Site-specific R-loops induce CGG repeat contraction and fragile X gene reactivation

1. Download : Download high-res image (136KB)
2. Download : Download full-size image

     

Expansion of the CGG repeat in fragile X in the FMR1 gene depends on the sex of the offspring.

Analysis of 139 mother-to-offspring transmissions of fragile X CGG triplet repeats revealed that the repeat expansion is enhanced in mother-to-son transmissions compared with mother-to-daughter transmissions. Evidence has been based on analysis of mother-offspring differences in the size of repeat (in kb), as well as on comparisons between proportions of male and female offspring with premutations, and full mutations, inherited from mothers carrying a premutation. Mean difference in the repeat size from mother-son transmissions was 1.45 kb, compared with mother-daughter transmissions of 0.76 kb. The difference is due primarily to a greater proportion of male than female offspring with full mutation from the premutation mothers and also to a higher frequency of reduction in repeat size from mothers to daughters than from mothers to sons. Our findings suggest the possibility of an interaction of the normal X homologue in a female zygote with the FMR1 sequence on the fragile X during replication to account for the lower level of expansion in mother-to-daughter transmissions relative to mother-to-son transmissions.     

Recurrent and unexpected segregation of the FMR1 CGG repeat in a family with fragile X syndrome

Fragile X syndrome, the most common cause of hereditary mental retardation, results from amplification of a CGG trinucleotide repeat in the FMR1 gene. The transmission of the CGG repeat from premutated individuals to their premutated descendants is usually unstable, showing an increase in the size of the repeat. We report here a family which exhibits recurrent and unexpected transmission of the maternal premutation to three daughters. The first daughter exhibited mosaicism with two premutated alleles, one contracted and the other expanded. The second daughter showed a reversion from the maternal premutation to the normal range, and the third carried an expanded premutated allele associated with an expanded paternal allele within the normal range. These variations in the size of the CGG repeat may result from many different mechanisms such as DNA polymerase slippage on the leading or lagging strand during replication, large contractions of repeats on the parental strand during replication, or recombination through unequal crossover between sister chromatids. Our results suggest that the variation of the CGG premutated alleles in this family may be the result of intrinsic instability associated with a trans-acting factor such as a mismatch repair gene product. Received: 21 August 1995 / Revised: 21 September 1995     

The fragile X premutation: into the phenotypic fold

Premutation alleles (55-200 CGG repeats) of the fragile X mental retardation 1 gene (FMR1) are known to contribute to the fragile X phenotype through genetic instability and transmission of full mutation alleles (>200 repeats). There is now mounting evidence that the premutation alleles themselves contribute to clinical involvement, including premature ovarian failure among female carriers and a new tremor/ataxia syndrome among older male carriers. Recent observations also provide direct evidence of dysregulation of the FMR1 gene in the premutation range, which may explain many of the clinical observations.     

Survey of the fragile X syndrome CGG repeat and the short-tandem-repeat and single-nucleotide-polymorphism haplotypes in an African American population

Previous studies have shown that specific short-tandem-repeat (STR) and single-nucleotide-polymorphism (SNP)-based haplotypes within and among unaffected and fragile X white populations are found to be associated with specific CGG-repeat patterns. It has been hypothesized that these associations result from different mutational mechanisms, possibly influenced by the CGG structure and/or cis-acting factors. Alternatively, haplotype associations may result from the long mutational history of increasing instability. To understand the basis of the mutational process, we examined the CGG-repeat size, three flanking STR markers (DXS548-FRAXAC1-FRAXAC2), and one SNP (ATL1) spanning 150 kb around the CGG repeat in unaffected (n=637) and fragile X (n=63) African American populations and compared them with unaffected (n=721) and fragile X (n=102) white populations. Several important differences were found between the two ethnic groups. First, in contrast to that seen in the white population, no associations were observed among the African American intermediate or "predisposed" alleles (41-60 repeats). Second, two previously undescribed haplotypes accounted for the majority of the African American fragile X population. Third, a putative "protective" haplotype was not found among African Americans, whereas it was found among whites. Fourth, in contrast to that seen in whites, the SNP ATL1 was in linkage equilibrium among African Americans, and it did not add new information to the STR haplotypes. These data indicate that the STR- and SNP-based haplotype associations identified in whites probably reflect the mutational history of the expansion, rather than a mutational mechanism or pathway.     

Detection of the fragile X syndrome protein for the evaluation of FMR1 intermediate alleles

Molecular screening programs in mentally retarded individuals have been performed in several populations worldwide. One finding has been an excess of FMR1 intermediate alleles in a population with learning difficulties. However, other published reports with similar characteristics did not corroborate those previous results. In order to contribute additional data from our population, we studied 563 patients affected with nonspecific mental retardation (MRX) that did not present a CGG expansion in the FMR1 gene and 208 individuals as a control population. Forty MRX patients presented alleles within the intermediate range. Among them, one case showed a pattern of expression of the FMR1 protein (FMRP) concordant with a fragile X syndrome case with an intermediate allele/full mutation mosaicism, although it was not detected by Southern blot analysis. Statistical analysis was performed again showing no statistically significant difference regarding the intermediate allele frequency in the MRX and control populations. This finding is in agreement with the hypothesis that the incidence of intermediate FMR1 alleles in MRX populations does not seem to be higher than in control populations, and it emphasizes the importance of FMRP detection as a diagnostic tool for fragile X syndrome.     

Data on the CGG repeat at the fragile X site in the non-retarded Japanese population and family suggest the presence of a subgroup of normal alleles predisposing to mutate

The fragile X mutation is the result of amplification in the repeat number of p(CGG) _n in FMR-1; alleles with more than 52 repeats have been shown to be so unstable as to mutate in the repeat number in almost every transmission. To improve our understanding of mutations in normal alleles of FMR-1, the following studies were carried out in the Japanese population: a study on length variation in the repeat to determine the allele distribution of the repeat length in a non-retarded population, family studies to observe new mutations in normal allele, and haplotype analyses with microsatellite markers flanking the repeat to confirm estimated mutation rates and founder chromosomes in the fragile X syndrome. Analysis of the p(CGG) _n in 370 unrelated males detected 24 distinct alleles with repeats of 18–44. A comparison with previously reported data suggests the presence of racial/ethnic differences in the allele distribution. No premutation allele was found in 824 unrelated X chromosomes examined by the polymerase chain reaction and Southern blot analysis. Family studies detected one new mutation in a total of 303 meioses. However, the mutation rate was not in accordance with the expected or observed heterozygosities in the population or with linkage disequilibrium observed between the repeat numbers and the haplotypes of the markers flanking the CGG. The haplotype in the chromosome in which the new mutation was found was the same as that frequently found in the Japanese fragile X chromosomes, and the variance in the CGG repeat number was wider in chromosomes with the haplotypes frequently found in the fragile X chromosome than in those with the other haplotypes. These observations suggest that a subgroup is present in normal alleles and that this subgroup is more liable to mutate than others.     

ATR protects the genome against CGG.CCG-repeat expansion in Fragile X premutation mice

Fragile X mental retardation syndrome is a repeat expansion disease caused by expansion of a CGG·CCG-repeat tract in the 5′ UTR of the FMR1 gene. In humans, small expansions occur more frequently on paternal transmission while large expansions are exclusively maternal in origin. It has been suggested that expansion is the result of aberrant DNA replication, repair or recombination. To distinguish amongst these possibilities we crossed mice containing 120 CGG·CCG-repeats in the 5′ UTR of the mouse Fmr1 gene to mice with mutations in ATR, a protein important in the cellular response to stalled replication forks and bulky DNA lesions. We show here that ATR heterozygosity results in increased expansion rates of maternally, but not paternally, transmitted alleles. In addition, age-related somatic expansions occurred in mice of both genders that were not seen in ATR wild-type animals. Some ATR-sensitive expansion occurs in postmitotic cells including haploid gametes suggesting that aberrant DNA repair is responsible. Our data suggest that two mechanisms of repeat expansion exist that may explain the small and large expansions seen in humans. In addition, our data provide an explanation for the maternal bias of large expansions in humans and the lower incidence of these expansions in mice.     

Methylation mosaicism of 5'-(CGG)(n)-3' repeats in fragile X, premutation and normal individuals

Fragile X syndrome (FRAXA) is characterized at the molecular level by an expansion of a naturally occurring 5′-(CGG)_n-3′ repeat in the promoter and 5′-untranslated region (5′-UTR) of the fragile X mental retardation (FMR1) gene on human chromosome Xq27.3. When expanded, this region is usually hypermethylated. Inactivation of the FMR1 promoter and absence of the FMR1 protein are the likely cause of the syndrome. By using the bisulfite protocol of the genomic sequencing method, we have determined the methylation patterns in this region on single chromosomes of healthy individuals and of selected premutation carriers and FRAXA patients. In control experiments with unmethylated or M-SssI-premethylated DNAs, this protocol has been ascertained to reliably detect all cytidines or 5-methylcytidines as unmethylated or methylated nucleotides, respectively. Analyses of the DNA from FRAXA patients reveal considerable variability in the lengths of the 5′-(CGG)_n-3′ repeats and in the levels of methylation in the repeat and the 5′-UTR. In one patient (OEl) with high repeat length heterogeneity (n = 15 to >200), shorter repeats (n = 20–80) were methylated or unmethylated, longer repeats (n = 100–150) were often completely methylated, but one repeat with n = 160 proved to be completely unmethylated. This type of methylation mosaicism was observed in several FRAXA patients. In healthy females, methylated 5′-CG-3′ sequences were found in some repeats and 5′-UTRs, as expected for the sequences from one of the X chromosomes. The natural FMR1 promoter is methylation sensitive, as demonstrated by the loss of activity in transfection experiments using the unmethylated or M-SssI-premethylated FMR1 promoter fused to the luciferase gene as an activity indicator.     

Variation of the CGG repeat at the fragile X site results in genetic instability: resolution of the Sherman paradox.

Fragile X syndrome results from mutations in a (CGG)n repeat found in the coding sequence of the FMR-1 gene. Analysis of length variation in this region in normal individuals shows a range of allele sizes varying from a low of 6 to a high of 54 repeats. Premutations showing no phenotypic effect in fragile X families range in size from 52 to over 200 repeats. All alleles with greater than 52 repeats, including those identified in a normal family, are meiotically unstable with a mutation frequency of one, while 75 meioses of alleles of 46 repeats and below have shown no mutation. Premutation alleles are also mitotically unstable as mosaicism is observed. The risk of expansion during oogenesis to the full mutation associated with mental retardation increases with the number of repeats, and this variation in risk accounts for the Sherman paradox.     

Instability of the CGG repeat and expression of the FMR1 protein in a male fragile X patient with a lung tumor.

The molecular mechanism of the fragile X syndrome is based on the expansion of an CGG repeat in the 5' UTR of the FMR1 gene in the majority of fragile X patients. This repeat displays instability both between individuals and within an individual. We studied the instability of the CGG repeat and the expression of the FMR1 protein (FMRP) in several different tissues derived from a male fragile X patient. Using Southern blot analysis, only a full mutation is detected in 9 of the 11 tissues tested. The lung tumor contains a methylated premutation of 160 repeats, whereas in the testis, besides the full mutation, a premutation of 60 CGG repeats is detected. Immunohistochemistry of the testis revealed expression of FMR1 in the spermatogonia only, confirming the previous finding that, in the sperm cells of fragile X patients with a full mutation in their blood cells, only a premutation is present. Immunohistochemistry of brain and lung tissue revealed that 1% of the cells are expressing the FMRP. PCR analysis demonstrated the presence of a premutation of 160 repeats in these FMR1-expressing cells. This indicates that the tumor was derived from a lung cell containing a premutation. Remarkably, despite the methylation of the EagI and BssHII sites, FMRP expression is detected in the tumor. Methylation of both restriction sites has thus far resulted in a 100% correlation with the lack of FMR1 expression, but the results found in the tumor suggest that the CpGs in these restriction sites are not essential for regulation of FMR1 expression. This indicates a need for a more accurate study of the exact promoter of FMR1.     

The quadruplex r(CGG)n destabilizing cationic porphyrin TMPyP4 cooperates with hnRNPs to increase the translation efficiency of fragile X premutation mRNA

The 5′ untranslated region of the FMR1 gene which normally includes 4–55 d(CGG) repeats expands to > 55–200 repeats in carriers of fragile X syndrome premutation. Although the levels of premutation FMR1 mRNA in carrier cells are 5–10-fold higher than normal, the amount of the product FMR protein is unchanged or reduced. We demonstrated previously that premutation r(CGG)_n tracts formed quadruplex structures that impeded translation and lowered the efficiency of protein synthesis. Normal translation could be restored in vivo by the quadruplex r(CGG)_n destabilizing action of CBF-A and hnRNP A2 proteins. Here we report that the quadruplex-interacting cationic porphyrin TMPyP4 by itself and in cooperation with CBF-A or hnRNP A2 also unfolded quadruplex r(CGG)_n and increased the efficiency of translation of 5′-(CGG)₉₉ containing reporter firefly (FL) mRNA. TMPyP4 destabilized in vitro a (CGG)₃₃ intramolecular quadruplex structure and enhanced the translation of 5′-(CGG)₉₉-FL mRNA in a rabbit reticulocyte lysate and in HEK293 cells. The efficiency of translation of (CGG)₉₉-FL mRNA was additively increased in cells exposed to TMPyP4 together with CBF-A. Whereas low doses of TMPyP4, CBF-A or hnRNP A2 by themselves did not affect the in vivo utilization of (CGG)₉₉-FL mRNA, introduction of TMPyP4 together with either protein synergistically augmented its translation efficiency.     

Human werner syndrome DNA helicase unwinds tetrahelical structures of the fragile X syndrome repeat sequence d(CGG)n

Formation of hairpin and tetrahelical structures by a d(CGG) trinucleotide repeat sequence is thought to cause expansion of this sequence and to engender fragile X syndrome. Here we show that human Werner syndrome DNA helicase (WRN), a member of the RecQ family of helicases, efficiently unwinds G'2 bimolecular tetraplex structures of d(CGG)7. Unwinding of d(CGG)7 by WRN requires hydrolyzable ATP and Mg2+ and is proportional to the amount of added helicase and to the time of incubation. The efficiencies of unwinding of G'2 d(CGG)7 tetraplex with 7 nucleotide-long single-stranded tails at their 3' or 5' ends are, respectively, 3.5- and 2-fold greater than that of double-stranded DNA. By contrast, WRN is unable to unwind a blunt-ended d(CGG)7 tetraplex, bimolecular tetraplex structures of a telomeric sequence 5'-d(TAGACATG(TTAGGG)2TTA)-3', or tetramolecular quadruplex forms of an IgG switch region sequence 5'-d(TACAGGGGAGCTGGGGTAGA)-3'. The ability of WRN to selectively unwind specific tetrahelices may reflect a specific role of this helicase in DNA metabolism.     

RNA-binding proteins hnRNP A2/B1 and CUGBP1 suppress fragile X CGG premutation repeat-induced neurodegeneration in a Drosophila model of FXTAS

Fragile X-associated tremor/ataxia syndrome (FXTAS) is a recently described neurodegenerative disorder of older adult carriers of premutation alleles (60-200 CGG repeats) in the fragile X mental retardation gene (FMR1). It has been proposed that FXTAS is an RNA-mediated neurodegenerative disease caused by the titration of RNA-binding proteins by the CGG repeats. To test this hypothesis, we utilize a transgenic Drosophila model of FXTAS that expresses a premutation-length repeat (90 CGG repeats) from the 5' UTR of the human FMR1 gene and displays neuronal degeneration. Here, we show that overexpression of RNA-binding proteins hnRNP A2/B1 and CUGBP1 suppresses the phenotype of the CGG transgenic fly. Furthermore, we show that hnRNP A2/B1 directly interacts with riboCGG repeats and that the CUGBP1 protein interacts with the riboCGG repeats via hnRNP A2/B1.     

Neuroanatomy in fragile X females: the posterior fossa.

The relative homogeneity of the neuropsychiatric phenotype in individuals with fragile (fra) X syndrome suggests that there are consistent central nervous system (CNS) abnormalities underlying the observed cognitive and behavioral abnormalities. In this study, the neuroanatomy of the posterior fossa and other selected CNS regions in 12 young fra X females were compared with those of a group of 12 age-, sex-, and IQ-matched females without evidence of the fra X syndrome. Fra X females were shown to have decreased size of the posterior cerebellar vermis and increased size of the fourth ventricle, findings that are identical to those previously reported for fra X males. When compared with fra X male and nonfra X control groups, the distribution of the posterior-vermis and fourth-ventricle variables for the fra X female group was intermediate. These results support the hypothesis that the fra X genetic abnormality leads to hypoplasia of the posterior cerebellar vermis, a neuroanatomical variation of potential importance to both developmental and neuropsychiatric syndromes.