The Klebsiella aerogenes glutamate dehydrogenase (gdhA) gene: cloning, high-level expression and hybrid enzyme formation in Escherichia coli

Summary The NADP-dependent glutamate dehydrogenase gene of Klebsiella aerogenes was cloned in E. coli in the expression plasmid pRK9. The cloned gene shows a high level of expression in E. coli in the hybrid plasmid pKG3 and such expression is independent of the vector promoter, as shown by experiments in which the promoter was deleted. Active hybrid GDH hexamers were shown in cell-free extracts of an E. coli strain carrying cloned gdhA genes of both E. coli and K. aerogenes. The nucleotide sequence of the N-terminal coding region of the K. aerogenes gdhA gene was determined and found to be strongly homologous with that of E. coli.Abbreviations GDH glutamate dehydrogenase - PMS phenazine methosulphate - MTT 3-(4,5-Dimethylthiazolyl-2)-2,5-diphenyltetrazolium-bromide - PMSF phenylmethylsulphonylfluoride - SSC standard saline citrate - DTT dithiothreitol - bp base pairs - kbp kilo base pairs - dNTP deoxynucleoside triphosphate     

Ribitol dehydrogenase of Klebsiella aerogenes. Sequence of the structural gene.

The ribitol dehydrogenase gene was cloned from wild-type Klebsiella aerogenes and also from a transducing phage lambda prbt which expresses the rbt operon constitutively. The coding sequence for 249 amino acids is separated from the following D-ribulokinase gene by 31 base pairs containing three stop codons, one of which overlaps the ribosome binding site for D-ribulokinase. Three residues in the amino acid sequence differ from that predicted from the DNA sequence: Asp-212 for Asn-212 is probably a protein sequencing error, but -Ala-Val- for -Ser-Ser- at 146-147 appears to be a 'neutral mutation' that may have arisen during prolonged chemostat selection of a strain that superproduces the enzyme from which the protein sequence was determined.     

Genetic characterization of the glutamate dehydrogenase gene (gdhA) of Salmonella typhimurium.

Salmonella typhimurium mutants, either devoid or glutamate dehydrogenase activity or having a thermolabile glutamate dehydrogenase protein, were used to identify the structural gene (gdhA) for this enzyme. Transductions showed that the mutations producing these phenotypes were linked to both the pncA and nit genes, placing the gdhA locus between 23 and 30 U on the S. typhimurium chromosome. Additional transductions with several Tn10 insertions established the gene order as pncA-gdhA-nit. Since few genetic markers exist in this region of the chromosome, Hfr strains were constructed to orient the pncA-gdhA-nit cluster with outside genes. Conjugation experiments provided evidence for the gene order pyrD-pncA-gdhA-nit-trp. To further characterize gdhA, we used Mu cts d1 (Apr lac) insertions in this gene to select numerous strains containing deletions with various endpoints. Transductions of these deletions with strains containing different gdh mutations and with a mutant having a thermolabile glutamate dehydrogenase protein permitted us to construct a deletion map of the gdhA region.     

Cloning and characterization of gdhA, the structural gene for glutamate dehydrogenase of Salmonella typhimurium.

Glutamic acid is synthesized in enteric bacteria by either glutamate dehydrogenase or by the coupled activities of glutamate synthase and glutamine synthetase. A hybrid plasmid containing a fragment of the Salmonella typhimurium chromosome cloned into pBR328 restores growth of glutamate auxotrophs of S. typhimurium and Escherichia coli strains which have mutations in the genes for glutamate dehydrogenase and glutamate synthase. A 2.2-kilobase pair region was shown by complementation analysis, enzyme activity measurements, and the maxicell protein synthesizing system to carry the entire glutamate dehydrogenase structural gene, gdhA. Glutamate dehydrogenase encoded by gdhA carried on recombinant plasmids was elevated 5- to over 100-fold in S. typhimurium or E. coli cells and was regulated in both organisms. The gdhA promoter was located by recombination studies and by the in vitro fusion to, and activation of, a promoter-deficient galK gene. Additionally, S. typhimurium gdhA DNA was shown to hybridize to single restriction fragments of chromosomes from other enteric bacteria and from Saccharomyces cerevisiae.     

Identification of the structural gene for glutamine synthetase in Klebsiella aerogenes.

Mutations at two sites of the Klebsiella aerogenes chromosome, unlinked by transduction with phages PW52 and P1, result in the lack of enzymatically active glutamine synthetase. A mutation in the glnB site leads to a marked decrease in the formation of an apparently normal enzyme. Some of the mutations in the glnA site lead to the production of enzymatically inactive material capable of reacting with anti-glutamine synthetase serum. The revertant of a glnA mutant was found to produce a glutamine synthetase with less activity and less stability to heat than the enzyme of the wild type. These results locate the structural gene to the production of enzymatically inactive glutamine synthetase antigen, not subject to repression by exogenously added ammonia. This observation suggests that glutamine synthetase is itself involved in the regulation of the synthesis of glutamine synthetase.     

Regulatory mutations in the Klebsiella aerogenes structural gene for glutamine synthetase.

Glutamine synthetase could be repressed several hundredfold rather than 6- to 10-fold as previously reported. Ammonia was not the primary repression signal for glutamine synthetase. Repression appeared to be mediated by a high level of glutamine and probably by a high ratio of glutamine to alpha-ketoglutarate. Mutations in glnA (the structural gene for glutamine synthetase) were seen to fall into three phenotypic groups: glutamine auxotrophs that produced no detectable glnA product; glutamine auxotrophs that produced a glnA product lacking enzymatic activity (and hence repressibility by ammonia) but were repressible under appropriate conditions; and glutamine synthetase regulatory mutants, whose glnA product was enzymatically active and not repressible under any conditions.     

A mass-spectrometric sequence study of the enzyme ribitol dehydrogenase from Klebsiella aerogenes

The first detailed results of the application of a low-resolution mixture analysis approach to the sequence analysis of an enzyme, ribitol dehydrogenase, are given. Examples of the interpretation of the spectra of peptide mixtures derived from this protein are described. Evidence for new fragmentation patterns observed is reported, together with an explanation of the generation of ambiguous sequences by use of a low-specificity enzyme, thermolysin. The overall sequencing strategy evolved is assessed.     

Selective inhibition of Klebsiella aerogenes growth on pentoses by pentitols.

Selective inhibition of growth by pentitols was observed when Klebsiella aerogenes M-7 which could not utilize pentitols was grown on pentoses. D-Arabitol inhibited the growth on D-arabinose as a sole carbon source, but had no effect on the growth on L-arabinose, D-xylose, and D-ribose. Similarly, L-arabitol inhibited the growth on D-arabinose and L-arabinose, ribitol inhibited the growth on D-arabinose and L-arabinose, and xylitol inhibited the growth on D-xylose. From the following reasons, we postulated that the selective growth inhibition by pentitols was due to the competitive inhibition of pentose isomerase reaction by the cell by pentitols. (i) D-Arabinose transport activity was not inhibited by pentitols. (ii) Induction of D-arabinose and L-arabinose isomerases was not inhibited by D- and L-arabitol, respectively. (iii) The specificity of growth inhibition by pentitols was the same as that of competitive inhibition of pentose isomerases by pentitols.     

Expression of the bacterial gdhA gene encoding a NADPH glutamate dehydrogenase in tobacco affects plant growth and development

We investigated the effects of genetic modification of nitrogen metabolism via the bacterial glutamate dehydrogenase (GDH) on plant growth and metabolism. The gdhA gene from Escherichia coli encoding a NADPH-GDH was expressed in tobacco plants under the control of the 35 S promoter. The specific activity of GDH in gdhA plants was 8-fold of that in E. coli. Damage caused by spray application of 1.35 mM of phosphinothricin (PPT) herbicide, a glutamine synthetase (GS) inhibitor, was less pronounced in gdhA plants as compared with the control plants which suggests that the introduced GDH can assimilate some of the excess ammonium, at least during GS inhibition. However, gdhA plants were susceptible to 2.7 mM PPT. Biomass production was consistently increased in gdhA transgenic plants grown under controlled conditions and in the field. Total free amino acids and total carbohydrates were increased in gdhA plants grown in the greenhouse suggesting that both nitrogen and carbon metabolism were altered. We conclude that the modifications in transgenic plants may result from both increased nitrogen efficiency and altered gene expression and metabolism. This revised version was published online in June 2006 with corrections to the Cover Date.     

Identification of the hutUH operator (hutUo) from Klebsiella aerogenes by DNA deletion analysis.

Expression of Klebsiella aerogenes histidine utilization operons hutUH and hutIG is negatively regulated by the product of hutC. Multiple copies of the hutUH promoter region [hut(P)] present in trans were able to titrate the limited amount of host-encoded hut repressor (HutC). Thus, the hut(P) region contains a specific binding site for HutC. To identify DNA sequences required for HutC titration, we constructed and characterized a set of 40 left-entering and 28 right-entering deletions within a 250-bp DNA sequence containing the hut(P) region. Mutants carrying deletions that altered a unique dyad symmetric sequence, ATGCTTGTATAGACAAGTAT, from -11 to -30 relative to the hutUH promoter (hutUp) were unable to titrate hut repressor; mutants carrying deletions that left this sequence intact retained their ability to titrate hut repressor. Thus, we identify ATGCTTGT ACAAGTAT as the hutUH operator.     

The glutamate dehydrogenase structural gene of Escherichin coli

Summary The glutamate dehydrogenase structural gene, gdhA, was mapped at 38.6 min on the genetic map and at 1860 kb on the physical map. A detailed map of this region is presented.