Energetic and structural aspects of ethidium cation intercalation into DNA minihelices

The enthalpy ΔH for the intercalation of the ethidium cation (EC) into DNA minihelices can be decomposed into (1) an energy of conformational adjustment (i.e., the energy of minihelix extension and unwinding from the B-form to the intercalated form) and (2) EC minihelix intermolecular interactions. In the present study, we have focused our attention mainly on a decomposition of the energetic factors of the EC minihelix intermolecular interactions, while the essential features of the energy of conformational adjustment have been discussed in detail elsewhere by us. The structural features of the various resulting energy-minimized EC-intercalated complexes are compared with each other and the initial x-ray model structure. ΔH is estimated to be in the range of ?12.3 to ?24.0 kcal/mol. This theoretical estimate is qualitatively and quantitatively in agreement with a variety of available experimental data. The energy of conformational adjustment is an energetically unfavorable step, while the energetically favorable contribution of the EC minihelix intermolecular interactions is responsible for the overall favorable nature of the intercalation process involving the EC. On the other hand, the observed preference for intercalation into Pyr(3′–5′)Pur DNA sequences over their isomeric Pur(3′–5′)Pyr sequences is controlled by the energy of conformational adjustment and not by the EC minihelix intermolecular interaction contribution. No base-composition effect is expected at EC concentrations normally found at cellular conditions. Moreover, the structural features of the various EC-intercalated complexes are very similar regardless of minihelix base sequence or composition. These results compare favorably with available evidence. The nature of biologically preferred sites of EC binding with the minihelices is discussed.     

Structure of the B DNA cationic shell as revealed by an X-ray diffraction study of CsDNA. Sequence-specific cationic stabilization of B form DNA

Synchrotron radiation diffraction data for phage T2 CsDNA fibres have been used to determine the co-ordinates of the caesium ions in crystalline B form DNA. The R value is 0.16 for an optimized structure. The caesium ions are distributed equally between the narrow and wide grooves of B DNA and are located close to the dyad axes lying between the planes of adjacent base-pairs. On the wide-groove side the cations are separated from the nearest phosphate atoms by a hydration layer one to two water molecules thick. In the narrow groove the cations are directly co-ordinated to the base atoms and, for six out of ten possible DNA stacking types, form chelation complexes: O-2(Pyr)-Cs+-O-2(Pyr), O-2(Pyr)-Cs+-N-3(Pur) or N-3(Pur)-Cs+-N-3(Pur), which stabilize the B conformation. The steric properties of such complexes as estimated for different base sequences and for different ions are consistent with the structural behaviour of double-helical polynucleotides with different base sequences, as experimentally observed.     

Central non-Pur.Pyr sequences in oligo(dG.dC) tracts and metal ions influence the formation of intramolecular DNA triplex isomers.

The effect of the central non-Pur.Pyr sequences in oligo(dG.dC) inserts on determining the type of intramolecular DNA triplex isomers formed in negatively supercoiled plasmids was investigated. Different triplex types (H-r3, H-r5, and H-y3), revealed by a combination of chemical probing and Maxam-Gilbert sequencing reactions, were adopted by the oligo(dG.dC) tracts depending on the length and composition of the central non-Pur.Pyr sequences (0, 3, or 5 base pairs) and the kind of metal ions. The H-r3 triplex conformer, one isomer of a Pur.Pur.Pyr structure, was formed in the (C)20 and (C)10GCG(C)10 inserts in plasmids in the presence of certain metal ions. Interestingly, H-r5, the other isomer of the Pur.Pur-Pyr triplex which had not been detected previously, was formed in a (C)9GAATT(C)9 insert in the presence of either Mg2+ or Ca2+. Alternatively, H-y3, one isomer of a Pyr.Pur.Pyr triplex, was formed in the (C)9GAATT(C)9 insert in the absence of metal ions. Thus, central non-Pur.Pyr sequences and metal ions play a role as determinants of the types of intramolecular triplexes formed; they also reduce the requirement of longer Pur.Pyr repeat sequences to form intramolecular triplexes. Furthermore, the effects of MgCl2 concentration and pH on the formation of triplex isomers were examined. The Pur.Pur.Pyr conformations (H-r3 and H-r5) may be the favored conformations in the cellular milieu, since they are stable at physiological pH and metal ion concentration.     

The role of molecular structure of sugar‐phosphate backbone and nucleic acid bases in the formation of single‐stranded and double‐stranded DNA structures

Our previous DFT computations of deoxydinucleoside monophosphate complexes with Na⁺‐ions (dDMPs) have demonstrated that the main characteristics of Watson‐Crick (WC) right‐handed duplex families are predefined in the local energy minima of dDMPs. In this work, we study the mechanisms of contribution of chemically monotonous sugar‐phosphate backbone and the bases into the double helix irregularity. Geometry optimization of sugar‐phosphate backbone produces energy minima matching the WC DNA conformations. Studying the conformational variability of dDMPs in response to sequence permutation, we found that simple replacement of bases in the previously fully optimized dDMPs, e.g. by constructing Pyr‐Pur from Pur‐Pyr, and Pur‐Pyr from Pyr‐Pur sequences, while retaining the backbone geometry, automatically produces the mutual base position characteristic of the target sequence. Based on that, we infer that the directionality and the preferable regions of the sugar‐phosphate torsions, combined with the difference of purines from pyrimidines in ring shape, determines the sequence dependence of the structure of WC DNA. No such sequence dependence exists in dDMPs corresponding to other DNA conformations (e.g., Z‐family and Hoogsteen duplexes). Unlike other duplexes, WC helix is unique by its ability to match the local energy minima of the free single strand to the preferable conformations of the duplex. © 2013 Wiley Periodicals, Inc. Biopolymers 101: 640–650, 2014.     

Fluorescence-determined preferential binding of quinacrine to DNA.

Quinacrine complexes with native DNA (Calf thymus, Micrococcus lysodeikticus, Escherichia coli, Bacillus subtilis, and Colstridium perfringens) and synthetic polynucleotides (poly(dA) . poly(dT), poly[d(A-T)] . poly[d(A-T)], poly(dG) . poly(dC) and poly[d(G-C)] . poly[d(G-C)]) has been investigated in solution at 0.1 M NaCl, 0.05 M Tris HCl, 0.001 M EDTA, pH 7.5, at 20 degrees C. Fluorescence excitation spectra of complexes with dye concentration D = 5-30 microM and DNA phosphate concentration P = 400 microM have been examined from 300 to 500 nm, while collecting the emission above 520 nm. The amounts of free and bound quinacrine in the dye-DNA complexes have been determined by means of equilibrium dialysis experiments. Different affinities have been found for the various DNAs and their values have been examined with a model that assumes that the binding constants associated with alternating purine and pyrimidine sequences are larger than those relative to nonalternating ones. Among the alternating nearest neighbor base sequences, the Pyr(3'-5')Pur sequences, i.e., C-G, T-G, C-A and T-A seem to bind quinacrine stronger than the remaining sequences. In particular the three sites, where a G . C base pair is involved, are found to display higher affinities. Good agreement is found with recent calculations on the energetics of intercalation sites in DNA. The analysis of the equilibrium shows also that the strength of the excitation spectrum of bound dye depends strongly upon the ratio of bound quinacrine to DNA. This effect can be attributed to dye-dye energy transfer along DNA.     

Nodule DNA in the (GA)37.(CT)37 insert in superhelical plasmids.

Di- or trivalent metal ions stabilize a supercoil-dependent transition in pGA37, which contains the (GA)37.(CT)37 insert, at neutral and basic pH. The structure formed is different from the well known protonated triplexes (H-DNA) adopted at low pH by polypurine.polypyrimidine (Pur.Pyr) inserts in plasmids. DNA samples must be preincubated in the presence of multivalent ions at 50 degrees C for the new transition to occur. At neutral pH in the presence of Co hexamine, both strands of the insert have modification maxima situated at one-third of the distance from both ends. We propose the formation of a new structure called nodule DNA which consists of both Pyr.Pur.Pyr and Pur.Pur.Pyr triplexes and does not contain continuous single-stranded regions. At basic pH (greater than 8.5) in the presence of magnesium ions, the modification pattern corresponds to Pur.Pur.Pyr triplex formation in the whole insert. At neutral pH in the presence of magnesium, both nodule DNA and the Pur.Pur.Pyr triplex can be formed in the insert. We also observed a magnesium-dependent transition at neutral pH in the other Pur.Pyr insert containing plasmids. These data demonstrate that Pur.Pyr sequences can adopt several non-B conformations at close to in vivo conditions.     

Multiple non-B-DNA conformations of polypurine.polypyrimidine sequences in plasmids

A polypurine.polypyrimidine (Pur.Pyr) sequence with a central interruption in a plasmid can adopt multiple non-B-DNA conformations depending on the conditions as revealed by specific chemical probes (OsO4, diethyl pyrocarbonate, and dimethyl sulfate) and two-dimensional electrophoresis. The relatively long mirror repeat Pur.Pyr sequences (GAA)9TTC(GAA)8 and (GGA)9TCC(GGA)8 form single canonical intramolecular triplexes at pH 7.0-6.0 in negatively supercoiled plasmids as isolated from Escherichia coli. With a lowering of the pH and/or an increase in the degree of negative supercoiling, these sequences undergo a novel conformational change as revealed by diethyl pyrocarbonate hypermodification of adenines in the middle of the polypurine strand and OsO4 reaction with thymines in the center and the quarter points of the polypyrimidine strand. To evaluate this structure, a family of related Pur.Pyr sequences were cloned and studied. The non mirror repeat sequence (GGA)9TCC(GAA)8 forms a non-B conformation only under acidic pH conditions, but the structural properties are different from those of the mirror repeat sequences. Furthermore, when the central interruptions of a mirror repeat sequence were increased from 3 to 9 bp, two canonical triplexes formed independently at pH 5.0 [at the (GAA)9 and (GAA)8 regions in the sequence (GAA)9TTAATTCGC(GAA)8]. Thus, if an interruption is sufficiently long, the two halves of the Pur.Pyr sequence do not interact with each other. Novel types of folded DNA geometries which explain these results are described.     

Structural heterogeneity of pyrimidine/purine-biased DNA sequence analyzed by atomic force microscopy.

We report here the direct evidence for the formation of alternative DNA structures in a plasmid DNA, termed pTIR10, containing a 0.23-kb pyrimidine/purine-biased (Pyr/Pur) stretch isolated from the rat genome. Long Pyr/Pur sequences are abundant in eukaryotic genomes, and they may modulate the biological activity of genes and genomes via formation of various types of triplex-related structures. The plasmid DNA in sodium acetate buffer (pH 4.35) was deposited on APS-modified mica, and after drying it was imaged with an atomic force microscope in air. Various types of thick protrusions have been observed on pTIR10 DNA. Structural parameters (width and height) of DNA molecules suggest that the alternative structures observed here are variations on the theme of an intramolecular triplex. The biological relevance of the structural features within Pyr/Pur stretches is discussed.     

Interactions of molecules with nucleic acids. VII. Intercalation and T.A specificity of daunomycin in DNA

Intercalation complexes of daunomicin(+1) with tetramer duplexes in DNA are studied with the theoretically determined intercalation sites (I, ?0.4), (II, ?0.4), and (III, ?1.4). These sites occur with base pairs separated by 6.76 Å for helical angles of 26°, 22°, and 8° about the intercalation site. Site I is preferred, and this is in agreement with experimental unwinding angles. Optimum binding positions and conformations are established, and these are in agreement with experimental results from crystal structures. A systematic procedure is devised to study base-pair and base-sequence specificity, which results in the demonstration that the most stable sequences are mainly ↑BP₁, T·A, DAUN, A·T, BP₄↓ and ↑BP₁, T·A, DAUN, G·C, BP₄↓, i.e., with the TpA and CpG (pyrimidine)p(purine) sequences about the intercalation site. These 32 possible sequences are found among the 40 most stable complexes. These theoretical calculations of intercalation complexes with daunomicin(+1) provide the first example in which a drug specifically selects the base pair T·A and prefers it in a particular sequence about the intercalation site. This specificity is in agreement with some experimental results. Problems associated with the interpretation of specificity are discussed in terms of the base, base-pair, and base-sequence resulting from the DNA site and the DNA–drug interactions. T·A specificity is rationalized by noting that the 2′deoxyribo-5′-monophosphate backbone attached to A is slightly more negative than that on the other nucleotides. Hence, a preference exists for binding to the protonated daunosamine (+1) groups. Stereographic projections of daunomycinone and daunomycin(+1) in a bond model and in a space-filling model with steric contours illustrate the results.     

Conformational studies on pyrimidine 5'-monophosphates and 3',5'-diphosphates. Effect of the phosphate groups on the backbone conformation of polynucleotides

In continuation of our studies on the effect of the base and the phosphate groups on the glycosyl and the sugar-phosphate backbone conformation, we have carried out semi-empirical potential energy calculations on the common 5′- and 3′5′-ribopyrimidine mono- and diphosphates by considering simultaneous rotations about the glycosyl (χ) and the C(4′)–C(5′) (ψ) bonds. This calculation provides an assessment of the nature and orientation of the base on the sugar–phosphate backbone conformation of nucleotides and polynucleotides. It is found that the attractive inetractions between the 5′-phosphate group and the base mutually stabilize the antiand the gauche-gauche (gg) conformations about χ and ψ, respectively, in 5′-ribopyrimidine nucleotides. The introduction of the 3′-phosphate group as in 3′,5′-ribopyrimidine diphosphates, still leaves the anti-gg as the most favored conformation with the important difference that the probability of occurrence of the anti, gauche-trans (gt) is how substantially increased. This is dependent to a large extent on the sugar conformation and to a lesser extent on the base. Uracil and thymine show a greater probability for the anti-gt than cytosine. The syn conformation is considerably less likely and its occurrence is also dependent on the base type, cytosine showing a lesser tendency than uracil and thymine. For the syn base, the most favourec conformation for ψ is gt, since gg is sterically disallowed and tg is destabilized by electrostatic repulsive interactions between the 3′ and 5′-phosphate groups. Thus, there is a striking correlation between the glycoysl and the backbone C(4′)–C(5′) bond conformations. The rest of the bonds of the backbone are considerable less dependent on the glycosyl conformation. These studies reveal that in poly-ribopyrimidine nucletides the majority of the nucleotide residues are expected to occur in the anti-gg conformation.     

7-Azido-Actinomycin D: A Photoaffinity Probe of the Sequence Specificity of DNA Binding by Actinomycin D

Abstract

Actinomycin D (ActD) is a DNA-binding antitumor antibiotic that appears to act in vivo by inhibiting RNA polymerase. The mechanism of DNA binding of ActD has attracted much attention because of its strong preference for 5′-dGpdC-3′ sequences. Binding is thought to involve intercalation of the tricyclic aromatic phenoxazone ring into a GC step, with the two equivalent cyclic pentapeptide lactone substituents lying in the minor groove and making hydrogen bond contacts with the 2-amino groups of the nearest neighbor guanines. Recent studies have indicated, however, that binding is also influenced by next-nearest neighboring bases. We have examined this higher order specificity using 7-azido-actinomycin-D as a photoaffinity probe, and DNA sequencing techniques to quantitatively monitor sites of covalent photoaddition. We found that GC doublets were strongly preferred only if the 5′- flanking base was a pyrimidine and the 3′-flanking base was not cytosine. In addition we observed a previously unreported preference for binding at a GG doublet in the sequence 5′- TGGG-3′.     

Correlation between the backbone and side chain conformations in 5′-nucleotides. The concept of a ‘rigid’ nucleotide conformation

Conformational energies of the 5′-adenosine monophosphate have been computed as a function of χ and ψ, of the torsion angles about the side-chain glycosyl C(1′)–N(9) and of the main-chain exocyclic C(4′)–C(5′) bonds by considering nonbonded, torsion, and electrostatic interactions. The two primary modes of sugar puckering, namely, C(2′)-endo and C(3′)-endo have been considered. The results indicate that there is a striking correlation between the conformations about the side-chain glyocsyl bond and the backbone C(4′)–C(5′) bond of the nucleotide unit. It is found that the anti and the Gauche–Gauche (gg), conformations about the glycosyl and the C(4′)–C(5′) bonds, respectively, are energetically the most favored conformations for 5′-adenine nucleotide irrespective of whether the puckering of the ribose is C(2′)-endo or C(3′)-endo. Calculations have also shown that the other common 5′-pyrimidine nucleotides will show similar preferences for the glycosyl and C(4′)–C(5′) bond conformations. These results are in remarkable agreement with the concept of the “rigid” nucleotide unit that has been developed from available data on mononucleotides and dinucleoside monophosphates. It is found that the conformational ‘rigidity’ in 5′-nucleotides compared with that of nucleosides is a consequence of, predominantly, the coulombic interactions between the negatively charged phosphate group and the base. The above result permits one to consider polynucleotide conformations in terms of a “rigid” C(2′)-endo or C(3′)-endo nucleotide unit with the major conformational changes being brought about by rotations about the P–O bonds linking the internucleotide phosphorus atom. IT is predicted that the anti and the gg conformations about the glycosyl and the C(4′)–C(5′) bonds would be strongly preferred in the mononucleotide components of different purine and pyrimidine coenzymes and also in the nucleotide phosphates like adenodine di- and triphosphates.     

Bacterial Synthesis of Nucleotides

General properties of bacterial nucleoside phosphotransferase were demonstrated. Nucleoside phosphotransferase activity was observed somewhere in cells, and the activity and the specificity for donor and product in this reaction are described to be due to the basic character of strains. Such aromatic phosphates as p-nitrophenylphosphate, phenylphosphate, benzylphosphate and the nucleotides were apparent to be useful for nucleotide synthesis, and the ability as donor did not always depend upon the energy consideration. The product specificity of this reaction was confirmed to correlate with nucleotide isomer added as donor; that is, the bacteria characterized to phosphorylate at 5′-position of nucleoside catalyzed the interconversion of phosphoryl or phosphate radical between 5′-nuclotides and those characterized to do at 3′(& 2′)-position of nucleoside catalyzed the interconversion of that between 3′(& 2′)-nucleotides. The phosphoryl or phosphate transfer reaction using nucleotide as donor is reversible but that using p-nitrophenylphosphate as donor is irreversible. The factors to get a good yield on the synthesis of 5′-inosinic acid were discussed, then the maximum yield was accounted to 80%.     

Conformational study of ribonucleotides, 2′-deoxyribonucleotides,and arabinonucleotides by carbon-13 nuclear magnetic resonance

The geminal and vicinal ¹³C-³¹P coupling constants have been monitored, as a function of pH, for a series of uracil and cytosine 3′- and 5′-nucleotides with a ribose, arabinose, or 2′-deoxyribose sugar. Data were also obtained for two 3′,5′-diphosphates in the ribose and arabinose series. The geminal J(C5′-P5′) and J(C3′-P3′) couplings show only a small dependence on the ionization state of the phosphate, decreasing by < 0.5 Hz in the pH 5–7 range. For the ribose and arabinose 3′-nucleotides, the vicinal J(C4′-P3′) increase (up to 1.5 Hz) on secondary phosphate ionization in the pH 5–7 range, whereas their J(C2′-P3′) couplings decrease (up to 1.5 Hz) over the same pH range. In contrast for the 2′-deoxyribose molecules, both couplings decrease (～0.5 Hz) on phosphate ionization. The titration curves provide information about the influence of the sugar on the conformation about the C3′? O3′ bond. Some conformational trends could be rationalized by consideration of the sugar-puckerdependent contact interactions between the 3′-phosphate and the substituents on the furanose ring.     

Sequence‐specific interactions of minor groove binders with restriction fragments of cDNAs for H tau 40 protein and MAP kinase 2. A qualitative and quantitative footprinting study

A series of DNA minor groove binders comprising netropsin, distamycin, the bisquaternary ammonium heterocycles SN 6999 and SN 6570, cis‐diammine platinum(II)‐bridged bis‐netropsin, cis‐diammine platinum(II)‐bridged bis‐distamycin and bis‐glycine‐linked bis‐distamycin were investigated for sequence‐specific interactions. The oligonucleotides used were the 154 base pair HindIII–RsaI restriction fragment of cDNA of h tau 40 protein and the 113 base pair NcoI–PvuII restriction fragment of cDNA of MAP kinase 2. Both proteins are believed to be involved in the pathology of Alzheimer's disease. For all these ligands, binding sites were localised at positions 1134–1139 (5′AATCTT3′), 1152–1156 (5′ATATT3′) and 1178–1194 (5′TTTCAATCTTTTTATTT3′) for the former and 720–726 (5′TATTCTT3′), 751–771 (5′AATTGTATAATAAATTTAAAA3′) and 781–785 (5′TATTT3′) for the latter. The AT‐preference of ligand binding was obvious and footprint titration experiments were applied to estimate binding constants (K_a) for each individual binding site mentioned above. The binding strength decreases in the order netropsin > distamycin > SN 6999 ≈ SN 6570>platinum‐bridged netropsin or distamycin≈bis‐glycine‐bridged distamycin and was found independently of the binding sites examined. GC‐base pairs interspersed in short AT‐tracts reduced the K_a‐values by as much as two orders of magnitudes. The dependence of extended bidentate as well as of monodentate binding of netropsin and distamycin derivatives on the length of AT‐stretches has been discussed. Copyright © 1999 John Wiley & Sons, Ltd.     

Visualization of drug--nucleic acid interactions at atomic resolution. V. Structure of two aminoacridine--dinucleoside monophosphate crystalline complexes, proflavine--5-iodocytidylyl (3'-5') guanosine and acridine orange--5-iodocytidylyl (3'-5') guanosine

Acridine orange and proflavine form complexes with the dinucleoside monophosphate, 5-iodocytidylyl(3′–5′)guanosine. The acridine orange-iodoCpG² crystals are monoclinic, space group P2₁, with unit cell dimensions $\text{a = 14.36}\text{A}\text{?}\text{, b = 19.64}\text{A}\text{?}\text{, c = 20.67}\text{A}\text{?}$, β = 102.5 °. The proflavine-iodoCpG crystals are monoclinic, space group C2, with unit cell dimensions $\text{a = 32.14}\text{A}\text{?}\text{, b = 22.23}\text{A}\text{?}\text{, c = 18.42}\text{A}\text{?}$, β = 123.3 °. Both structures have been solved to atomic resolution by Patterson and Fourier methods, and refined by full matrix least-squares.Acridine orange forms an intercalative structure with iodoCpG in much the same manner as ethidium, ellipticine and 3,5,6,8-tetramethyl-N-methyl phenanthrolinium (Jain et al., 1977, Jain et al., 1979), except that the acridine nucleus lies asymmetrically in the intercalation site. This asymmetric intercalation is accompanied by a sliding of base-pairs upon the acridine nucleus and is similar to that observed with the 9-aminoacridine-iodoCpG asymmetric intercalative binding mode described in the previous papers (Sakore et al., 1977, Sakore et al., 1979). Basepairs above and below the drug are separated by about 6.8 Å and are twisted about 10 °; this reflects the mixed sugar puckering pattern observed in the sugar-phospate chains: C3′ endo (3′–5′) C2′ endo (i.e. each cytidine residue has a C3′ endo sugar comformation, while each guanosine residue has a C2′ endo sugar conformation), alterations in glycosidic torsional angles and other small but significant conformational changes in the sugar-phosphate backbone.Proflavine, on the other hand, demonstrates symmetric intercalation with iodoCpG. Hydrogen bonds connect amino groups on proflavine with phosphate oxygen atoms on the dinucleotide. In contrast to the acridine orange structure, base-pairs above and below the intercalative proflavine molecule are twisted about 36 °. The altered magnitude of this angular twist reflects the sugar puckering pattern that is observed: C3′ endo (3′–5′) C3′ endo. Since proflavine is known to unwind DNA in much the same manner as ethidium and acridine orange (Waring, 1970), one cannot use the information from this model system to understand how proflavine binds to DNA (it is possible, for example, that hydrogen bonding observed between proflavine and iodoCpG alters the intercalative geometry in this model system).Instead, we propose a model for proflavine-DNA binding in which proflavine lies asymmetrically in the intercalation site (characterized by the C3′ endo (3′–5′) C2′ endo mixed sugar puckering pattern) and forms only one hydrogen bond to a neighboring phosphate oxygen atom. Our model for proflavine-DNA binding, therefore, is very similar to our acridine orange-DNA binding model. We will describe these models in detail in this paper.     

Interaction of molecules with nucleic acids. II. Two pairs of families of intercalation sites, unwinding angles, and the neighbor-exclusion principle

Intercalation-site geometries are generated for a tetramer duplex extracted from B-DNA. Glycosidic angles and puckers of the deoxyribose sugar groups bonded to base pairs BP₁ and BP₄, namely, those at either end of the tetramer duplex, are assumed to be those of B-DNA to insure continuity. All possible geometrical conformations for combinations of C(2′)-endo, C(3′)-endo, C(2′)-exo, and C(3′)-exo sugar puckers are determined for the tetranucleotide backbone. Those with minimum energy are selected as candidates for intercalation sites. Calculations reveal two pairs of physically meaningful families of intercalation sites which occur in two distinct regions, I and II, of helical angles which orient BP₂ relative to BP₃ and with the helical axis disjointed between these base pairs. For each site I and II within BP₂ and BP₃, there are two distinct backbone conformations, A and B, connecting BP₃ to BP₄ or BP₁ to BP₂ which do not disrupt backbone conformations connecting BP₂ to BP₃. Hence two pairs, IA and IB, and IIA and IIB, of intercalation sites exist in which the sugar puckers along the backbone of the tetramer alternate from C(2′)-endo to C(3′)-endo on the backbone (5′p3′) connecting BP₂ to BP₃. The glycosidic angles of the C(3′)-endo sugar χ₃^γ are, coincidentally, 80° ± 2° for both conformations γ = A and B connecting BP₃ to BP₄ along the phosphate backbone (5′p3′). Consistent with the theoretical results, the experimental unwinding angles can be grouped into two categories with absolute values of 18° and 26°. The theoretical unwinding angles for sites IA and IB of 16° and for sites IIA and IIB of 20° occur for a displacement of -0.8 Å in the helical axes of BP₂ and BP₃ and for a 100% G·C composition, with a decrease depending on the amount of A·T base pairs present. Ratios of theoretical unwinding angles of sites I and II, which range from 0.75 to 0.84 for the two principal sites, compare well with the experimental value of 0.71. The theoretical results, in agreement with experimental observation, provide a new interpretation of the nature and conformation of the possible binding sites. Conformations obtained from these studies of intercalation sites in a tetramer duplex are used to rationalize the well-known neighbor-exclusion principle. The possibility of violation of this principle is demonstrated by the existence of two families of physically meaningful conformations. Conformations of unconstrained dimer duplexes are also obtained, one of which corresponds to the experimental crystal structure of ethidium–dinucleoside complexes, but these cannot be joined to the B-DNA structure. Backbone conformations of the tetramer duplex can be constructed until the base-pair separation reaches 8.25 Å, which may limit the molecules that can intercalate.     

An analysis of the sequence dependence of the structure and energy of A- and B-DNA models using molecular mechannics

Molecular-mechanics calculations have been carried out on the base-paired hexanucleoside pentaphosphates d(TATATA)₂, d(ATATAT)₂, d(A₆)·d(T₆), d(CGCGCG)₂, d(GCGCGC)₂, and d(C₆)·d(G₆) in both A- and B-DNA geometries. The calculated relative energies of these polymers are consistent with the relative stabilities of the polymers found experimentally. In particular, the results of our calculations support the observation that the homopolymer d(A)_n·d(T)_n is more stable in a B-DNA conformation, while the homopolymer d(G)_n·d(C)_n is more stable in an A-DNA conformation. The molecular interactions responsible for these differential stabilities include both inter- and intrastrand base stacking, as well as base–phosphate interactions. While definitive experiments on the heteropolymer stabilities have not yet been carried out, the results of our calculations also suggest a greater stability of the purine-3′,5′-pyrimidine sequence over the pyrimidine-3′,5′-purine sequence in both the A- and B-conformations. The reason for this greater stability lies in the importance of the inherent directionality (5′ → 3′ vs 3′ → 5′) of phosphate–base and base–base interactions. The largest conformation change observed on energy refinement is sugar repuckering, which occurs mainly on pyrimidine-attched sugars and only in the B-DNA geometry. We suggest a molecular mechanism, specifically, differential base–sugar steric interactions involving neighboring sugars, to explain why this repuckering occurs more with d(A₆)·d(T₆) than with other isomers.