DNA repair in neurons: So if they don’t divide what's to repair?

Neuronal DNA repair remains one of the most exciting areas for investigation, particularly as a means to compare the DNA repair response in mitotic (cancer) vs. post-mitotic (neuronal) cells. In addition, the role of DNA repair in neuronal cell survival and response to aging and environmental insults is of particular interest. DNA damage caused by reactive oxygen species (ROS) such as generated by mitochondrial respiration includes altered bases, abasic sites, and single- and double-strand breaks which can be prevented by the DNA base excision repair (BER) pathway. Oxidative stress accumulates in the DNA of the human brain over time especially in the mitochondrial DNA (mtDNA) and is proposed to play a critical role in aging and in the pathogenesis of several neurological disorders including Parkinson's disease, ALS, and Alzheimer's diseases. Because DNA damage accumulates in the mtDNA more than nuclear DNA, there is increased interest in DNA repair pathways and the consequence of DNA damage in the mitochondria of neurons. The type of damage that is most likely to occur in neuronal cells is oxidative DNA damage which is primarily removed by the BER pathway. Following the notion that the bulk of neuronal DNA damage is acquired by oxidative DNA damage and ROS, the BER pathway is a likely area of focus for neuronal studies of DNA repair. BER variations in brain aging and pathology in various brain regions and tissues are presented. Therefore, the BER pathway is discussed in greater detail in this review than other repair pathways. Other repair pathways including direct reversal, nucleotide excision repair (NER), mismatch repair (MMR), homologous recombination and non-homologous end joining are also discussed. Finally, there is a growing interest in the role that DNA repair pathways play in the clinical arena as they relate to the neurotoxicity and neuropathy associated with cancer treatments. Among the numerous side effects of cancer treatments, major clinical effects include neurocognitive dysfunction and peripheral neuropathy. These symptoms occur frequently and have not been effectively studied at the cellular or molecular level. Studies of DNA repair may help our understanding of how those cells that are not dividing could succumb to neurotoxicity with the clinical manifestations discussed in the following article.     

DNA structure: what's in charge?

DNA structure is well known to be sensitive to hydration and ionic strength. Recent theoretical predictions and experimental observations have raised the idea of the intrusion of monovalent cations into the minor groove spine of hydration in B-form DNA. To investigate this further, extensions and further analysis of molecular dynamics (MD) simulations on d(CGCCGAATTCGCG), d(ATAGGCAAAAAATAGGCAAAAATGG) and d(G(5)-(GA(4)T(4)C)(2)-C(5)), including counterions and water, have been performed. To examine the effective of minor groove ions on structure, we analyzed the MD snapshots from a 15 ns trajectory on d(CGCGAATTCGCG) as two subsets: those exhibiting a minor groove water spine and those with groove-bound ions. The results indicate that Na(+) at the ApT step of the minor groove of d(CGCCGAATTCGCG) makes only small local changes in the DNA structure, and these changes are well within the thermal fluctuations calculated from the MD. To examine the effect of ions on the differential stability of a B-form helix, further analysis was performed on two longer oligonucleotides, which exhibit A-tract-induced axis bending localized around the CpG step in the major groove. Plots of axis bending and proximity of ions to the bending locus were generated as a function of time and revealed a strong linear correlation, supporting the idea that mobile cations play a key role in local helix deformations of DNA and indicating ion proximity just precedes the bending event. To address the issue of "what's in charge?" of DNA structure more generally, the relative free energy of A and B-form d(CGCGAATTCGCG) structures from MD simulations under various environmental circumstances were estimated using the free energy component method. The results indicate that the dominant effects on conformational stability come from the electrostatic free energy, but not exclusively from groove bound ions per se, but from a balance of competing factors in the electrostatic free energy, including phosphate repulsions internal to the DNA, the electrostatic component of hydration (i.e. solvent polarization), and electrostatic effects of the counterion atmosphere. In summary, free energy calculations indicate that the electrostatic component is dominant, MD shows temporal proximity of mobile counterions to be correlated with A-track-induced bending, and thus the mobile ion component of electrostatics is a significant contributor. However, the MD structure of the dodecamer d(CGCGAATTCGCG) is not highly sensitive to whether there is a sodium ion in the minor groove.     

Sequence learning: what's the hippocampus to do?

The medial temporal lobe is crucial for some forms of memory, but its role in implicit learning has remained in question. A brain imaging study by Schendan et al., in this issue of Neuron, provides direct evidence of medial temporal lobe activation during implicit learning of motor sequences.     

What role for DNA damage and repair in the bystander response?

The radiation-induced bystander effect challenges the accepted paradigm of direct DNA damage in response to energy deposition driving the biological consequences of radiation exposure. With the bystander response, cells which have not been directly exposed to radiation respond to their neighbours being targeted. In our own studies we have used novel targeted microbeam approaches to specifically irradiate parts of individual cells within a population to quantify the bystander response and obtain mechanistic information. Using this approach it has become clear that energy deposited by radiation in nuclear DNA is not required to trigger the effect, with cytoplasmic irradiation required. Irradiated cells also trigger a bystander response regardless of whether they themselves live or die, suggesting that the phenotype of the targeted cell is not a determining factor. Despite this however, a range of evidence has shown that repair status is important for dealing with the consequences of a bystander signal. Importantly, repair processes involved in the processing of dsb appear to be involved suggesting that the bystander response involves the delayed or indirect production of dsb-type lesions in bystander cells. Whether these are infact true dsb or complexes of oxidised bases in combination with strand breaks and the mechanisms for their formation, remains to be elucidated.     

Inducibility of error-prone DNA repair in yeast?

Whereas some experimental evidence suggests that mutagenesis in yeast after treatment with DNA-damaging agents involves inducible functions, a general-acting error-prone repair activity analogous to the SOS system of Escherichia coli has not yet been demonstrated. The current literature on the problem of inducibility of mutagenic repair in yeast is reviewed with emphasis on the differences in the experimental procedures applied.     

Genetic polymorphisms in the DNA repair gene XRCC1 and susceptibility to glioma in a Han population in northeastern China: A case–control study

Background

Several single nucleotide polymorphisms (SNPs) in the X-ray cross-complementing group 1 (XRCC1) gene have been shown to influence DNA repair and to modify cancer susceptibility. To investigate the role of these loci further, we examined the association of three XRCC1 polymorphisms with the risk of gliomas in a Han population in northeastern China.

Methods

Using a PCR–RFLP method, XRCC1 Arg194Trp, Arg280His and Arg399Gln were genotyped in 624 glioma patients and 580 healthy controls.

Results

Significant differences in the distribution of the Arg399Gln allele were detected between glioma patients and healthy controls by a logistic regression analysis (OR = 1.35, 95%CI 1.17–1.68, P = 0.001). Our data also revealed that the Arg399Gln variant (allele A) carriers had an increased glioma risk compared to the wild-type (allele G) homozygous carriers (OR = 1.40, 95%CI 1.12–1.76, P = 0.003).

Conclusions

These results suggest that the XRCC1 Arg399Gln might influence the risk of developing glioma in a Han population in northeastern Chinese.     

IAPs: what's in a name?

Originally described in insect viruses, cellular proteins with Baculoviral IAP repeat (BIR) motifs have been thought to function primarily as inhibitors of apoptosis. The subsequent finding that a subset of IAPs that contain a RING domain have ubiquitin protein ligase (E3) activity implied the presence of other functions. It is now known that IAPs are involved in mitotic chromosome segregation, cellular morphogenesis, copper homeostasis, and intracellular signaling. Here, we review the current understanding of the roles of IAPs in apoptotic and nonapoptotic processes and explore the notion that the latter represents the primary physiologic activities of IAPs.     

Wnt: what's needed to maintain pluripotency?

A precise role for the canonical Wnt pathway in maintaining pluripotency in mouse embryonic stem cells (mESCs) has been debated. Four recent reports add pieces to the puzzle and together these results may help establish a robust model.     

MUTYH and the mismatch repair system: partners in crime?

Biallelic germline mutations of MUTYH—a gene encoding a base excision repair protein—are associated with an increased susceptibility of colorectal cancer. Whether monoallelic MUTYH mutations also increase cancer risk is not yet clear, although there is some evidence suggesting a slight increase of risk. As the MUTYH protein interacts with the mismatch repair (MMR) system, we hypothesised that the combination of a monoallelic MUTYH mutation with an MMR gene mutation increases cancer risk. We therefore investigated the prevalence of monoallelic MUTYH mutations in carriers of a germline MMR mutation: 40 carriers of a truncating mutation (group I) and 36 of a missense mutation (group II). These patients had been diagnosed with either colorectal or endometrial cancer. We compared their MUTYH mutation frequencies with those observed in a group of 134 Dutch colorectal and endometrial cancer patients without an MMR gene mutation (0.7%) and those reported for Caucasian controls (1.5%). In group I one monoallelic MUTYH mutation was found (2.5%). In group II five monoallelic germline MUTYH mutations were found (14%), four of them in MSH6 missense mutation carriers (20%). Of all patients with an MMR gene mutation, only those with a missense mutation showed a significantly higher frequency of (monoallelic) MUTYH mutations than the Dutch cancer patients without MMR gene mutations (P=0.002) and the published controls (P=0.001). These results warrant further study to test the hypothesis of mutations in MMR genes (in particular MSH6) and MUTYH acting together to increase cancer risk.     

Adding synchrotron radiation to infrared microspectroscopy: what's new in biomedical applications?

Infrared spectroscopy and microscopy have heralded a period of rapid advances in tissue and cellular characterization during the past decade. However, vibrational spectroscopy is still an analytical tool that is neither familiar nor understood in the medical environment. For many years this field has been mainly driven by physicists and chemists, who are, undoubtedly, at the forefront of tremendous technical developments in technology, detection and data treatment. Although the theory of infrared (IR) spectroscopy is thoroughly worked out, the scientific ground of vibrational spectroscopy is now undergoing a real boost, with the application of this analytical technique in biology and biomedicine.     

Stereoscopic vision: what's the first step?

Neurons in primary visual cortex respond to binocular disparity, the raw material of stereoscopic depth perception. Although these neurons are probably essential to depth perception, a recent study has shown that they are unable to compute depth itself.     

DNA from formalin-fixed tissue: extraction or repair? That is the question

Establishing effective DNA-based protocols for use on archival material fixed in formaldehyde (formalin) is a particularly challenging task. Formalin fixation induces cross-linking with nucleic acids and proteins, thereby reducing the amount and quality of the extracted DNA. Previous attempts have primarily focused on optimizing DNA extraction protocols. Here we focus on the use of enzymes capable of in vitro repair of DNA extracts prior to amplification of the nucleic acids by the polymerase chain reaction (PCR). The amplification success of mitochondrial DNA was greater using the repair enzyme assay (56%) than with the regular PCR assay (20%), and even more convincing results were obtained with the amplified nuclear ribosomal region (91% versus 21%). These results indicate that in vitro repair of DNA damage (depurinated sites, strand nicks and base modifications) increases the number of samples that amplify, amplify to a greater extent and amplify fewer ancillary bands and that DNA repair has been overlooked as a way of improving the efficiency of molecular methods used on formalin-fixed samples. Fidelity has not been specifically investigated, but preliminary results indicate that misincorporation is not a major problem.