Functional idiosyncrasies of tRNA isoacceptors in cognate and noncognate aminoacylation systems

The specificity of transfer RNA aminoacylation by cognate aminoacyl-tRNA synthetase is a crucial step for synthesis of functional proteins. It is established that the aminoacylation identity of a single tRNA or of a family of tRNA isoacceptors is linked to the presence of positive signals (determinants) allowing recognition by cognate synthetases and negative signals (antideterminants) leading to rejection by the noncognate ones. The completion of identity sets was generally tested by transplantation of the corresponding nucleotides into one or several host tRNAs which acquire as a consequence the new aminoacylation specificities. Such transplantation experiments were also useful to detect peculiar structural refinements required for optimal expression of a given aminoacylation identity set within a host tRNA. This study explores expression of the defined yeast aspartate identity set into different tRNA scaffolds of a same specificity, namely the four yeast tRNA(Arg) isoacceptors. The goal was to investigate whether expression of the new identity is similar due to the unique specificity of the host tRNAs or whether it is differently expressed due to their peculiar sequences and structural features. In vitro transcribed native tRNA(Arg) isoacceptors and variants bearing the aspartate identity elements were prepared and their aminoacylation properties established. The four wild-type isoacceptors are active in arginylation with catalytic efficiencies in a 20-fold range and are inactive in aspartylation. While transplanted tRNA(1)(Arg) and tRNA(4)(Arg) are converted into highly efficient substrates for yeast aspartyl-tRNA synthetase, transplanted tRNA(2)(Arg) and tRNA(3)(Arg) remain poorly aspartylated. Search for antideterminants in these two tRNAs reveals idiosyncratic features. Conversion of the single base-pair C6-G67 into G6-C67, the pair present in tRNA(Asp), allows full expression of the aspartate identity in the transplanted tRNA(2)(Arg), but not in tRNA(3)(Arg). It is concluded that the different isoacceptor tRNAs protect themselves from misaminoacylation by idiosyncratic pathways of antidetermination.     

The primary structure of six leucine isoacceptor tRNAs of yellow lupin seeds. The structural requirements for amber tRNA suppressor activity

Six tRNA(Leu) isoacceptors from yellow lupin seeds were purified, sequenced, and their readthrough properties over the UAG stop codon were tested using TMV RNA as a messenger. The tested tRNAs(Leu) did not show amber suppressor activity. The partial structure of tRNA(Gln), a minor species in yellow lupin, was also determined. Comparison of the nucleotide sequence of all known isoacceptors of tRNA(Tyr), tRNA(Gln) and tRNA(Leu) from plants, mammals and ciliates enabled us to find general structural requirements for tRNA to be a UAG suppressor. From the partial sequence of lupin tRNA(Gln) we suggest that it will have readthrough properties.     

The Seryl-tRNA synthetase/tRNA acceptor stem interface is mediated via a specific network of water molecules

tRNAs are aminoacylated by the aminoacyl-tRNA synthetases. There are at least 20 natural amino acids, but due to the redundancy of the genetic code, 64 codons on the mRNA. Therefore, there exist tRNA isoacceptors that are aminoacylated with the same amino acid, but differ in their sequence and in the anticodon. tRNA identity elements, which are sequence or structure motifs, assure the amino acid specificity. The Seryl-tRNA synthetase is an enzyme that depends on rather few and simple identity elements in tRNA^Ser. The Seryl-tRNA-synthetase interacts with the tRNA^Ser acceptor stem, which makes this part of the tRNA a valuable structural element for investigating motifs of the protein–RNA complex. We solved the high resolution crystal structures of two tRNA^Ser acceptor stem microhelices and investigated their interaction with the Seryl-tRNA-synthetase by superposition experiments. The results presented here show that the amino acid side chains Ser151 and Ser156 of the synthetase are interacting in a very similar way with the RNA backbone of the microhelix and that the involved water molecules have almost identical positions within the tRNA/synthetase interface.     

Comparative RNomics and modomics in Mollicutes: prediction of gene function and evolutionary implications

Stable RNAs are central to protein synthesis. Ribosomal RNAs make the core of the ribosome and provide the scaffold for accurate translation of mRNAs by a set of tRNA molecules each carrying an activated amino acid. To fulfill these important cellular functions, both rRNA and tRNA molecules require more than the four canonical bases and have recruited enzymes that introduce numerous modifications on nucleosides. Mollicutes are parasitic unicellular bacteria that originated from gram-positive bacteria by considerably reducing their genome, reaching a minimal size of 480 kb in Mycoplasma genitalium. By analyzing the complete set of tRNA isoacceptors (tRNomics) and predicting the tRNA/rRNA modification enzymes (Modomics) among all sequenced Mollicutes (15 in all), our goal is to predict the minimal set of RNA modifications needed to sustain accurate translation of the cell's genetic information. Building on the known phylogenetic relationship of the 15 Mollicutes analyzed, we demonstrate that the solutions to reducing the RNA component of the translation apparatus vary from one Mollicute to the other and often rely on co-evolution of specific tRNA isoacceptors and RNA modification enzymes. This analysis also reveals that only a few modification enzymes acting on nucleotides of the anticodon loop in tRNA (the wobble position 34 as well as in position 37, 3'-adjacent to anticodon) and of the peptidyltransferase center of 23S rRNA appear to be absolutely essential and resistant to gene loss during the evolutionary process of genome reduction.     

Recognition of exon-intron boundaries by the Halobacterium volcanii tRNA intron endonuclease.

The intron-containing tRNA(Trp) precursor from Halobacterium volcanii, like many intron-containing archaebacterial precursor tRNAs, can assume a structure in which the two intron endonuclease cleavage sites are localized in two three-nucleotide loops separated by four base pairs. To investigate the role of this structure in cleavage by the halophilic endonuclease, a series of mutant tRNA(Trp) RNAs were prepared and evaluated as substrates. We find that alterations in this structure result in the loss of cleavage at both 5' and 3' sites. Cleavage of a 35-nucleotide model RNA substrate, containing only these features, demonstrates that sequences and structures present at the exon-intron boundaries are sufficient for recognition and cleavage. We have also examined the mechanism used by the halophilic endonuclease to identify the cleavage sites. Addition of a single base, or a base pair in the anticodon stem above the cleavage sites, does not affect the cleavage site selection. The addition of nucleotides between the two cleavage sites significantly decreases cleavage efficiency and has an effect on the cleavage site selection. These results demonstrate that the halophilic endonuclease requires a defined structure at the exon-intron boundaries and does not identify its cleavage sites by a measurement mechanism like that employed by eukaryotic tRNA intron endonucleases.     

Identification of an entire set of tRNA molecules and characterization of cleavage sites of the intron-containing tRNA precursors in acidothermophilic crenarchaeon Sulfolobus tokodaii strain7

The acidothermophilic crenarchaeon, Sulfolobus tokodaii strain7, was isolated from a hot spring in Beppu, Kyushu, Japan. Whole genomic data of this microorganism indicated that among 46 putative tRNA genes identified, 24 were interrupted tRNA genes containing an intron. A sequence comparison between the cDNA sequences for unspliced and spliced tRNAs indicated that all predicted tRNAs were expressed and all intron portions were spliced in this microorganism. However, the actual cleavage site in the splicing process was not determined for 13 interrupted tRNAs because of the presence of the same nucleotides at both 5′ and 3′ border regions of each intron. The cleavage sites for all the introns, which were determined by an in vitro cleavage experiment with recombinant splicing endonuclease as well as cDNA sequencing of the spliced tRNAs, indicated that non-canonical BHB structure motifs were also recognized and processed by the splicing machinery in this organism. This is the first report to empirically determine the actual cleavage and splice sites of introns in the whole set of archaeal tRNA genes, and reassigns the exon-intron borders with a novel and more plausible non-canonical BHB structure.     

Specific changes in Q-ribonucleoside containing transfer RNA species during Friend leukemia cell erythroid differentiation.

Changes in specific tRNA isoacceptors during Friend leukemia cell (F.L.C.) erythroid differentiation have been found to be concomitant with differences in the extent of the Q-base modification in certain species of tRNA. Transfer RNA was isolated from F.L.C. cultures after 0, 36, 48, 72, and 96 hr of DMSO induced differentiation. Changes in 17 isoacceptors of tRNAasn, tRNAasp, tRNAhis and tRNAtyr were compared by RPC-5 chromatography. Isoacceptors of these tRNA changed in relative amounts, following consistent trends throughout cell differentiation. The amount and distribution of Q-base containing tRNA isoacceptors was assayed by measuring the quanine-tRNA transferase catalyzed incorporation of [3H]-labeled guanine into tRNA species undermodified in Q-base followed by RPC-5 chormatography of the tRNA. The amount of Q-base containing tRNA species decreased in the first 48 hr after the induction, then increased again, indicating the level of Q-modification is correlated to the process of differentiation. Isoacceptors that lacked the Q-base were eluted late from RPC-5.     

Synthesis of 125I-labeled N-3-(4-hydroxyphenyl)propionyl aminoacyl transfer ribonucleic acids.

A method for the isolation and labeling to high specific radioactivity of individual isoaccepting tRNAs is described. After blocking reactive minor bases by acetylation and iodination of the crude tRNA, a single family of isoacceptors was aminoacylated. Individual isoacceptors were separated by chromatography on RPC-5 and then acylated with the 3-(4-hydroxyphenyl)propionyl ester of N-hydroxysuccinimide. The product was purified by chromatography on BD-cellulose and RPC-5. This derivatized tRNA was then iodinated with 125I- and Chloramine-T to give a product containing between 5 X 10(7) and 3 X 10(8) dpm/microgram. The suitability of such labeled tRNAs for hybridization to homologous DNA in solution and cytological preparations of chromosomes is discussed with particular reference to Drosophila melanogaster.     

Eukaryotic tRNA sequences present conserved and amino acid-specific structural signatures

Metazoan organisms have many tRNA genes responsible for decoding amino acids. The set of all tRNA genes can be grouped in sets of common amino acids and isoacceptor tRNAs that are aminoacylated by corresponding aminoacyl-tRNA synthetases. Analysis of tRNA alignments shows that, despite the high number of tRNA genes, specific tRNA sequence motifs are highly conserved across multicellular eukaryotes. The conservation often extends throughout the isoacceptors and isodecoders with, in some cases, two sets of conserved isodecoders. This study is focused on non-Watson–Crick base pairs in the helical stems, especially GoU pairs. Each of the four helical stems may contain one or more conserved GoU pairs. Some are amino acid specific and could represent identity elements for the cognate aminoacyl tRNA synthetases. Other GoU pairs are found in more than a single amino acid and could be critical for native folding of the tRNAs. Interestingly, some GoU pairs are anticodon-specific, and others are found in phylogenetically-specific clades. Although the distribution of conservation likely reflects a balance between accommodating isotype-specific functions as well as those shared by all tRNAs essential for ribosomal translation, such conservations may indicate the existence of specialized tRNAs for specific translation targets, cellular conditions, or alternative functions.     

Wheat germ tRNAs containing uridine in place of ribothymidine: a characterization of an unusual class of eukaryotic tRNAs.

An unusual class of wheat germ tRNAs has been isolated which completely lacks ribothymidine (rT) and contains an unmodified uridine in its place. We discuss here the isolation, identification and properties of these tRNAs. The rT-lacking tRNAs of wheat germ are essentially limited to the glycine isoacceptors (a minimum of five identifiable species), three threonine and at least, one tyrosine tRNA. All tRNAs were obtained 70-100% pure by chromatographic methods, and were detected by their ability to be methylated by E. coli rT-forming uracil methyltransferase with methyl-labeled S-adenosyl-L-methionine (SAM) as the methyl donor. In vitro methylation of each of the tRNAs resulted in the formation of 1 mole of rT per mole of tRNA. In the one case analyzed in detail (tRNA1Gly), all of the rT was found to be located at the 23rd position from the 3' end of the tRNA molecule. Following complete digestion of four highly purified glycine isoacceptors (tRNAGly1,4,5,6) to nucleosides and subsequent periodate oxidation and 3H potassium borohydride reduction, all were found to contain an unusually high level of 5-methylcytidine (m5C) (3-4 residues per molecule), and all contained no rT. The possible correlation between the presence of m5C and the absence of rT is discussed. All of the chromatographically purified glycine tRNAs function in a wheat germ cell-free protein synthesizing system and polymerize glycine in response to either poly G or poly (G, U).     

Conservation of the relative tRNA composition in healthy and cancerous tissues

Elongation in protein translation is strongly dependent on the availability of mature transfer RNAs (tRNAs). The relative concentrations of the tRNA isoacceptors determine the translation efficiency in unicellular organisms. However, the degree of correspondence of codons and the relevant tRNA isoacceptors serves as an estimator for translation efficiency in all organisms. In this study, we focus on the translational capacity of the human proteome. We show that the correspondence between the codon usage and tRNAs can be improved by combining experimental measurements with the genomic copy number of isoacceptor groups. We show that there are technologies of tRNA measurements that are useful for our analysis. However, fragments of tRNAs do not agree with translational capacity. It was shown that there is a significant increase in the absolute levels of tRNA genes in cancerous cells in comparison to healthy cells. However, we find that the relative composition of tRNA isoacceptors in healthy, cancerous, or transformed cells remains almost identical. This result may indicate that maintaining the relative tRNA composition in cancerous cells is advantageous via its stabilizing of the effectiveness of translation.     

Patterns of E. coli leucine tRNA isoacceptors following bacteriophage MS2 infection.

The RNA extracted from MS2 phage particles can accept radioactive leucine and serine in the presence of tRNA activating enzymes. Leucine acceptance is due to the presence of E. coli leucine tRNA that binds very tightly to the virus particle. RPC-5 column chromatography shows that the pattern of virus associated leucyl-tRNA isoacceptors is different from that of normal E. coli leucyl-tRNA. It is also different from the pattern of host leucyl-tRNA isoacceptors found in E. coli lysate following MS2 phage infection. The RPC-5 pattern of the latter tRNA shows several new peaks of leucine tRNA isoacceptors. The possibility that these tRNAs are some modified forms of normal leucine tRNA isoacceptors is suggested.     

Over expression of a tRNA(Leu) isoacceptor changes charging pattern of leucine tRNAs and reveals new codon reading

During mRNA translation, synonymous codons for one amino acid are often read by different isoaccepting tRNAs. The theory of selective tRNA charging predicts greatly varying percentages of aminoacylation among isoacceptors in cells starved for their common amino acid. It also predicts major changes in tRNA charging patterns upon concentration changes of single isoacceptors, which suggests a novel type of translational control of gene expression. We therefore tested the theory by measuring with Northern blots the charging of Leu-tRNAs in Escherichia coli under Leu limitation in response to over expression of tRNA(GAG)(Leu). As predicted, the charged level of tRNA(GAG)(Leu) increased and the charged levels of four other Leu isoacceptors decreased or remained unchanged, but the charged level of tRNA(UAG)(Leu) increased unexpectedly. To remove this apparent inconsistency between theory and experiment we postulated a previously unknown common codon for tRNA(GAG)(Leu) and tRNA(UAG)(Leu). Subsequently, we demonstrated that the tRNA(GAG)(Leu) codon CUU is, in fact, read also by tRNA(UAG)(Leu), due to a uridine-5-oxyacetic acid modification.     

The Enzymatic Paradox of Yeast Arginyl-tRNA Synthetase: Exclusive Arginine Transfer Controlled by a Flexible Mechanism of tRNA Recognition

Identity determinants are essential for the accurate recognition of transfer RNAs by aminoacyl-tRNA synthetases. To date, arginine determinants in the yeast Saccharomyces cerevisiae have been identified exclusively in vitro and only on a limited number of tRNA Arginine isoacceptors. In the current study, we favor a full cellular approach and expand the investigation of arginine determinants to all four tRNA Arg isoacceptors. More precisely, this work scrutinizes the relevance of the tRNA nucleotides at position 20, 35 and 36 in the yeast arginylation reaction. We built 21 mutants by site-directed mutagenesis and tested their functionality in YAL5, a previously engineered yeast knockout deficient for the expression of tRNA Arg CCG. Arginylation levels were also monitored using Northern blot. Our data collected in vivo correlate with previous observations. C35 is the prominent arginine determinant followed by G36 or U36 (G/U36). In addition, although there is no major arginine determinant in the D loop, the recognition of tRNA Arg ICG relies to some extent on the nucleotide at position 20. This work refines the existing model for tRNA Arg recognition. Our observations indicate that yeast Arginyl-tRNA synthetase (yArgRS) relies on distinct mechanisms to aminoacylate the four isoacceptors. Finally, according to our refined model, yArgRS is able to accommodate tRNA Arg scaffolds presenting N34, C/G35 and G/A/U36 anticodons while maintaining specificity. We discuss the mechanistic and potential physiological implications of these findings.     

Exon-intron organization of the human gp130 gene

The exon-intron organization and sequences of the exon-intron boundaries of the human gp130 transmembrane receptor gene have been determined using genomic DNAs as samples. The gp130 gene comprises 17 exons and 16 introns. The positions of the exon-intron boundaries show good correlation to the functional/homology regions of gp130. Exons 3-17 code for the gp130 protein, and each subdomain of the receptor is encoded by a set of exons. The coding potential of exons and the intron phasing of the human gp130 gene conform to the patterns observed previously for other cytokine receptor genes. This supports the notions that the gp130 gene evolved from the same ancestral gene that gave rise to other members of the cytokine receptor family.     

Two drosophila melanogaster tRNAGly genes are contained in a direct duplication at chromosomal locus 56F.

One Drosophila melanogaster tRNAGly gene occurs on each 1.1-2.0 kb unit of a direct duplication at chromosomal region 56F. The nucleotide sequence of the gene and the 5' flanking region has been determined. The non-transcribed strand sequence of the tRNA gene is: 5' GCATCGGTGGTTCAGTGGTAGAATGCTCGCCTGCCACGCGGGCGGCCCGGGTTCGATTCCCGGCCGATGCA 3'. This nucleotide sequence is identical to that of the major glycine tRNA in Bombyx mori posterior silk gland. Within the 22 kb region mapped, additional tRNA genes are found, an observation consistent with reports that genes for other isoacceptors are present at this locus.     

In vivo processing of an intron-containing archael tRNA

In vitro studies on the processing of halobacterial tRNA introns have led to the proposal that archaeal and eukaryotic tRNA intron endonucleases have distinctly different requirements for the recognition of pre-tRNAs. Using a Haloferax volcanii in vivo expression vector we have examined the in vivo processing of modified forms of the halobacterial intron-containing tRNA_Trp gene. As observed in vitro, changes in the exon–intron boundary structure of this pre-tRNA block processing. Intron sequences, other than those at the exon–intron boundaries, are not essential for processing in vivo. We also show that conversion of the tryptophan anticodon to an opal suppressor anticodon is tolerated when the exon-intron boundary structure is maintained.