSB2 were found to be present in a low copy number compared to telomeres and were organized in blocks of 0.3-1.5 kb flanked by Hinf I and Hae III restriction sites. A model for the organization of L. amazonensis chromosomal ends is provided.     

Construction of fowlpox virus vectors with intergenic insertions: expression of the beta-galactosidase gene and the measles virus fusion gene.

A DNA fragment from fowlpox virus cloned on a plasmid vector was modified to contain foreign DNA inserts within an intergenic region. In a first step, a 32-base-pair intergenic region from the fowlpox virus genome corresponding to the position of the thymidine kinase locus in the vaccinia virus genome was enlarged to 55 base pairs by site-directed mutagenesis. A unique restriction endonuclease site introduced upstream of the intergenic region was then used to insert various foreign DNA fragments. The lacZ gene encoding beta-galactosidase and the measles virus gene encoding the fusion protein were positioned downstream of two vaccinia virus p7.5 promoter elements in either a direct repeat or inverted repeat orientation. Foreign DNA inserts contained within the fowlpox virus sequence were transferred to the viral genome by homologous recombination occurring in cells infected with a fowlpox virus temperature-sensitive mutant and transfected with both wild-type viral DNA and plasmid DNA. Recombinant viruses were selected for the expression of beta-galactosidase activity by screening for blue plaques in the presence of a chromogenic substrate. Stable recombinants expressing both the lacZ gene and the unselected measles gene were obtained when the p7.5 promoter was present as an inverted repeat. However, when the p7.5 promoter was in the direct repeat orientation, viral recombinants which initially expressed both gene inserts readily deleted the lacZ gene flanked by the promoter repeat. The methods described enable precise insertion and deletion of foreign genes in the fowlpox virus genome and could be applied to other intergenic regions of the same virus as well as other poxviruses.     

A polymerase chain reaction based method for the detection of Culex quinquefasciatus (Diptera: culicidae)

Culex quinquefasciatus Say is the major vector of the filarial parasite Wuchereria bancrofti (Cobbold) which causes lymphatic filariasis in humans. A repetitive DNA sequence from the genome of C. quinquefasciatus has been cloned and completely sequenced. The 693 bp cloned fragment had an A+T content of 72%. Dot matrix analysis of the fragment did not reveal any direct or inverted repeats within it. Southern blot analysis using a variety of restriction enzymes appeared to indicate that the cloned fragment was interspersed within the genome with a copy number of approximately 30,000. A search of the GenBank database did not reveal significant homologies to any previously cloned sequences. Although the probe was sensitive enough to detect picogram quantities of DNA, it was not specific for C. quinquefasciatus, as it hybridized with DNA from other mosquito species, Culex pseudovishnui Colless, Culex gelidus Theobald, Culex tritaeniorhynchus Giles, Anopheles vagus D?nitz and Mansonia uniformis (Theobald). However PCR primers derived from the cloned sequence, IpC, were found to be specific and amplified only C. quinquefasciatus DNA. The optimized PCR assay was found to be very sensitive and was capable of detecting DNA from all stages of C. quinquefasciatus thus making it an ideal diagnostic tool.     

A cowpox virus gene required for multiplication in Chinese hamster ovary cells.

Cowpox virus, in contrast to vaccinia virus, can multiply in Chinese hamster ovary cells. To study the genetic basis for this difference in host range, recombinants between vaccinia and cowpox viruses were isolated and their DNA restriction patterns were examined. The ability to multiply in Chinese hamster ovary cells could be correlated with the conservation of cowpox virus sequences mapping at the left end of the genome. This was further demonstrated by marker rescue of the host range phenotype with restricted cowpox virus DNA. Marker rescue with cloned restriction fragments of decreasing size enabled the fine localization of the host range function to a 2.3-kilobase-pair fragment. Nucleotide sequencing revealed that the fragment encoded a single major polypeptide of approximately 77,000 daltons. It is suggested that the role of the host range gene from cowpox virus is to prevent the early and extensive shutoff of protein synthesis that normally occurs in Chinese hamster ovary cells infected by vaccinia virus.     

Incompletely base-paired flip-flop terminal loops link the two DNA strands of the vaccinia virus genome into one uninterrupted polynucleotide chain

The nature of the ends of the vaccinia virus genome was determined by nucleotide sequencing. Our finding of terminal hairpins indicated that the linear double-stranded DNA molecule consists of a single continuous polynucleotide chain. The 104 nucleotide apex of the hairpin contains predominantly A and T residues and is incompletely base-paired. These loops exist in two forms, which when inverted with respect to each other are complementary in sequence. Both forms of the 104 nucleotide loop are present in nearly equimolar amounts at each end of the genome. A set of 13 tandem 70 bp repeats begins 87 bp from the proximal segment of the terminal loop, followed by a unique sequence of 325 bp, and then by a second set of 18 tandem 70 bp repeats. The sequence of the 70 bp repeats reveals a 13 bp internal redundancy. Self-priming and de novo start replication models, which involve a site-specific nick in one DNA strand proximal to the 104 nucleotide loop, account for the observed sequence inversions and incomplete base-pairing. Similar mechanisms may be involved in replication of the ends of the eucaryotic chromosome.     

Long interspersed repeated sequences of the mouse genome

Long interspersed repeated sequences of the mouse genome can be prepared by digesting reassociated DNA with single-strand nuclease. Length resolution reveals many discrete bands that can be assigned to 15 kbp and 6 kbp groups. The reassociated 6 kbp group (which we identify with the MIF-1 family) possesses significant sequence heterogeneity, evidenced by the production of several smaller fragments upon single-strand nuclease digestion of heteroduplexes. The sites of sequence heterogeneity are relatively few and can be mapped using additional restriction endonuclease cuts. We have mapped additional restriction sites into this group, particularly within a cloned HindIII 400 bp fragment, and have also clearly mapped one end of this relatively homogeneous long interspersed repeated sequence.     

Structure of the joint region and the termini of the DNA of herpes simplex virus type 1.

Analysis of restriction endonuclease cleavage sites within the inverted, repeated sequences in the joint region of the DNA of herpes simplex virus type 1 strain KOS revealed the presence of two types of sequence heterogeneity. The first was an insertion of 280 base pairs or multiples of 280 base pairs which was found in approximately half of all DNA molecules from every plaque-purified stock of virus. These insertions seemed to be tandem duplications of sequences which were present at the joint and correspond closely to the inverted terminal redunancy. The second type of heterogeneity was due to variable insertions and deletions which were present in some, but not all, plaque-purified virus stocks. Comparison of restriction fragments from the joint region with fragments from the termini indicated that in the simplest observed molecules of herpes simplex virus type 1 DNA, only one copy of the inverted terminal redundancy was present at the joint. A map of restriction endonuclease cleavage sites in the joint region is presented.     

Structure and properties of a highly repetitive DNA sequence in sheep

Cleavage of sheep DNA with the restriction endonuclease EcoR I yields three discrete size classes (370, 435 and 800bp) of highly repetitive DNA. The 435bp long fragment was cloned and its nucleotide sequence determined. All three classes of repetitive DNA are related to each other as seen by cross-hybridisation. They are tandemly arranged in the genome and in situ hybridisation to sheep lymphocyte chromosomes show their location mainly in the centromere region of all chromosomes. The primary sequence of the repetitive DNA shows a close structural similarity to the bovine 1.715 satellite DNA, however only poor cross-hybridisation between the sheep and cattle repetitive DNA could be shown.     

Restriction endonuclease cleavage of satellite DNA in intact bovine nuclei

We have analyzed the efficiency with which specific nucleotide sequences within nucleosomes are recognized and cleaved by DNA restriction endonucleases. A system amenable to this sort of analysis is the cleavage of the bovine genome with the restriction endonuclease EcoRI. Bovine satellite I comprises 7% of the genome and is tandemly repetitious with an EcoRI site at 1400 base pair (bp) intervals within this sequence. The ease with which this restriction fragment can be measured permits an analysis of the accessibility of this sequence when organized in a nucleosomal array.Initial studies indicated that satellite I sequences are organized in a nucleosomal structure in a manner analogous to that observed for total genomic DNA. We then examined the accessibility of the EcoRI cleavage sites in satellite to endonucleolytic cleavage in intact nuclei. We find that whereas virtually all the satellite I sequences from naked DNA are cleaved into discrete 1400 bp fragments, only 33% of the satellite I DNA is liberated as this fragment from intact nuclei. These data indicate that 57% of the EcoRI sites in nuclei are accessible to cleavage and that cleavage can occur within the core of at least half the nucleosomal subunits. Analysis of the products of digestion suggests a random distribution of nucleosomes about the EcoRI sites of satellite I DNA.Finally, the observation that satellite sequences can be cleaved from nuclei to 1400 bp length fragments with their associated proteins provides a method for the isolation of specific sequences as chromatin. Using sucrose gradient velocity centrifugation, we have isolated a 70% pure fraction of satellite I chromatin. Nuclease digestion of this chromatin fraction reveals the presence of nucleosomal subunits and indicates that specific sequences can be isolated in this manner without gross disorganization of their subunit structure.