Intramolecular folding of a fragment of the cytosine-rich strand of telomeric DNA into an i-motif.

In the recently discovered i-motif, four stretches of cytosine form two parallel-stranded duplexes whose C.C+ base pairs are fully intercalated. The i-motif may be recognized by characteristic Overhauser cross-peaks of the proton NMR spectrum, reflecting short H1'-H1' distances across the minor groove, and short internucleotide amino-proton-H2'/H2" across the major groove. We report the observation of such cross-peaks in the spectra of a fragment of the C-rich telomeric strand of vertebrates, d[CCCTAA]3CCC. The spectra also demonstrate that the cytosines are base-paired and that proton exchange is very slow, as reported previously for the i-motif. From UV absorbance and gel chromatography measurements, we assign these properties to an i-motif which includes all or nearly all the cytosines, and which is formed by intramolecular folding at slightly acid or neutral pH. A fragment of telomeric DNA of Tetrahymena, d[CCCCAA]3CCCC, has the same properties. Hence four consecutive C stretches of a C-rich telomeric strand can fold into an i-motif. Hypothetically, this could occur in vivo.     

Disordering of human telomeric G-quadruplex with novel antiproliferative anthrathiophenedione

Linear heteroareneanthracenediones have been shown to interfere with DNA functions, thereby causing death of human tumor cells and their drug resistant counterparts. Here we report the interaction of our novel antiproliferative agent 4,11-bis[(2-{[acetimido]amino}ethyl)amino]anthra[2,3-b]thiophene-5,10-dione with telomeric DNA structures studied by isothermal titration calorimetry, circular dichroism and UV absorption spectroscopy. New compound demonstrated a high affinity (K_ass∼10⁶ M⁻¹) for human telomeric antiparallel quadruplex d(TTAGGG)₄ and duplex d(TTAGGG)₄∶d(CCCTAA)₄. Importantly, a ∼100-fold higher affinity was determined for the ligand binding to an unordered oligonucleotide d(TTAGGG TTAGAG TTAGGG TTAGGG unable to form quadruplex structures. Moreover, in the presence of Na⁺ the compound caused dramatic conformational perturbation of the telomeric G-quadruplex, namely, almost complete disordering of G-quartets. Disorganization of a portion of G-quartets in the presence of K⁺ was also detected. Molecular dynamics simulations were performed to illustrate how the binding of one molecule of the ligand might disrupt the G-quartet adjacent to the diagonal loop of telomeric G-quadruplex. Our results provide evidence for a non-trivial mode of alteration of G-quadruplex structure by tentative antiproliferative drugs.     

Human telomeric G-quadruplex formed from duplex under near physiological conditions: Spectroscopic evidence and kinetics

The structural interconversion between the G-quadruplex and duplex in vivo is an important subject. In the present study, we used human telomeric DNA duplex composed of GGG(TTAGGG)₃/CCC(TAACCC)₃ as a model system to investigate its properties under near physiological conditions by spectroscopic methods. Circular dichroism and fluorescence spectra demonstrated that G-quadruplex structure can be formed from duplex at near physiological pH (pH 7.4), salt concentration (150 mM K⁺), and temperature (37 °C) in the presence of molecular crowding agent PEG (400 g/l), whereas the G-quadruplex structure cannot be formed at 25 °C in buffer containing 150 mM K⁺ in the presence of PEG. It is found that the formation rate of G-quadruplex structure depends on the temperature and the concentrations of both PEG and K⁺. This work suggests that human telomeric G-quadruplex structure may be potentially formed from Watson–Crick duplex in vivo.     

In vitro properties of the conserved mammalian protein hnRNP D suggest a role in telomere maintenance

Mammalian chromosomes terminate with a 3' tail which consists of reiterations of the G-rich repeat, d(TTAGGG). The telomeric tail is the primer for replication by telomerase, and it may also invade telomeric duplex DNA to form terminal lariat structures, or T loops. Here we show that the ubiquitous and highly conserved mammalian protein hnRNP D interacts specifically with the G-rich strand of the telomeric repeat. A single gene encodes multiple isoforms of hnRNP D. All isoforms bind comparably to the G-rich strand, and certain isoforms can also bind tightly and specifically to the C-rich telomeric strand. G-rich telomeric sequences readily form structures stabilized by G-G pairing, which can interfere with telomere replication by telomerase. We show that hnRNP D binding to the G-rich strand destabilizes intrastrand G-G pairing and that hnRNP D interacts specifically with telomerase in human cell extracts. This biochemical analysis suggest that hnRNP D could function in vivo to destabilize structures formed by telomeric G-rich tails and facilitate their extension by telomerase.     

The effect of the TRF2 N-terminal and TRFH regions on telomeric G-quadruplex structures

The sequence of human telomeric DNA consists of tandem repeats of 5′-d(TTAGGG)-3′. This guanine-rich DNA can form G-quadruplex secondary structures which may affect telomere maintenance. A current model for telomere protection by the telomere-binding protein, TRF2, involves the formation of a t-loop which is stabilized by a strand invasion-like reaction. This type of reaction may be affected by G-quadruplex structures. We analyzed the influence of the arginine-rich, TRF2 N-terminus (TRF2^B), as well as this region plus the TRFH domain of TRF2 (TRF2^BH), on the structure of G-quadruplexes. Circular dichroism results suggest that oligonucleotides with 4, 7 and 8 5′-d(TTAGGG)-3′ repeats form hybrid structures, a mix of parallel/antiparallel strand orientation, in K⁺. TRF2^B stimulated the formation of parallel-stranded structures and, in some cases, intermolecular structures. TRF2^BH also stimulated intermolecular but not parallel-stranded structures. Only full-length TRF2 and TRF2^BH stimulated uptake of a telomeric single-stranded oligonucleotide into a plasmid containing telomeric DNA in the presence of K⁺. The results in this study suggest that G-quadruplex formation inhibits oligonucleotide uptake into the plasmid, but the inhibition can be overcome by TRF2. This study is the first analysis of the effects of TRF2 domains on G-quadruplex structures and has implications for the role of G-quadruplexes and TRF2 in the formation of t-loops.     

Telomeric repeat mutagenicity in human somatic cells is modulated by repeat orientation and G-quadruplex stability

Telomeres consisting of tandem guanine-rich repeats can form secondary DNA structures called G-quadruplexes that represent potential targets for DNA repair enzymes. While G-quadruplexes interfere with DNA synthesis in vitro, the impact of G-quadruplex formation on telomeric repeat replication in human cells is not clear. We investigated the mutagenicity of telomeric repeats as a function of G-quadruplex folding opportunity and thermal stability using a shuttle vector mutagenesis assay. Since single-stranded DNA during lagging strand replication increases the opportunity for G-quadruplex folding, we tested vectors with G-rich sequences on the lagging versus the leading strand. Contrary to our prediction, vectors containing human [TTAGGG]₁₀ repeats with a G-rich lagging strand were significantly less mutagenic than vectors with a G-rich leading strand, after replication in normal human cells. We show by UV melting experiments that G-quadruplexes from ciliates [TTGGGG]₄ and [TTTTGGGG]₄ are thermally more stable compared to human [TTAGGG]₄. Consistent with this, replication of vectors with ciliate [TTGGGG]₁₀ repeats yielded a 3-fold higher mutant rate compared to the human [TTAGGG]₁₀ vectors. Furthermore, we observed significantly more mutagenic events in the ciliate repeats compared to the human repeats. Our data demonstrate that increased G-quadruplex opportunity (repeat orientation) in human telomeric repeats decreased mutagenicity, while increased thermal stability of telomeric G-quadruplexes was associated with increased mutagenicity.     

5,10,15,20-Tetra-(N-methyl-3-pyridyl)porphyrin destabilizes the anti-parallel telomeric quadruplex d(TTAGGG)4

We studied the parameters of binding of 5,10,15,20-tetra-(N-methyl-3-pyridyl)porphyrin (TMPyP3) to the anti-parallel human telomeric G-quadruplex d(TTAGGG)4, the oligonucleotide dTTAGGGTTAGAG(TTAGGG)2 that does not form a quadruplex structure, as well as to the double stranded d(AC)8 x d(GT) and single stranded d(AC)8 and d(GT)8 DNAs. The analysis of absorption revealed that the binding constants and the number of DNA binding sites for TMPyP3 were d(AC)8 < d(GT)8 < d(AC)8 x d(GT)8 = d(TTAGGG)4 < dTTAGGGTTAGAG(TTAGGG)2. We demonstrated for the first time that the binding constant of TMPyP3 with the non-quadruplex chain dTTAGGGTTAGAG(TTAGGG)2 (1.3 x 10(7) M(-1)) is approximately 3 times bigger than the binding constant with the quadruplex d(TTAGGG)4 (4.6 x 10(6) M(-1)). Binding of two TMPyP3 molecules to d(TTAGGG)4 led to a decrease of thermostability of the G-quadruplex (deltaT(m) = -8 degrees C). Circular dichroism spectra of TMPyP3:d(TTAGGG)4 complexes revealed a shift of DNA structure from the G-quadruplex to an irregular chain. We hypothesize that partial destabilization of the telomeric G-quadruplex by TMPyP3 might be a reason for relatively low potency of this ligand as a telomerase inhibitor, as well as its marginal cytotoxicity for cultured tumor cells.     

Formation of the G-quadruplex and i-motif structures in retinoblastoma susceptibility genes (Rb)

The formation of G-quadruplex and i-motif structures in the 5′ end of the retinoblastoma (Rb) gene was examined using chemical modifications, circular dichroism (CD) and fluorescence spectroscopy. It was found that substitutions of 8-methylguanine at positions that show syn conformations in antiparallel G-quadruplexes stabilize the structure in the G-rich strand. The complementary C-rich 18mer forms an i-motif structure, as suggested by CD spectroscopy. Based on the C to T mutation experiments, C bases participated in the C–C⁺ base pair of the i-motif structure were determined. Experiments of 2-aminopurine (2-AP) substitution reveal that an increase of fluorescence in the G-quadruplex relative to duplex is attributed to unstacked 2-AP within the loop of G-quadruplex. The fluorescence experiments suggest that formation of the G-quadruplex and i-motif can compete with duplex formation. Furthermore, a polymerase arrest assay indicated that formation the G-quadruplex structure in the Rb gene acts as a barrier in DNA synthesis.     

Cationic porphyrins promote the formation of i-motif DNA and bind peripherally by a nonintercalative mechanism

Telomeric C-rich strands can form a noncanonical intercalated DNA structure known as an i-motif. We have studied the interactions of the cationic porphyrin 5,10,15,20-tetra-(N-methyl-4-pyridyl)porphine (TMPyP4) with the i-motif forms of several oligonucleotides containing telomeric sequences. TMPyP4 was found to promote the formation of the i-motif DNA structure. On the basis of (1)H NMR studies, we have created a model of the i-motif-TMPyP4 complex that is consistent with all the available experimental data. Two-dimensional NOESY data prompted us to conclude that TMPyP4 binds specifically to the edge of the intercalated DNA core by a nonintercalative mechanism. Since we have shown that TMPyP4 binds to and stabilizes the G-quadruplex form of the complementary G-rich telomeric strand, this study raises the intriguing possibility that TMPyP4 can trigger the formation of unusual DNA structures in both strands of the telomeres, which may in turn explain the recently documented biological effects of TMPyP4 in cancer cells.     

Protection of DNA ends by telomeric 3' G-tail sequences

The extreme ends of eukaryotic chromosomes contain 3' extensions in the form of single-stranded G-rich repeats, referred to as telomeric 3' G-tails or overhangs. Increasing evidence has suggested that telomeric 3' G-tails can adopt a G-quadruplex conformation both in vitro and in vivo. However, the role of G-quadruplexes on the structure and function of telomeric 3' G-tails remains unclear. In the current study, we showed that the human telomeric 3' G-tail sequence protected the duplex DNA ends in cis from being recognized as double strand breaks. This protection is dependent on the G-quadruplex conformation of the 3' G-tail sequence. These results suggest that the ability of telomeric 3' G-tails to adopt the endprotecting G-quadruplex conformation may be one of the reasons for the existence of the evolutionarily conserved G-stretch motifs in telomeric DNA sequences.     

5,10,15,20-Tetra-(N-methyl-3-pyridyl)porphyrin destabilizes the antiparallel telomeric quadruplex d(TTAGGG)<Subscript>4</Subscript>

5,10,15,20-Tetra-(N-methyl-3-pyridyl)porphyrin (TMPyP3) is a DNA-binding derivative of porphyrins. A comparative study of the binding of this ligand to biologically significant DNA structures was performed. For this purpose, the interactions of TMPyP3 with the antiparallel telomeric G-quadruplex d(TTAGGG)₄, oligonucleotide dTTAGGGTTAGAG(TTAGGG)₂ (not forming a quadruplex structure), double-stranded d(AC)₈ · d(GT)₈, and single-stranded d(AC)₈ and d(GT)₈ DNA molecules have been studied. Analysis of absorption isotherms has demonstrated that the binding constants and the number of binding sites for the complexes TMPyP3: DNA increase in the following order: d(AC)₈ < d(GT)₈ < d(AC)₈ · d(GT)₈ = d(TTAGGG)₄ < dTTAGGGTTAGAG(TTAGGG)₂. It has been for the first time demonstrated that the constant for TMPyP3 binding to unfolded dTTAGGGTTAGAG(TTAGGG)₂ strand (1.3 × 10⁷ M⁻¹) is approximately threefold higher than for the G-quadruplex d(TTAGGG)₄ (4.7 × 10⁶ M⁻¹). Binding of two TMPyP3 molecules to d(TTAGGG)₄ decreases the thermostability of G-quadruplex (ΔT_m = −8°C). Circular dichroism spectra of the TMPyP3 complexes with d(TTAGGG)₄ suggest that the ligand partially unfolds the G-quadruplex structure. Structural destabilization of the telomeric G-quadruplex by TMPyP3 can explain the relatively low activity of this ligand as a telomerase inhibitor and a low cytotoxicity for cultured tumor cells.     

Sequence specificity of inter- and intramolecular G-quadruplex formation by human telomeric DNA

Human telomeric DNA consists of tandem repeats of the sequence 5'-d(TTAGGG)-3'. Guanine-rich DNA, such as that seen at telomeres, forms G-quadruplex secondary structures. Alternative forms of G-quadruplex structures can have differential effects on activities involved in telomere maintenance. With this in mind, we analyzed the effect of sequence and length of human telomeric DNA on G-quadruplex structures by native polyacrylamide gel electrophoresis and circular dichroism. Telomeric oligonucleotides shorter than four, 5'-d(TTAGGG)-3' repeats formed intermolecular G-quadruplexes. However, longer telomeric repeats formed intramolecular structures. Altering the 5'-d(TTAGGG)-3' to 5'-d(TTAGAG)-3' in any one of the repeats of 5'-d(TTAGGG)(4)-3' converted an intramolecular structure to intermolecular G-quadruplexes with varying degrees of parallel or anti-parallel-stranded character, depending on the length of incubation time and DNA sequence. These structures were most abundant in K(+)-containing buffers. Higher-order structures that exhibited ladders on polyacrylamide gels were observed only for oligonucleotides with the first telomeric repeat altered. Altering the sequence of 5'-d(TTAGGG)(8)-3' did not result in the substantial formation of intermolecular structures even when the oligonucleotide lacked four consecutive telomeric repeats. However, many of these intramolecular structures shared common features with intermolecular structures formed by the shorter oligonucleotides. The wide variability in structure formed by human telomeric sequence suggests that telomeric DNA structure can be easily modulated by proteins, oxidative damage, or point mutations resulting in conversion from one form of G-quadruplex to another.     

Duplex and quadruplex DNA binding and photocleavage by trioxatriangulenium ion

The stable trioxatriangulenium ion (TOTA) has previously been shown to bind to and photooxidize duplex DNA, leading to cleavage at G residues, particularly 5'-GG-3' repeats. Telomeric DNA consists of G-rich sequences that may exist in either duplex or G-quadruplex forms. We have employed electrospray ionization mass spectrometry (ESI-MS) to investigate the interactions between TOTA and duplex DNA or G-quadruplex DNA. A variety of duplex decamer oligodeoxynucleotides form complexes with TOTA that can be detected by ESI-MS, and the stoichiometry and fragmentation patterns observed are commensurate with an intercalative binding mode. TOTA also forms complexes with four-stranded and hairpin-dimer G-quadruplex oligodeoxynucleotides that can be detected by ESI-MS. Both the stoichiometry and the fragmentation patterns observed by ESI-MS are different than those observed for G-tetrad end-stacking binding ligands. We have carried out (1)H NMR titrations of a four-stranded G-quadruplex in the presence of TOTA. Addition of up to 1 equiv of TOTA is accompanied by pronounced upfield shifts of the G-tetrad imino proton resonances in the NMR, which is similar to the effect observed for G-tetrad end-stacking ligands. At higher ratios of added TOTA, there is evidence for additional binding modes. Duplex DNA containing either human telomeric repeats (T(2)AG(3))(4) or the Tetrahymena telomeric repeats (T(2)G(4))(4) are readily photooxidized by TOTA, the major sites of oxidation being the central guanine residues in each telomeric repeat. These telomeric repeats were incorporated into duplex/quadruplex chimeras in which the repeats adopt a G-quadruplex structure. Analysis by denaturing polyacrylamide gel electrophoresis reveals significantly less TOTA photocleavage of these quadruplex telomeric repeats when compared to the duplex repeats.     

Structural polymorphism of telomeric DNA regulated by pH and divalent cation

DNA oligonucleotides can form multi-stranded structures such as a duplex, triplex, and quadruplex, while the double helical structure is generally considered as the canonical structure of DNA oligonucleotides. Guanine-rich or cytosine-rich oligonucleotides, which are observed in telomere, centromere, and other biologically important sequences in vivo, can form four-stranded G-quadruplex and I-motif structures in vitro. In this study, we have investigated the effects of pH and cation on the structures and their stabilities of d(G4T4G4) and d(C4A4C4). The CD spectra and thermal melting curves of DNAs at various pHs demonstrated that acidic conditions induced a stable I-motif structure of d(C4A4C4), while the pH value did not affect the G-quadruplex structure and stability of d(G4T4G4). The CD spectra of the 1:1 mixture of d(G4T4G4) and d(C4A4C4) indicated that the acidic conditions inhibit the duplex formation between d(G4T4G4) and d(C4A4C4). Isothermal titration calorimetry measurements of the duplex formation at various pHs also quantitatively indicated that the acidic conditions inhibit the duplex formation. On the other hand, the CD spectra and thermal melting curves of DNAs in the absence and presence of Ca2+ indicated that Ca2+ induces a parallel G-quadruplex structure of d(G4T4G4) and then inhibits the duplex formation. These results lead to the conclusion that both the pH and coexisting cation can induce and regulate the structural polymorphisms the oligonucleotides in which they form the G-quadruplex, I-motif, and duplex depending on the conditions. Thus, the results reported here indicate pivotal roles of pH and coexisting cations in biological processes by regulating the conformational switching between the duplex and quadruplexes structures of the guanine-rich or cytosine-rich oligonucleotides in vivo.     

Polymorphism of human telomeric quadruplex structures

Human telomeric DNA consists of tandem repeats of the sequence d(TTAGGG). Compounds that can stabilize the intramolecular DNA G-quadruplexes formed in the human telomeric sequence have been shown to inhibit the activity of telomerase and telomere maintenance, thus the telomeric DNA G-quadruplex has been considered as an attractive target for cancer therapeutic intervention. Knowledge of intramolecular human telomeric G-quadruplex structure(s) formed under physiological conditions is important for structure-based rational drug design and thus has been the subject of intense investigation. This review will give an overview of recent progress on the intramolecular human telomeric G-quadruplex structures formed in K(+) solution. It will also give insight into the structure polymorphism of human telomeric sequences and its implications for drug targeting.     

Evidence for a HeLa nuclear protein that binds specifically to the single-stranded d(CCCTAA)n telomeric motif.

In recent years several telomere binding proteins from eukaryotic organisms have been identified that are able to recognise specifically the duplex telomeric DNA repeat or the G-rich 3'-ending single strand. In this paper we present experimental evidence that HeLa nuclear extracts contain a protein that binds with high specificity to the single-stranded complementary d(CCCTAA)n repeat. Electrophoretic mobility shift assays show that the oligonucleotide d(CCCTAACCCTAACCCTAACCCT) forms a stable complex with this protein in the presence of up to 1000-fold excesses of single-stranded DNA and RNA competitors, but is prevented from doing so in the presence of its complementary strand. SDS-PAGE experiments after UV cross-linking of the complex provide an estimate of 50 kDa for the molecular weight of this protein.     

A comparative study on the interaction of acridine and synthetic bis-acridine with G-quadruplex structure

DNA from the telomeres contains a stretch of simple tandemly repeated sequences in which clusters of G residues alternate with clusters of T/A sequences along one DNA strand. Model telomeric G-clusters form four-stranded structures in presence of Na(I), K(I) and NH(4)(I) ions. Electrophoretic and spectroscopic studies were made with the telomeric related sequences d(T6G16) or d(G4T2G4T2G4T2G4). It was noticed earlier that G-quadruplex may either be inter-molecular, or intra-molecular, or a mixture of both. CD spectral characteristics of various G-quadruplex DNA suggests that the CD maximum at 293 nm corresponds to that of an intra-molecular G-quadruplex structure or hairpin dimers. Fluorescence titration studies also show that acridine and the bis-acridine are interacting with G-quadruplex DNA and destabilize the K(I)-quadruplex structure more efficiently than the quadruplex formed by NH(4)(I) ion. Among the two drugs studied, acridine is more capable of breaking the G-quadruplex structure than bis-acridine. This result is further confirmed by the CD experiments.     

t-loops at trypanosome telomeres

Mammalian telomeres form large duplex loops (t-loops) that may sequester chromosome ends by invasion of the 3' TTAGGG overhang into the duplex TTAGGG repeat array. Here we document t-loops in Trypanosoma brucei, a kinetoplastid protozoan with abundant telomeres due to the presence of many minichromosomes. These telomeres contained 10-20 kb duplex TTAGGG repeats and a 3' TTAGGG overhang. Electron microscopy of psoralen/UV cross-linked DNA revealed t-loops in enriched telomeric restriction fragments and at the ends of isolated minichromosomes. In mammals, t-loops are large (up to 25 kb), often comprising most of the telomere. Despite similar telomere lengths, trypanosome t-loops were much smaller (approximately 1 kb), indicating that t-loop sizes are regulated. Coating of non-cross-linked minichromosomes with Escherichia coli single-strand binding protein (SSB) often revealed 3' overhangs at both telomeres and several cross-linked minichromosomes had t-loops at both ends. These results suggest that t-loops and their prerequisite 3' tails can be formed on the products of both leading and lagging strand synthesis. We conclude that t-loops are a conserved feature of eukaryotic telomeres.     

Structure of a C-rich strand fragment of the human centromeric satellite III: a pH-dependent intercalation topology

Repetitive DNA sequences may adopt unusual pairing arrangements. At acid to neutral pH, cytidine-rich DNA oligodeoxynucleotides can form the i-motif structure in which two parallel-stranded duplexes with C.C(+) pairs are intercalated head-to-tail. The i-motif may be formed by multimeric associations or by intra-molecular folding, depending on the number of cytidine tracts, the nucleotide sequences between them, and the experimental conditions.We have found that a natural fragment of the human centromeric satellite III, d(CCATTCCATTCCTTTCC), can form two monomeric i-motif structures that differ in their intercalation topology and that are favored at pH values higher (the eta-form) and lower (the lambda-form) than 4.6. The change in intercalation may be related to adenine protonation in the loops.We studied the uridine derivative methylated on the first cytidine base, d(5mCCATTCCAUTCCUTTCC), whose proton spectrum is better resolved. The intercalation topologies are (C7.C17)/(5mC1.C11)/(C6.C16)/(C2.C12) for form lambda and (5mC1.C11)/(C7.C17)/(C2.C12)/(C6.C16) for form eta. We have solved the structure of the eta-form, and we present a model for the lambda-form. The switch from eta to lambda involves disruption of the i-motif. In both forms, the central AUT linker crosses the wide groove, and the first and the third linkers loop across the minor grooves. The i-motif core is extended in the eta-form by the inter-loop reverse Watson-Crick A3.U13 pair, whose dissociation constant is around 10(-2) at 0 degrees C, and in the lambda-form by the interloop T5.T15 pair.In contrast, d(5mCCATTCCTTACCTTTCC) folds into a pH-independent structure that has the same intercalation topology as the lambda-form. The i-motif core is extended below by the interloop T5.T15 pair and closed on top by the T8.A10 pair.Thus, the C-rich strand of the human satellite III tandem repeats, like the G-rich strand, can fold into various compact structures. The relevance of these features to centromeric function remains unknown.