Heterogeneity within and between primary colorectal carcinomas and matched metastases as revealed by analysis of Ki-ras and p53 mutations

Analysis of the genetic status of Ki-ras and p53 in primary colorectal carcinomas and matched colorectal liver metastasis from 30 patients reveals an overall heterogeneity both within and between the two tumoral tissues. Both genes were found mutated with a similar frequency in both tissues; however, identical mutations in primary tumor and matched metastasis were found less frequently in the case of the Ki-ras than the p53 gene. Only in three cases the same p53 and Ki-ras mutations found in the primary tumor were found also in the metastasis. In several metastatic specimens the DNA bearing a mutation detected also in the primary tumor appears significantly less abundant than the wild-type DNA. These data are discussed in the light of current models of primary tumor/metastasis relationships.     

Prognostic significance of proliferative activity, DNA-ploidy, p53 and Ki-ras point mutations in colorectal liver metastases

Abstract. Paired colorectal liver metastases (CLM) and normal tissue samples from a consecutive series of 36 patients were studied prospectively. MIB-1 expression was studied by immunohistochemistry on paraffin-embedded sections. DNA ploidy and S-phase fraction (SPF) measurements were performed by flow cytometry on frozen tissues. Mutations within the p53 (exons 5-8) and c-Ki-ras (codons 12 and 13) genes were detected by PCR single-strand conformation polymorphism analysis followed by sequencing. A high correlation was observed between the MIB-1 LI and SPF value (rho=0·81; P<0·01). Moreover, p53 gene mutations were associated with either high MIB-1 LI and high SPF. In univariate analysis, SPF and MIB-1 levels were related to risk of death. The association between overall survival and DNA-ploidy or p53 mutations did not reach statistical significance, but a slightly better survival was observed for patients either with DNA-diploid tumours or without mutations ( P =0·05 and P =0.06, respectively). SPF was shown by multivariate Cox model analysis to be an independent prognostic variable and thus it might be a useful prognostic factor in patients with CLM.     

Prognostic significance of proliferative activity, DNA-ploidy, p53 and Ki-ras point mutations in colorectal liver metastases

Paired colorectal liver metastases (CLM) and normal tissue samples from a consecutive series of 36 patients were studied prospectively. MIB-1 expression was studied by immunohistochemistry on paraffin-embedded sections. DNA ploidy and S-phase fraction (SPF) measurements were performed by flow cytometry on frozen tissues. Mutations within the p53 (exons 5-8) and c- Ki-ras (codons 12 and 13) genes were detected by PCR single-strand conformation polymorphism analysis followed by sequencing. A high correlation was observed between the MIB-1 LI and SPF value (rho=0.81; P <0.01). Moreover, p53 gene mutations were associated with either high MIB-1 LI and high SPF. In univariate analysis, SPF and MIB-1 levels were related to risk of death. The association between overall survival and DNA-ploidy or p53 mutations did not reach statistical significance, but a slightly better survival was observed for patients either with DNA-diploid tumours or without mutations ( P =0.05 and P =0.06, respectively). SPF was shown by multivariate Cox model analysis to be an independent prognostic variable and thus it might be a useful prognostic factor in patients with CLM.     

Quadruplex DNA formation in a region of the tRNA gene supF associated with hydrogen peroxide mediated mutations

A hot spot for H2O2/Fe-mediated mutation has been observed between bases 154 and 170 of the supF gene in the mutation reporter plasmid pZ189 [Moraes et al. (1990) Carcinogenesis 11, 283; Akman et al. (1991) Mutat. Res. (in press)]. To further characterize this hot spot, we synthesized the 33mer d(pAAAGTGATGGTGGTGGGGGAAGGATTCGAACCT) (pZ33), which is complementary to bases 159-191 of the supF gene. pZ33 annealed spontaneously in 10 mM Tris-HCl (pH 8.0)-1 mM EDTA-100 mM NaCl at 50 degrees C into two major forms, one of which migrates more slowly than does d(pT)33 on nondenaturing 12% polyacrylamide gels. We propose that this form is a four-stranded structure stabilized by Hoogsteen-type deoxyguanosine quartets involving all deoxyguanosines of the sequence d-(pGGTGGTGGGGG) because of the following. (1) pZ33 migrates as a single form that comigrates with d(pT)33 on denaturing 20% acrylamide-8 M urea gels. (2) Annealing an equimolar mixture of 5'-32P-labeled pZ33 and the oligodeoxynucleotide d(pTTTTTTTTpZ33TTTTTTTT) (pZ49), as well as 5'-32P-labeled pZ49 and pZ33, caused the formation of four, discreet slowly migrating bands on nondenaturing 12% polyacrylamide gels. Mixing 5'-32P-labeled pZ33 with 5'-32P-labeled pZ49 resulted in five slowly migrating bands. (3) An oligodeoxynucleotide identical with pZ33 except that every deoxyguanosine has been replaced with deoxyinosine did not anneal into a slowly migrating form. (4) Dimethyl sulfate protection studies demonstrated that all deoxyguanosines of the sequence d(pGGTGGTGGGGG) were protected at N-7 in the slowly migrating form but not in single-stranded pZ33. These data suggest that a hot spot for H2O2/Fe-mediated base substitutions is located adjacent to a sequence that can spontaneously adopt a quadruplex structure in which deoxyguanosine quartets are Hoogsteen bonded.     

Exclusive KRAS mutation in microsatellite-unstable human colorectal carcinomas with sequence alterations in the DNA mismatch repair gene, MLH1

Microsatellite instability (MSI) is regarded as reflecting defective DNA mismatch repair (MMR). MMR defects lead to an increase in point mutations, as well as repeat instability, on the genome. However, despite the highly unstable microsatellites, base substitutions in representative oncogenes or tumor suppressors are extremely infrequent in MSI-positive tumors. Recently, the heterogeneity in MSI-positive colorectal tumors is pointed out, and the 'hereditary' and 'sporadic settings' are proposed. Particularly in the former, base substitution mutations in KRAS are regarded as relatively frequent. We sequenced the KRAS gene in a panel of 76 human colorectal carcinomas in which the MSI status has been determined. KRAS mutations were detected in 22 tumors (28.9%). Intriguingly, all of the KRAS-mutant MSI-H (high) tumors harbored sequence alterations in an essential MMR gene, MLH1, which implies that KRAS mutation more frequently and almost exclusively occurs in MMR gene-mutant MSI-H tumors. Furthermore, in contrast with the prevailing viewpoint, some of these tumors are derived from sporadic colorectal cancer patients. The tight connection between MMR gene mutation and KRAS mutation may suggest previously unrecognized complexities in the relationship between MSI and the mutator phenotype derived from defective MMR.     

Molecular cloning and chromosomal localization of DNA sequences associated with a human DNA repair gene.

The genes and gene products involved in the mammalian DNA repair processes have yet to be identified. Toward this end we made use of a number of DNA repair-proficient transformants that were generated after transfection of DNA from repair-proficient human cells into a mutant hamster line that is defective in the initial incision step of the excision repair process. In this report, biochemical evidence is presented that demonstrates that these transformants are repair proficient. In addition, we describe the molecular identification and cloning of unique DNA sequences closely associated with the transfected human DNA repair gene and demonstrate the presence of homologous DNA sequences in human cells and in the repair-proficient DNA transformants. The chromosomal location of these sequences was determined by using a panel of rodent-human somatic cell hybrids. Both unique DNA sequences were found to be on human chromosome 19.     

Cloning of the gene for myxobacterial hemagglutinin and isolation and analysis of structural gene mutations.

Myxobacterial hemagglutinin (MBHA) is a major developmentally induced protein that accumulates during the period of cellular aggregation in the bacterium Myxococcus xanthus. It has been shown that this lectin is targeted to the cell surface and periplasmic space of developmental cells, suggesting that it may play a role in cell-cell recognition or agglutination. We have cloned the structural gene for MBHA by using synthetic deoxyoligonucleotides containing sequences deduced from the amino acid sequence of MBHA and have used the cloned gene to construct strains of M. xanthus that cannot synthesize MBHA. We found that although the MBHA-deficient strains are delayed in their developmental time course, they are otherwise able to aggregate and sporulate normally. Our results suggest that MBHA may function to increase the efficiency of fruiting-body formation but is not a critical component of cellular aggregation.     

Analysis of DNA damage and repair accompanying differentiation in the intestinal crypt.

The ability to process damaged DNA may vary between cells depending on their differentiated status. However, there is little in vivo data available and it is not intuitively obvious how the activity of specific repair pathways may vary between different subpopulations (e.g. stem cells and proliferative, committed and differentiated cells) of a particular tissue. To obtain such information for the intestinal epithelium, we have developed an assay that detects differences in the way different regions of the crypt (stem, proliferative and maturation zones) respond to DNA damage. The assay is a variant of the ''comet'' assay, which detects DNA strand breaks by measuring the proportion of DNA migrating from individual cells, or in this case intact isolated crypts, in an electrophoretic field. The method is quantitative, with the amount of migrating DNA being proportional to the number of strand breaks. Isolated crypts are repair competent and spatial differences are apparent with some agents. The assay has the potential to characterize the repair properties of cells at different stages of differentiation within the crypt, determine the characteristics that might predispose them to damage and may help in understanding the route of stem cell mutation.     

A patient with type 2 diabetes mellitus associated with mutations in calcium sensing receptor gene and mitochondrial DNA

A 44-year-old female with familial hypocalciuric hypercalcemia (FHH) due to a homozygous missense mutation (Pro40Ala) in calcium sensing receptor (CaSR) gene has type 2 diabetes mellitus. The identical heterozygous mutation of CaSR gene was observed in consanguineous parents and all other family members examined except her two sisters. Many subjects with abnormal glucose tolerance were observed in this family, which is compatible with maternal inheritance. Mitochondrial function of complex I (NADH-coenzyme Q reductase) activity in cybrid cells between mitochondrial DNA (mtDNA)-deleted (rho(0)) HeLa cells and mtDNA from the proband was decreased by 35%. The proband has eight substitutions and among these 4833 A/G is a missense substitution in NADH dehydrogenase 2 gene and may probably be a major pathogenic mutation of impaired complex I activity. These results suggest that coexistence of nuclear gene and mtDNA mutations may have caused or modified the development of abnormal glucose tolerance in this family.     

Liver-specific expression of a Qa-encoded class I gene is associated with DNA hypomethylation.

DNA methylation of two murine major histocompatibility complex (H-2) class I genes was examined in hybridizations to MspI and HpaII chromosomal DNA restriction digests. Q10, which exhibits liver-specific expression, and H-2Kb, a transplantation antigen gene, were examined in liver, spleen, thymus, and cell-line DNAs. Unmethylated Q10 gene sequences were detected only in the liver, whereas the H-2Kb gene was unmethylated in all tissues examined.     

Sensitive detection of p53 gene mutations by a 'mutant enriched' PCR-SSCP technique.

For the rapid and sensitive detection of p53 'hot spot' mutations, we combined polymerase chain reaction based single-strand conformational polymorphism (PCR-SSCP) analysis with sequence specific-clamping by peptide nucleic acids (PNAs) in a one-step reaction tube protocol. For this purpose, we designed two PNA molecules comprising aa 246-250 of exon 7 and aa 270-275 of exon 8, respectively, to suppress the amplification of wild-type p53 allelic variants during PCR amplification. Using this method in a survey of 20 brush cytology samples from lung cancer patients, we were able to detect five p53 point mutations occurring in codons 248, 249 and 273 which could not be retrieved by conventional PCR-SSCP. Thus, allelic suppression by PNA molecules opens a way to largely improve the sensitivity of existing PCR-SSCP protocols (approximately 10-50-fold) and could be useful in the detection of 'hot spot' oncogene lesions in histological samples containing only a small number of cancer cells.     

Rapid isolation of flanking genomic DNA using biotin-RAGE, a variation of single-sided polymerase chain reaction.

A method is described for quickly and reproducibly isolating genomic DNA contiguous with known DNA sequence by means of the polymerase chain reaction (PCR). Flanking genomic DNA is isolated using a biotinylated sequence-specific primer in combination with a generic hybrid primer that binds to a deoxyoligonucleotide sequence artificially added to the ends of the genomic DNA. Amplified sequences that include the biotinylated primer are purified from nonbiotinylated amplification products by binding to a solid-phase streptavidin matrix. The biotinylated amplification product(s) are subjected to a further round of amplification, after which they can be subcloned and analyzed. This technique was applied to the isolation of three intron-exon junctions. Verification of the identify of these junction sequences was accomplished by designing primers based on the intron sequences isolated by Biotin-RAGE, amplifying across the exon using these intron primers, and sequencing the PCR-generated product.     

Identification, mapping, and application of polymorphic DNA associated with resistance gene Pm21 of wheat.

A new powdery mildew resistance gene designated Pm21, from Haynaldia villosa, a relative of wheat, has been identified and incorporated into wheat through an alien translocation line. Cytogenetic and biochemical analyses showed that chromosome arms 6VS and 6AL were involved in this translocation. Random amplified polymorphic DNA (RAPD) analysis was performed on recipient wheat cultivar Yangmai 5, the translocation line, and H. villosa with 180 random primers. Eight of the 180 primers amplified polymorphic DNA in the translocation line, and the same results were obtained in four replications. Furthermore, RAPD analysis was reported for substitution line 6V, seven addition lines (1V-7V), and the F1, as well as F2 plants of (translocation line x 'Yangmai 5'), using two of the eight random primers. One RAPD marker, specific to chromosome arm 6VS, OPH17-1900, could be used as a molecular marker for the detection of gene Pm21 in breeding materials with powdery mildew resistance introduced from H. villosa. Key words : RAPD analysis, 6VS-specific marker, Pm21, Erysiphe graminis f.sp. tritici, Triticum aestivum - Haynaldia villosa translocation.     

The detection of beta-globin gene mutations in beta-thalassemia using oligonucleotide probes and amplified DNA

DNA amplification combined with the use of synthetic oligonucleotide probes has become an important tool in the identification of base substitutions. We report the use of this DNA amplification technique for the detection of mutations in beta-thalassemia. A series of oligonucleotide primers are synthesized which span the beta-globin gene; one primer is complementary to the coding strand and the other to the non-coding strand. The primers are chosen so that there is little homology with other DNA segments, especially the delta gene. Each set of primers spans an area of the gene between 100 and 300 bp, while the suspected mutation point is located between these two primers. With the use of such a primer set, the beta-globin gene region is amplified by denaturation, annealing and DNA synthesis. The amplification cycle is repeated 25-30 times, using the Klenow fragment of DNA polymerase I. The resulting amplified DNA is hybridized with normal and synthetic deoxynucleotide probes using a standard dot-blot method. We have designed a set of primers and experimental conditions which should prove useful to diagnostic centers for detection of numerous beta-thalassemia mutations.     

Relative DNA content in diploid,polyploid, and multiploid species of <Emphasis Type="Italic">Paspalum</Emphasis> (Poaceae) with relation to reproductive mode and taxonomy

It is generally accepted that polyploids have downsized basic genomes rather than additive values with respect to their related diploids. Changes in genome size have been reported in correlation with several biological characteristics. About 75 % of around 350 species recognized for Paspalum (Poaceae) are polyploid and most polyploids are apomictic. Multiploid species are common with most of them bearing sexual diploid and apomictic tetraploid or other ploidy levels. DNA content in the embryo and the endosperm was measured by flow cytometry in a seed-by-seed analysis of 47 species including 77 different entities. The relative DNA content of the embryo informed the genome size of the accession while the embryo:endosperm ratio of DNA content revealed its reproductive mode. The genome sizes (2C-value) varied from 0.5 to 6.5 pg and for 29 species were measured for the first time. Flow cytometry provided new information on the reproductive mode for 12 species and one botanical variety and supplied new data for 10 species concerning cytotypes reported for the first time. There was no significant difference between the mean basic genome sizes (1Cx-values) of 32 sexual and 45 apomictic entities. Seventeen entities were diploid and 60 were polyploids with different degrees. There were no clear patterns of changes in 1Cx-values due to polyploidy or reproductive systems, and the existing variations are in concordance with subgeneric taxonomical grouping.