Facile determination of DNA-binding nuclear factor-kappaB by chemiluminescence detection

A simple, rapid, and sensitive method for the assay of a sequence-specific DNA-binding protein, nuclear factor-kappaB (NF-kappaB), has been developed by using a DNA-detectable chemiluminogenic reagent and a centrifugal filter that distinguishes different molecular sizes. After the formation of a complex between NF-kappaB and DNA, the unbound DNA is separated from the complex by the centrifugal filter. The amount of the bound NF-kappaB is estimated by chemiluminescence detection of the bound DNA. This detection is performed within 2 min at room temperature by the use of a chemiluminogenic reagent, 3',4',5'-trimethoxyphenylglyoxal, which selectively recognizes guanine moiety in oligonucleotides or DNAs. This method does not require any labeled probes or antibodies and can determine a concentration as low as 5 nM of DNA-binding NF-kappaB. The sensitivity is nearly the same as that of other methods such as gel shift assay using fluorescence-labeled probes and enzyme-linked immunosorbent assay. Therefore, the current method provides a convenient tool for surveying various DNA-binding proteins.     

Crystal structure of the CENP-B protein-DNA complex: the DNA-binding domains of CENP-B induce kinks in the CENP-B box DNA.

The human centromere protein B (CENP-B), one of the centromere components, specifically binds a 17 bp sequence (the CENP-B box), which appears in every other alpha-satellite repeat. In the present study, the crystal structure of the complex of the DNA-binding region (129 residues) of CENP-B and the CENP-B box DNA has been determined at 2.5 A resolution. The DNA-binding region forms two helix-turn-helix domains, which are bound to adjacent major grooves of the DNA. The DNA is kinked at the two recognition helix contact sites, and the DNA region between the kinks is straight. Among the major groove protein-bound DNAs, this 'kink-straight-kink' bend contrasts with ordinary 'round bends' (gradual bending between two protein contact sites). The larger kink (43 degrees ) is induced by a novel mechanism, 'phosphate bridging by an arginine-rich helix': the recognition helix with an arginine cluster is inserted perpendicularly into the major groove and bridges the groove through direct interactions with the phosphate groups. The overall bending angle is 59 degrees, which may be important for the centromere-specific chromatin structure.     

Epstein-Barr virus nuclear antigen forms a complex that binds with high concentration dependence to a single DNA-binding site.

A bacterially synthesized 28-kilodalton carboxyl-terminal fragment (28K-EBNA of Epstein-Barr virus nuclear antigen shows highly concentration dependent binding to monomer, dimer, and trimer copies of synthetic DNA-binding site 5' GATCTAGGATAGCATATGCTACCCCGGGG 3' 3' ATCCTATCGTATACGATGGGGCCCCCTAG 5' in bacterial plasmids. The rate of the binding reaction is independent of the number of sites, but dependent upon the length of the DNA containing the sites. These data are consistent with 28K-EBNA locating its binding sites by a process of facilitated transfer or sliding along the DNA. The highly concentration dependent binding suggests that multiple 28K-EBNA monomer polypeptides form a complex before or during binding. Binding occurs equally well at 24 and 37 degrees C, but not at 0 degrees C. A 28K-EBNA complex bound to a single site has unoccupied binding sites capable of interacting with additional DNA molecules. Such interaction is confirmed by agarose gel electrophoresis of protein-DNA complexes which indicate that a 28K-EBNA complex forms bridges between two DNA molecules. A bridge between the two binding regions in the Epstein-Barr virus origin of plasmid replication (oriP) would form a loop structure which could be an important feature for the regulatory function of authentic Epstein-Barr virus nuclear antigen.     

The crystal structure of the Ran-Nup153ZnF2 complex: a general Ran docking site at the nuclear pore complex

Nucleoporin (Nup) 153 is a highly mobile, multifunctional, and essential nuclear pore protein. It contains four zinc finger motifs that are thought to be crucial for the regulation of transport-receptor/cargo interactions via their binding to the small guanine nucleotide binding protein, Ran. We found this interaction to be independent of the phoshorylation state of the nucleotide. Ran binds with the highest affinity to the second zinc finger motif of Nup153 (Nup153ZnF2). Here we present the crystal structure of this complex, revealing a new type of Ran-Ran interaction partner interface together with the solution structure of Nup153ZnF2. According to our complex structure, Nup153ZnF2 binding to Ran excludes the formation of a Ran-importin-beta complex. This finding suggests a local Nup153-mediated Ran reservoir at the nucleoplasmic distal ring of the nuclear pore, where nucleotide exchange may take place in a ternary Nup153-Ran-RCC1 complex, so that import complexes are efficiently terminated.     

Novel DNA-binding ligands with sequence selectivity based on hydrophobic structure.

We have developed diamino-bistetrahydrofuran compounds (diamino-bisTHF) as new DNA binding molecules. Diamino-bisTHF (3:RR8) stabilized GC-rich duplex DNA with sequence specificity. DNA binding affinity increased as the alkyl chain was lengthened, indicating that the hydrophobic interaction is essential for DNA binding. It was also found that DNA binding affinity of the ligands depends on the stereochemistry of the amino group. In thermodynamic evaluation, diamino-bisTHF (3:RR8) showed a high affinity to the 12 bp duplex at a molar ratio of 1:1.     

Crystal structure of the chromodomain helicase DNA-binding protein 1 (Chd1) DNA-binding domain in complex with DNA

Chromatin remodelers are ATP-dependent machines that dynamically alter the chromatin packaging of eukaryotic genomes by assembling, sliding, and displacing nucleosomes. The Chd1 chromatin remodeler possesses a C-terminal DNA-binding domain that is required for efficient nucleosome sliding and believed to be essential for sensing the length of DNA flanking the nucleosome core. The structure of the Chd1 DNA-binding domain was recently shown to consist of a SANT and SLIDE domain, analogous to the DNA-binding domain of the ISWI family, yet the details of how Chd1 recognized DNA were not known. Here we present the crystal structure of the Saccharomyces cerevisiae Chd1 DNA-binding domain in complex with a DNA duplex. The bound DNA duplex is straight, consistent with the preference exhibited by the Chd1 DNA-binding domain for extranucleosomal DNA. Comparison of this structure with the recently solved ISW1a DNA-binding domain bound to DNA reveals that DNA lays across each protein at a distinct angle, yet contacts similar surfaces on the SANT and SLIDE domains. In contrast to the minor groove binding seen for Isw1 and predicted for Chd1, the SLIDE domain of the Chd1 DNA-binding domain contacts the DNA major groove. The majority of direct contacts with the phosphate backbone occur only on one DNA strand, suggesting that Chd1 may not strongly discriminate between major and minor grooves.     

A 1H nuclear relaxation study of the Mn2+ . bleomycin complex. Proximity of the metal to the DNA-binding site

The antineoplastic action of bleomycin is thought to involve the aerobic degradation of DNA by the Fe2+ . bleomycin complex. Different parts of the bleomycin molecule have been implicated in metal binding and DNA binding. To probe the structure of a metal-containing bleomycin, we studied the effects of the high spin Mn2+ ion in the Mn2+ . bleomycin complex on the longitudinal nuclear relaxation rates of various protons in the molecule. Complexation of Mn2+ to bleomycin was also studied by EPR, and a Scatchard plot of the EPR data revealed a single tight divalent cation-binding site per molecule. From the magnitudes of the paramagnetic effects of Mn2+ on the nuclear relaxation rates of several assigned resonances, we calculate the relative distances of the corresponding protons from the metal. Using a pyrimidine methyl to metal distance of 6.5 A, consistent with the metal coordination of this aromatic group of bleomycin established on the basis of other studies, we find from our data that the bithiazole and COOH-terminal portions of the molecule are located spatially very close to the metal. These groups have previously been implicated in DNA binding. Our metal to bithiazole proton distances (approximately 5.4 A) are consistent with bithiazole as a metal ligand, although possible involvement of interactions other than direct coordination in maintaining close proximity cannot be excluded. Our distance data also argue against the imidazole ring of beta-hydroxyhistidine as a ligand. The short distance between the metal- and DNA-binding sites indicated by our studies would help ensure that the reactive reduced oxygen radicals produced at the metal site during Fe2+ oxidation in the aerobic Fe2+ . bleomycin complex reach the substrate DNA before the destruction of these radicals can occur in other ways.     

G protein-coupled receptor kinase 5 contains a DNA-binding nuclear localization sequence

G protein-coupled receptor kinases (GRKs) mediate desensitization of agonist-occupied G protein-coupled receptors (GPCRs). Here we report that GRK5 contains a DNA-binding nuclear localization sequence (NLS) and that its nuclear localization is regulated by GPCR activation, results that suggest potential nuclear functions for GRK5. As assessed by fluorescence confocal microscopy, transfected and endogenous GRK5 is present in the nuclei of HEp2 cells. Mutation of basic residues in the catalytic domain of GRK5 (between amino acids 388 and 395) results in the nuclear exclusion of the mutant enzyme (GRK5(Delta)(NLS)), demonstrating that GRK5 contains a functional NLS. The nuclear localization of GRK5 is subject to dynamic regulation. Calcium ionophore treatment or activation of Gq-coupled muscarinic-M3 receptors promotes the nuclear export of the kinase in a Ca(2+)/calmodulin (Ca(2+)/CaM)-dependent fashion. Ca(2+)/CaM binding to the N-terminal CaM binding site of GRK5 mediates this effect. Furthermore, GRK5, but not GRK5(Delta)(NLS) or GRK2, binds specifically and directly to DNA in vitro. Consistent with their presence in the nuclei of transfected cells, all the GRK4, but not GRK2, subfamily members contain putative NLSs. These results suggest that the GRK4 subfamily of GRKs may play a signaling role in the nucleus and that GRK4 and GRK2 subfamily members perform divergent cellular functions.     

Detecting DNA-binding helix-turn-helix structural motifs using sequence and structure information

In this work, we analyse the potential for using structural knowledge to improve the detection of the DNA-binding helix–turn–helix (HTH) motif from sequence. Starting from a set of DNA-binding protein structures that include a functional HTH motif and have no apparent sequence similarity to each other, two different libraries of hidden Markov models (HMMs) were built. One library included sequence models of whole DNA-binding domains, which incorporate the HTH motif, the second library included shorter models of ‘partial’ domains, representing only the fraction of the domain that corresponds to the functionally relevant HTH motif itself. The libraries were scanned against a dataset of protein sequences, some containing the HTH motifs, others not. HMM predictions were compared with the results obtained from a previously published structure-based method and subsequently combined with it. The combined method proved more effective than either of the single-featured approaches, showing that information carried by motif sequences and motif structures are to some extent complementary and can successfully be used together for the detection of DNA-binding HTHs in proteins of unknown function.     

Dynamic DNA contacts observed in the NMR structure of winged helix protein-DNA complex.

Genesis is an HNF-3/fkh homologous protein. By using multi-dimensional NMR techniques, we have obtained the solution structure and backbone dynamics of Genesis complexed with a 17 base-pair DNA. Our results indicate that both the local folding and dynamic properties of Genesis are perturbed when it binds to the DNA site. Our data show that a conserved flexible amino acid sequence (wing 1) makes dynamic contacts to DNA in the complex and a short helix is induced by Genesis-DNA interactions. Our data indicate that, unlike the HNF-3gamma/DNA complex, a magnesium ion is not required in forming the stable Genesis-DNA complex.     

The DNA-binding protein of Pf1 filamentous bacteriophage: amino-acid sequence and structure of the gene

The amino-acid sequence of the single-stranded DNA-binding protein of bacteriophage Pf1 and the nucleotide sequence of the corresponding gene have been determined. The protein has 144 amino acids and a molecular weight of 15 400; the gene consists of 435 nucleotides. The amino-acid sequence was determined by Edman degradation, carboxypeptidase A, B, and P digestion of intact protein and of peptides derived by chymotrypsin, Staphylococcus aureus V8 protease, and trypsin digestion. The nucleotide sequence was determined by the dideoxy method after random cloning of fragments of Pf1 DNA into M13. No sequence homology could be established between the amino-acid sequence of the DNA-binding protein of Pseudomonas aeruginosa-specific bacteriophage Pf1 and bacteriophage fd of Escherichia coli.     

Comparison of X-ray crystal structure of the 30S subunit-antibiotic complex with NMR structure of decoding site oligonucleotide-paromomycin complex

Aminoglycoside antibiotics that bind to 16S ribosomal RNA in the aminoacyl-tRNA site (A site) cause misreading of the genetic code and inhibit translocation. Structures of an A site RNA oligonucleotide free in solution and bound to the aminoglycosides paromomycin or gentamicin C1a have been determined by NMR. Recently, the X-ray crystal structure of the entire 30S subunit has been determined, free and bound to paromomycin. Distinct differences were observed in the crystal structure, particularly at A1493. Here, the NMR structure of the oligonucleotide-paromomycin complex was determined with higher precision and is compared with the X-ray crystal structure of the 30S subunit complex. The comparison shows the validity of both structures in identifying critical interactions that affect ribosome function.