Karyotypic evolution of a novel cervid satellite DNA family isolated by microdissection from the Indian muntjac Y-chromosome

A minilibrary was constructed from DOP-PCR products using microdissected Y-chromosomes of Indian muntjac as DNA templates. Two microclones designated as IM-Y4-52 and IM-Y5-7 were obtained from negative screening of all three cervid satellite DNAs (satellites I, II, and IV). These two microclones were 295 and 382 bp in size, respectively, and shared 70% sequence homology. Southern blot analysis showed that the IM-Y4-52 clone was repetitive in nature with an 0.32-kb register in HaeIII digest. Sequence comparison revealed no similarities to DNA sequences deposited in the GenBank database, suggesting that the microclone sequences were from a novel satellite DNA family designated as cervid satellite V. A subclone of an Indian muntjac BAC clone which screened positive for IM-Y4-52 had a 3,325-bp insert containing six intact monomers, four deleted monomers, and two partial monomers. The consensus sequence of the monomer was 328 bp in length and shared more than 80% sequence homology with every intact monomer. A zoo blot study using IM-Y4-52 as a probe showed that the strong hybridization with EcoRI digested male genomic DNA of Indian muntjac, Formosan muntjac, Chinese muntjac, sambar deer, and Chinese water deer. Female genomic DNA of Indian muntjac, Chinese water deer, and Formosan muntjac also showed positive hybridization patterns. Satellite V was found to specifically localize to the Y heterochromatin region of the muntjacs, sambar deer, and Chinese water deer and to chromosome 3 of Indian muntjac and the X-chromosome of Chinese water deer.Y.-C. Li and Y.-M. Cheng contributed equally to this work.     

Isolation and identification of a novel satellite DNA family highly conserved in several Cervidae species

In an attempt to amplify cervid satellite II DNA from the genomes of Indian muntjac and Chinese muntjac, a pair of primers derived from the white tailed deer satellite II DNA clone (OvDII) yielded a prominent approximately 1 kb polymerase chain reaction (PCR) product (in addition to the expected 0.7 kb satellite II DNA fragments) in both species. The approximately 1 kb products were cloned, sequenced, and analyzed by Southern blotting and fluorescence in situ hybridization (FISH). This revealed that the approximately 1 kb cloned sequences indeed represent a previously unknown cervid satellite DNA family, which is now designated as cervid satellite IV DNA. Approximately 1 kb PCR clones were also obtained from the genomes of the black tailed deer and Canadian woodland caribou with similar primer pairs. Extremely high sequence conservation (over 90% homology) was observed among the clones generated from all four deer species and PCR-Southern hybridization experiments further verified the co-amplification of two kinds of satellite DNA sequences with the same pair of primers. This satellite DNA was found to co-localize with centromeric proteins at the kinetochore by a simultaneous FISH and immunofluorescence study. Due to its high sequence conservation and close association with kinetochores, the newly identified satellite DNA may have a functional centromeric role.     

Localization and characterization of recombinant DNA clones derived from the highly repetitive DNA sequences in the Indian muntjac cells: their presence in the Chinese muntjac

A total of seven, highly repeated, DNA recombinant M13 mp8 clones derived from a Hpa II digest of cultured cells of the Indian muntjac (Muntiacus muntjac vaginalis) were analyzed by restriction enzymes, in situ hybridization, and DNA sequencing. Two of the clones, B1 and B8, contain satellite DNA inserts which are 80% homologous in their DNA sequences. B1 contains 781 nucleotides and consist of tandem repetition of a 31 bp consensus sequence. This consensus sequence, TCCCTGACGCAACTCGAGAGGAATCCTGAGT, has only 3 bp changes, at positions 7, 24, and 27, from the consensus sequence of the 31 bp subrepeats of the bovine 1.715 satellite DNA. The satellite DNA inserts in B1 and B8 hybridize primarily but not specifically to chromosome X, and secondarily to other sites such as the centromeric regions of chromosomes 1 and 2. Under less stringent hybridization conditions, both of them hybridize to the interior of the neck region and all other chromosomes (including chromosomes 3 and Y). The other five DNA clones contain highly repetitive, interdispersed DNA inserts and are distributed throughout the genome except for the neck region of the compound chromosome X+3. Blot hybridization results demonstrate that the satellite DNA component is also present in Chinese muntjac DNA (Muntiacus reevesi) in spite of the very different karyotypes of the Chinese and Indian muntjacs.     

New evidence for tandem chromosome fusions in the karyotypic evolution of Asian muntjacs

A clone of highly repetitive DNA, designated C5, was isolated from DNA of female Chinese muntjac cells. The nucleotide sequence of this clone is 80%–85% homologous to that of the satellite IA clone and other highly repetitive DNA clones previously obtained from the Indian muntjac. Using C5 as a probe for in situ hybridizations to chromosome preparations of cells of both the Chinese and Indian muntjacs, we were able to show that these repeated sequences occur in centromeric heterochromatin of the chromosomes of both Chinese and indian muntjac species. More significantly, non-random clusters of hybridization signals were detected on the arms of chromosomes of the Indian muntjac. These latter hybridization sites are postulated to be regions of interstitial heterochromatin and could be the remnants of centromeric heterochromatin from ancestral Chinese muntjac chromosomes. Our observations provide new supportive evidence for the tandem chromosome fusion theory that has been proposed for the evolution of the Indian muntjac karyotype.by P.B. Moens     

Comparative sequence analyses reveal sites of ancestral chromosomal fusions in the Indian muntjac genome

Background

Indian muntjac (Muntiacus muntjak vaginalis) has an extreme mammalian karyotype, with only six and seven chromosomes in the female and male, respectively. Chinese muntjac (Muntiacus reevesi) has a more typical mammalian karyotype, with 46 chromosomes in both sexes. Despite this disparity, the two muntjac species are morphologically similar and can even interbreed to produce viable (albeit sterile) offspring. Previous studies have suggested that a series of telocentric chromosome fusion events involving telomeric and/or satellite repeats led to the extant Indian muntjac karyotype.

Results

We used a comparative mapping and sequencing approach to characterize the sites of ancestral chromosomal fusions in the Indian muntjac genome. Specifically, we screened an Indian muntjac bacterial artificial-chromosome library with a telomere repeat-specific probe. Isolated clones found by fluorescence in situ hybridization to map to interstitial regions on Indian muntjac chromosomes were further characterized, with a subset then subjected to shotgun sequencing. Subsequently, we isolated and sequenced overlapping clones extending from the ends of some of these initial clones; we also generated orthologous sequence from isolated Chinese muntjac clones. The generated Indian muntjac sequence has been analyzed for the juxtaposition of telomeric and satellite repeats and for synteny relationships relative to other mammalian genomes, including the Chinese muntjac.

Conclusions

The generated sequence data and comparative analyses provide a detailed genomic context for seven ancestral chromosome fusion sites in the Indian muntjac genome, which further supports the telocentric fusion model for the events leading to the unusual karyotypic differences among muntjac species.     

Chromosomal distribution and organization of three cervid satellite DNAs in Chinese water deer (Hydropotes inermis)

The species-specific profile and centromeric heterochromatin localization of satellite DNA in mammalian genomes imply that satellite DNA may play an important role in mammalian karyotype evolution and speciation. A satellite III DNA family, CCsatIII was thought to be specific to roe deer (Capreolus capreolus). In this study, however, this satellite DNA family was found also to exist in Chinese water deer (Hydropotes inermis) by PCR-Southern screening. A satellite III DNA element of this species was then generated from PCR-cloning by amplifying this satellite element using primer sequences from the roe deer satellite III clone (CCsatIII). The newly generated satellite III DNA along with previously obtained satellite I and II DNA clones were used as probes for FISH studies to investigate the genomic distribution and organization of these three satellite DNA families in centromeric heterochromatin regions of Chinese water deer chromosomes. Satellite I and II DNA were observed in the pericentric/centric regions of all chromosomes, whereas satellite III was distributed on 38 out of 70 chromosomes. The distribution and orientation of satellite DNAs I, II and III in the centromeric heterochromatin regions of the genome were further classified into four different types. The existence of a Capreolus-like satellite III in Chinese water deer implies that satellite III is not specific to the genus Capreolus (Buntjer et al., 1998) and supports the molecular phylogeny classification of Randi et al. (1998) which suggests that Chinese water deer and roe deer are closely related.     

Cervid satellite DNA and karyotypic evolution of Indian muntjac

Five satellite DNA families (designated as satellite I?CV) have been identified in the Cervidae so far. Among those, satellite I, II and IV are centromere specific. Satellite I and II are shared by large number of deer species, where satellite IV is highly conserved among several deer species examined. Satellite III was initially thought to be roe deer specific but later identified in Chinese water deer as well. SatelliteV is Y-chromosome specific for several Asian deer species examined but also found in the pericentric region of Indian muntjac chromosome 3 and in X chromosome of Chinese water deer. The observation of interstitial hybridization sites on Indian muntjac chromosomes with satellite DNA I probe generated from Chinese muntjac provides the first molecular evidence supporting the tandem fusion theory that 2n=6??/7??of Indian muntjac karyotype could derive from an ancestral Chinese muntjac-like species with 2n=46. Interspecies chromosome painting study and the maximum number of interstitial hybridization detected with satellite I and satellite II DNA probes lend support to the hypothesis that the Indian muntjac karyotype could evolve directly from an ancestral Chinese water deer-like species with 2n=70. Such hypothesis is further substantiated by the finding of satellite V signals presented in specific chromosome regions between the Chinese water deer and the Indian muntjac chromosomes.     

Characterization and chromosomal distribution of a novel satellite DNA sequence of Japanese quail (Coturnix coturnix japonica)

A novel satellite DNA sequence of Japanese quail (Coturnix coturnix japonica) was isolated from genomic DNA digested with restriction endonuclease, Bg/II. Sequence analysis of three different-size clones revealed the presence of a tandem array of a GC-rich 41 bp repeated element. This sequence was localized by fluorescence in situ hybridization (FISH) primarily to microchromosomes of Japanese quail (2n = 78); approximately 50 of the 66 microchromosomes showed positive signals, although hybridization signals were also detected on chromosomes 4 and W. This satellite DNA did not cross-hybridize with genomic DNA of chicken (Gallus gallus) and Chinese painted quail (Excalfactoria chinensis) under moderately stringent conditions, suggesting that this class of repetitive DNA sequences was species specific and fairly divergent in Galliformes species.     

CENP-A associated complex satellite DNA in the kinetochore of the Indian muntjac

The centromere/kinetochore complex is a chromosomal assembly that mediates chromosome motility and mitotic regulation by interacting with microtubules of the mitotic spindle apparatus. Centromere protein A (CENP-A) is a histone H3 homolog that is concentrated in the chromatin of the inner kinetochore plate of human chromosomes. To identify DNA sequences associated with the inner kinetochore plate, we used anticentromere autoantibodies to immunoprecipitate CENP-A associated chromatin selectively from Indian muntjac fibroblasts. DNA was cloned from immunoprecipitated CENP-A- associated chromatin and characterized by DNA sequence and hybridization analyses. A novel centromeric satellite DNA sequence was identified and shown by fluorescence in situ hybridization analysis to be present at all centromeres of the Indian muntjac. This satellite DNA constitutes a 972 bp monomer repeat and shows partial homology with satellite II DNA of the white-tailed deer. Southern blot analysis of muntjac genomic DNA suggests that this satellite DNA is present in repetitive tandem arrays and contains complex internal arrangements. In conjunction with previous work showing the association of CENP-A with human α-satellite DNA, we conclude that the mammalian inner kinetochore plate contains a unique form of chromatin that contains CENP-A in association with complex satellite DNA. Received: 18 May 1999; in revised form: 5 July 1999 / Accepted: 20 July 1999     

Isolation and characterization of salmonid telomeric and centromeric satellite DNA sequences

Satellite DNA clones with a 37 bp repeat unit were obtained from BglII-digested genomic DNA of Masu salmon (Oncorhynchus masou) and Chum salmon (O. keta). Fluorescence in situ hybridization (FISH) analysis with the isolated clones as a probe showed that these repetitive sequences were localized in the telomeric regions of chromosomes in both species. Southern and dot blot analyses suggested conservation of homologous sequences with similar repeat unit in other salmonids including the species of the genus Oncorhynchus and Salvelinus, but lack or scarcity of such sequences in the genus Hucho and Salmo. Similarly, polymerase chain reaction (PCR)-based cloning of satellite DNA referring to a reported Rainbow trout (O. mykiss) centromeric sequence was successful for the Oncorhynchus, Salvelinus and Hucho species. The obtained satellite DNA clones were localized with FISH in the centromeric regions of chromosomes of the species from these three genera. Although PCR cloning of the centromeric satellite DNA had failed in the Salmo species due to some base changes in the priming sites, dot blot hybridization analysis suggested conservation of homologous satellite DNA in the genus Salmo as in the other three genera. In the neighbor-joining tree of cloned centromeric satellite DNA sequences, the genus Oncorhynchus and Salvelinus formed adjacent clades, and the clade of the genus Hucho included the reported centromeric sequence of the genus Salmo. Conservation pattern and molecular phylogeny of the telomeric and centromeric satellite DNA sequences isolated herein support a close phylogenetic relationship between the genus Oncorhynchus and Salvelinus and between the Salmo and Hucho.     

Direct visualization of the genomic distribution and organization of two cervid centromeric satellite DNA families

Several repetitive DNA fragments were generated from PCR amplifications of caribou DNA using primer sequences derived from the white-tailed deer satellite II DNA clone OvDII. Two fragments, designated Rt-0.5 and Rt-0.7, were sequenced and found to have 96% sequence similarity. These caribou clones also had 85% sequence similarity with OvDII. Multiple-colored fluorescence in situ hybridization (FISH) studies with satellite I and satellite II DNA probes to caribou metaphase chromosomes and extended chromatin fibers provided direct visualization of the genomic organization of these two satellite DNA families, with the following findings: (1) Cervid satellite I DNA is confined to the centromeric regions of the acrocentric autosomes, whereas satellite II DNA is found at the centromeric regions of all chromosomes except for the Y. (2) For most acrocentric chromosomes, the satellite I signal appeared to be medially located at the primary constriction, in contrast to that of satellite II, which appeared to be oriented toward the lateral sides as two separate fluorescent dots. (3) The satellite II clone Rt-0.7 appeared to be enriched in the centromeric region of the caribou X chromosome, a pair of biarmed autosomes, and a number of other acrocentric autosomes. (4) Fiber-FISH demonstrated that the satellite I and satellite II arrays were juxtaposed. On highly extended chromatin fibers, the total length of the hybridization signals for the two satellite DNA arrays often reached 300-400 microm. The length of a given satellite II array usually reached 200 microm, corresponding to 2 x 10(3) kb of DNA in a given centromere.     

Sequence heterogeneity of the human alphoid satellite DNA and thermal stability of mismatched alphoid DNA duplexes

1. 340 bp (dimer) and 680 bp (tetramer) fractions of the human alphoid satellite DNA (h alpha RI DNA) were isolated after complete cleavage of total human DNA with EcoR I and cloned in pBR 32.5. 2. Ten clones containing 340 bp inserts and one clone containing 680 bp insert were sequenced in order to investigate the sequence heterogeneity of this satellite DNA and the sequence data were compared with the consensus h alpha RI DNA sequence of Wu and Manuelidis (1980). 3. It was shown that in all clones studied the mutations are nonrandomly distributed along the human alphoid monomers forming distinct conservative and variable regions. 4. This mutation distribution pattern was compared with the nucleotide variations between the consensus sequences of different primate alphoid DNAs and it was found that the interspecies nucleotide divergency of this satellite DNA is quite similar to the intragenomic one. 5. The sequenced h alpha RI DNA clones were used for preparation of DNA-DNA hybrids with a known percentage of base pair mismatching. 6. These hybrids were melted on hydroxyapatite (HAP) and the results obtained were used to determine the relationship between the thermal stability (Tm) and the extent of base pair mismatching for naturally diverged DNA sequences. 7. A value of 0.7 degrees C decrease in Tm per 1% base pair mismatching was found.     

Characterization of cloned human alphoid satellite with an unusual monomeric construction: evidence for enrichment in HeLa small polydisperse circular DNA.

A recombinant DNA plasmid library was constructed from HeLa cell extrachromosomal circular DNA and the sequence organization of one family of clones, which contain sequences enriched in HeLa small polydisperse circular (spc) DNA, was studied by restriction mapping and base sequence analysis. Restriction mapping revealed each clone to be composed solely of imperfect tandem repeats of ca. 170 bp. The entire DNA sequence of one clone was determined and found to be alphoid satellite with a variant monomeric construction.     

Tomato genome is comprised largely of fast-evolving, low copy-number sequences

Summary Fifty random clones (350–2300 bp), derived from sheared, nuclear DNA, were studied via Southern analysis in order to make deductions about the organization and evolution of the tomato genome. Thirty-four of the clones were mapped genetically and determined to represent points on 11 of the 12 tomato chromosomes. Under moderate stringency conditions (80% homology required) 44% of the clones were classified as single copy. Under higher stringency, the majority of the clones (78%) behaved as single copy. Most of the remaining clones belonged to multicopy families containing 2–20 copies, while a few contained moderately or highly repeated sequences (10% at moderate stringency, 4% at high stringency). Divergence rates of sequences homologous to the 50 random genomic clones were compared with those corresponding to 20 previously described cDNA (coding sequence) clones. Rates were measured by probing each clone (random genomics and cDNAs) onto filters containing DNA from various species from the family Solanaceae (including potato, Datura, petunia and tobacco) as well as one species (watermelon) from another plant family, Cucurbitaceae. Under moderate stringency conditions, the majority of the random clones (single copy and repetitive) failed to detect homologous sequences in the more distantly related species, whereas approximately 90% of the 20 coding sequences analyzed could still be detected in all solanaceous species. The most highly repeated sequences appear to be the fastest evolving and homologous copies could be detected only in species most closely related to tomato. Dispersion of repetitive sequences, as opposed to tandem clustering, appears to be the rule for the tomato genome. None of the repetitive sequences discovered by this random sampling of the genome were tandemly arranged — a finding consistent with the notion that the tomato genome contains only a small fraction of satellite DNA. This study, along with a companion paper (Ganal et al. 1988), provides the first general sketch of the tomato genome at the molecular level and indicates that it is comprised largely of single copy sequences and these sequences, together with repetitive sequences are evolving at a rate faster than the coding portion of the genome. The small genome and paucity of highly repetitive DNA are favourable attributes with respect to the possibilities of conducting chromosome walking experiments in tomato and the fact that coding regions are well conserved among solanaceous species may be useful for distinguishing clones that contain coding regions from those that do not.     

Genetic variability in a family of satellite DNAs from tilapia (Pisces: Cichlidae).

We have cloned and sequenced members of a family of satellite DNAs from three genera of the tilapiine tribe of fishes: Oreochromis, Sarotherodon, and Tilapia. The satellite DNAs, visualized as intensely staining bands following electrophoretic separation of EcoRI-digested genomic DNA, consist of three size variants differentially distributed in the various tilapiine species. The sizes of the monomers are approximately 237 bp (type I), 230 bp (type II), and 209 bp (type III). Several cloned monomers were sequenced from Oreochromis niloticus (type III), Oreochromis placidus (types I and II), Sarotherodon galilaeus (type I), Tilapia zillii (type I), and Tilapia rendalli (type I). Comparison of derived consensus sequences for the monomer units of the satellite DNAs revealed sequence identities within and between species that ranged from 89 to 96%. The type II and type III size variants appear to have arisen by deletions of 9 and 29 bp, respectively, within different regions of the type I satellite. Hybridization of a cloned monomer satellite from O. niloticus (type III) to PalI digests of genomic DNA from all three genera detected polymorphic, high molecular weight restriction fragments that produced fingerprint-like patterns. The complexity of these DNA fingerprints varied from one species to another, suggesting a markedly different genomic organization for these polymorphic satellite DNAs.     

Characterization of ancestral chromosome fusion points in the Indian muntjac deer

Tandem fusion, a rare evolutionary chromosome rearrangement, has occurred extensively in muntjac karyotypic evolution, leading to an extreme fusion karyotype of 6/7 (female/male) chromosomes in the Indian muntjac. These fusion chromosomes contain numerous ancestral chromosomal break and fusion points. Here, we designed a composite polymerase chain reaction (PCR) strategy which recovered DNA fragments that contained telomere and muntjac satellite DNA sequence repeats. Nested PCR confirmed the specificity of the products. Two-color fluorescence in situ hybridization (FISH) with the repetitive sequences obtained and T₂AG₃ telomere probes showed co-localization of satellite and telomere sequences in Indian muntjac chromosomes. Adjacent telomere and muntjac satellite sequences were also seen by fiber FISH. These data lend support to the involvement of telomere and GC-rich satellite DNA sequences during muntjac chromosome fusions.Communicated by E.A. NiggAccession numbers: AY322158, AY322159, AY322160     

Characterisation of the telomeres at opposite ends of a 3 Mb Theileria parva chromosome.

Bacteriophage lambda clones containing Theileria parva genomic DNA derived from two different telomeres were isolated and the nucleotide sequences of the telomeric repeats and adjacent telomere-associated (TAS) DNA were determined. The T.parva telomeric repeat sequences, a tandem array of TTTTAGGG or TTTAGGG interspersed with a few variant copies, showed a high degree of sequence identity to those of the photosynthetic algae Chlamydomonas reinhardtii (97% identity) and Chlorella vulgaris (87.7% identity) and the angiosperm Arabidopsis thaliana (84.4% identity). Unlike most organisms which have been studied, no significant repetitive sequences were found in the nucleotide sequences of TAS DNA located centromere-proximal to the telomeric repeats. Restriction mapping and hybridisation analysis of lambda EMBL3 clones containing 16 kilobases of TAS DNA derived from one telomere suggested that they did not contain long regions of repetitive DNA. The cloned TAS DNAs were mapped to T.parva Muguga genomic SfiI fragments 8 and 20, which are located at opposite ends of the largest T.parva chromosome. A 126 bp sequence located directly centromere-proximal to the telomeric repeats was 94% identical between the two cloned telomeres. The conserved 126 bp sequence was present on all T.parva Muguga telomeric SfiI fragments.     

Isolation and characterization of S genome specific sequences from Aegilops sect. sitopsis species.

Three S genome specific sequences were isolated from Aegilops sect. sitopsis species using different experimental approaches. Two clones, UTV86 and UTV39, were isolated from a partial genomic library obtained from DNA of Aegilops sharonensis, whereas a third clone, UTV5, was isolated from Aegilops speltoides. The three clones were characterized by sequencing, analysis of methylation, and sequence organization and abundance in some Aegilops and Triticum species. The clones UTV39 and UTV5 belong to the same family of tandem repeated sequences and showed high homology with a sequence already present in nucleotide databases. The UTV86 clone from Ae. sharonensis corresponded to an interspersed low frequency repeated sequence and did not show any significant homology with reported sequences. Southern hybridization experiments, using the cloned sequences as probes, detected polymorphism in the restriction patterns of all the five Aegilops species in section sitopsis. Aegilops speltoides showed the most divergent hybridization pattern. A close relationship was detected between the S genome of Ae. speltoides and the G genome of the wild Triticum timopheevii. In situ hybridization revealed a telomeric and (or) subtelomeric location of the sequences UTV39 and UTV5.     

Molecular structure and chromosomal localization of major repetitive DNA families in the chickpea (Cicer arietinum L.) genome

Three major repetitive DNA sequences were isolated from a genomic library of chickpea (Cicer arietinum L.) and characterized with respect to their genomic organization and chromosomal localization. All repetitive elements are genus-specific and mostly located in the AT-rich pericentric heterochromatin. Two families are organized as satellite DNAs with repeat lengths of 162–168 bp (CaSat1) and 100 bp (CaSat2). CaSat1 is mainly located adjacent to the 18S rDNA clusters on chromosomes A and B, whereas CaSat2 is a major component of the pericentric heterochromatin on all chromosomes. The high abundance of these sequences in closely related species of the genus Cicer as well as their variation in structure and copy number among the annual species provide useful tools for taxonomic studies. The retrotransposon-like sequences of the third family (CaRep) display a more complex organization and are represented by two independent sets of clones (CaRep1 and CaRep2) with homology to different regions of Ty3-gypsy-like retrotransposons. They are distributed over the pericentric heterochromatin block on all chromosomes with extensions into euchromatic regions. Conserved structures within different crossability groups of related Cicer species suggest independent amplification or transposition events during the evolution of the annual species of the genus.