High mobility group proteins HMG-1 and HMG-I/Y bind to a positive regulatory region of the pea plastocyanin gene promoter

A 268 bp region (P268) of the pea plastocyanin gene promoter responsible for high-level expression has been shown to interact with the high mobility group proteins HMG-1 and HMG-I/Y isolated from pea shoot chromatin. cDNAs encoding an HMG-1 protein of 154 amino acid residues containing a single HMG-box and a C-terminal acidic tail and an HMG-I/Y-like protein of 197 amino acid residues containing four AT-hooks have been isolated and expressed in Escherichia coli to provide large amounts of full-length proteins. DNase I footprinting identified eight binding sites for HMG-I/Y and six binding sites for HMG-1 in P268. Inhibition of binding by the antibiotic distamycin, which binds in the minor groove of A/T-rich DNA, revealed that HMG-I/Y binding was 400-fold more sensitive than HMG-1 binding. Binding-site selection from a pool of random oligonucleotides indicated that HMG-I/Y binds to oligonucleotides containing stretches of five or more A/T bp and HMG-1 binds preferentially to oligonucleotides enriched in dinucleotides such as TpT and TpG.     

Multiple proteins bind to the P2 promoter region of the zein gene pMS1 of maize

Summary A 216 by promoter fragment of the 19 kDa protein zein gene pMS1, containing the CCAAT and TATA boxes, was analysed by a variety of techniques for in vitro interactions with nuclear proteins from endosperm tissue. HMG proteins were found to form stable complexes with these A/T-rich promoter sequences and several specific DNA-binding proteins appear to be involved in the formation of DNA-protein complexes with this fragment. A 29 bp region spanning the two CCAAT boxes was protected from DNase I digestion in footprinting experiments.     

Purification of multiple erythroid cell proteins that bind the promoter of the alpha-globin gene.

Three erythroid cell factors that bind the murine alpha-globin promoter were enriched more than 1,000-fold by conventional and DNA sequence affinity chromatography. Visualization of enriched polypeptides revealed simple patterns suggesting that each binding activity was purified. Two of the purified proteins, alpha-CP1 and alpha-CP2, have been shown previously to interact with distinct binding sites that overlap in the alpha-globin CCAAT box. Affinity purification of alpha-CP1 revealed seven polypeptides with Mrs raging from 27,000 to 38,000. In contrast, purified alpha-CP2 was made up of a polypeptide doublet with Mrs of 64,000 and 66,000. The third purified binding activity, alpha-IRP, interacted with sequences that formed an inverted repeat (IR) between the alpha-globin CCAAT and TATAA boxes. Affinity-purified alpha-IRP was made up of a single polypeptide with an Mr of 85,000. We confirmed that the purified polypeptides corresponded to alpha-CP1-, alpha-CP2-, and alpha-IRP-binding activities by UV cross-linking experiments (alpha-CP2 and alpha-IRP) or by renaturation of binding activity after elution of polypeptides from sodium dodecyl sulfate-polyacrylamide gels (alpha-CP1 and alpha-CP2). The apparent complexity of the polypeptides accounting for alpha-CP1 binding activity prompted a further physical characterization of this factor. Sedimentation of affinity-purified alpha-CP1 in glycerol gradients containing 100 mM KCl showed that all seven polypeptides migrated as a complex that cosedimented with alpha-CP1-binding activity. In contrast, when sedimented in glycerol gradients containing 500 mM KCl, alpha-CP1 dissociated into at least two components. Under these conditions, alpha-CP1-binding activity was reduced or lost. Activity was reconstituted, however, by combining fractions that were enriched in the two components. These results were confirmed by experiments in which we showed that alpha-CP1-binding activity can be recovered only by combining distinct sets of polypeptides that were isolated and renatured from sodium dodecyl sulfate-polyacrylamide gels. Our results suggest that the seven polypeptides visualized after affinity purification of alpha-CP1 interact to form a heterotypic complex (or set of complexes) required for alpha-CP1-binding activity.     

BLG-e1 - a novel regulatory element in the distal region of the beta-lactoglobulin gene promoter

beta-Lactoglobulin (BLG) is a major ruminant milk protein. A regulatory element, termed BLG-e1, was defined in the distal region of the ovine BLG gene promoter. This 299-bp element lacks the established cis-regulatory sequences that affect milk-protein gene expression. Nevertheless, it alters the binding of downstream BLG sequences to histone H4 and the sensitivity of the histone-DNA complexes to trichostatin A treatment. In mammary cells cultured under favorable lactogenic conditions, BLG-e1 acts as a potent, position-independent silencer of BLG/luciferase expression, and similarly affects the promoter activity of the mouse whey acidic protein gene. Intragenic sequences upstream of BLG exon 2 reverse the silencing effect of BLG-e1 in vitro and in transgenic mice.     

Alpha and beta thyroid hormone receptors bind immediately adjacent to the rat growth hormone gene TATA box in a negatively hormone-responsive promoter region

We report that alpha and beta type rat thyroid hormone receptors bind specifically and with high affinity to the 10-base pair sequence immediately 3' of the rat growth hormone TATA box (positions -25 to -16) in a region of the rat growth hormone promoter which can be negatively hormone responsive (nTRE). The receptors have approximately 7-fold lower affinity in vitro for the nTRE than for the thyroid hormone-responsive enhancer of the rat growth hormone gene (TRE). Proteins extracted with high salt concentration from rat pituitary cell nuclei enhance binding of the receptors to both the TRE and nTRE. A modification of the avidin-biotin complex DNA binding assay which enhances the sensitivity of the assay approximately 100-fold was used in these studies. The immediate proximity of a receptor binding site to the rat growth hormone TATA box suggests that direct interaction between receptor and TFIID (the TATA binding protein) mediates nTRE activity.     

Constitutive and inducible factors bind to regulatory element 3 in the promoter of the gene encoding mouse granulocyte colony-stimulating factor.

The expression of the mouse gene (G-CSF) encoding granulocyte colony-stimulating factor is controlled by at least three regulatory elements, GPE1, GPE2 and GPE3 (G-CSF promoter elements). A set of 30-mer oligodeoxyribonucleotides (oligos) scanning the GPE3 region (-104 to -51) of the G-CSF promoter was synthesized, and the tetramer of each oligo was inserted upstream from the cat gene with the simian virus 40 enhancer element. By introducing these hybrid genes into human squamous carcinoma CHU-2 and mouse macrophage BAM3 cells, the enhancer core element of the GPE3 was localized to the region from -98 to -79 in the promoter. A nuclear factor which specifically binds to the core element of the GPE3 was constitutively detected in human CHU-2 cells, whereas the expression of a similar, but distinctly different, factor was significantly induced in BAM3 cells by lipopolysaccharide. The results suggest that these nuclear factors play important roles in the constitutive expression of G-CSF in CHU-2 cells and its inducible expression in macrophages.     

Novel cAMP regulatory elements in the promoter region of bovine P-450(11 beta) gene

In order to elucidate the cAMP regulatory elements in the promoter region of bovine P-450(11 beta) genes, we analyzed the promoter region using chloramphenicol acetyltransferase (CAT) gene as the reporter. Various deletion plasmids were constructed using the promoter region of CB11 beta-7, which is one of the two normal genes. Examination of the effects of Bt2cAMP on the CAT activities of mouse adrenal tumor cells (Y-1 cells) transfected with these deletion plasmids suggested that two elements named Ad3 and Ad4 play major roles in the induction by cAMP. Ad3(AAGATAAGGCACCCATCCATCTT) is located at -306 bp to -284 bp and Ad4 (CCAAGGTC) is located at -331 bp to -324 bp in the promoter region of the P-450(11 beta) gene. Deletions of both Ad3 and Ad4 resulted in a large decrease of the induction ratio from 9- to 3-fold. Coexistence of Ad3 and Ad4 is essential for their function, because any mutations introduced into either one of them resulted in a decrease of the cAMP induction ratio. These two elements are highly conserved among bovine, mouse, and human P-450(11 beta) genes and have no similarity with known cAMP regulatory elements. DNase I footprint analysis indicated that factors which specifically bind to the two elements exist in the nuclear extract of bovine adrenal cortex cells. Ad3 and Ad4 showed different patterns in gel shift analysis using probes which contained Ad3 or Ad4 sequence, suggesting their interaction with different nuclear factors. We also found two other protected regions by DNase I footprint analysis of the promoter regions of P-450(11 beta) gene, and named them Ad5 and Ad6.(ABSTRACT TRUNCATED AT 250 WORDS)