Attachment of reporter groups to specific, selected cytidine residues in RNA using a bisulfite-catalyzed transamination reaction.

Bisulfite catalyzes transamination of cytidine at the N4 position; the suitability of this reaction for attaching reporter groups to selected cytidine residues in RNA molecules has been investigated. Poly(C) is nearly quantitatively converted to the poly (N4 aminoethyl-C) derivative after 3 hrs at 42 degrees C with ethylene diamine (pK1 = 7.6) and bisulfite. This derivative reacts quantitatively with N-hydroxysuccinimide esters; the linkage of a fluorescent dye, nitrobenzofurazan, to cytidine by this reaction is demonstrated. To direct the bisulfite reaction to selected cytidines within a large RNA molecule, the RNA is hybridized to complementary DNA containing a deletion. Only the cytidines in the single strand RNA loop (corresponding to the DNA deletion) are reactive. Two cytidines in the middle of a 340 base RNA fragment from 16S ribosomal RNA have been modified by this technique.     

Evidence on the conformation of HeLa-cell 5.8S ribosomal ribonucleic acid from the reaction of specific cytidine residues with sodium bisulphite.

The reaction of HeLa-cell 5.8S rRNA with NaHSO3 under conditions in which exposed cytidine residues are deaminated to uridine was studied. It was possible to estimate the reactivities of most of the 46 cytidine residues in the nucleotide sequence by comparing 'fingerprints' of the bisulphite-treated RNA with those of untreated RNA. The findings were consistent with the main features of the secondary-structure model for mammalian 5.85S rRNA proposed by Nazar, Sitz, & Busch [J. Biol. Chem (1975) 250, 8591--8597]. Five out of six regions that are depicted in the model as single-stranded loops contain cytidine residues that are reactive towards bisulphite at 25 degrees C (the other loop contains no cytidine). The cytidine residue nearest to the 3'-terminus is also reactive. Several cytidines residues that are internally located within proposed double-helical regions show little or no reactivity towards bisulphite, but the cytidine residues of several C.G pairs at the ends of helical regions show some reactivity, and one of the proposed loops appears to contain six nucleotides, rather than the minimum of four suggested by the primary structure. Two cytidine residues that are thought to be 'looped out' by small helix imperfections also show some reactivity.     

Importance of tRNA interactions with 23S rRNA for peptide bond formation on the ribosome: studies with substrate analogs

The major enzymatic activity of the ribosome is the catalysis of peptide bond formation. The active site -- the peptidyl transferase center -- is composed of ribosomal RNA (rRNA), and interactions between rRNA and the reactants, peptidyl-tRNA and aminoacyl-tRNA, are crucial for the reaction to proceed rapidly and efficiently. Here, we describe the influence of rRNA interactions with cytidine residues in A-site substrate analogs (C-puromycin or CC-puromycin), mimicking C74 and C75 of tRNA on the reaction. Base-pairing of C75 with G2553 of 23S rRNA accelerates peptide bond formation, presumably by stabilizing the peptidyl transferase center in its productive conformation. When C74 is also present in the substrate analog, the reaction is slowed down considerably, indicating a slow step in substrate binding to the active site, which limits the reaction rate. The tRNA-rRNA interactions lead to a robust reaction that is insensitive to pH changes or base substitutions in 23S rRNA at the active site of the ribosome.     

Ribonuclease-resistance patterns of RNA from L1210 cells.

Ribonuclease resistance of RNA from mammalian cells was studied as a possible measure of the extent of base pairing. Ribonuclease-sensitive and resistant components of the RNA were discerned from the biphasic kinetics of the ribonuclease reaction. The amount of resistant component increased progressively with increasing salt concentration until it comprised 20–40% of the total RNA. Comparisons between different RNA fractions from L1210 cells revealed differences in the content of resistant component, in the order: nucleolar ribosomal-precursor RNA > mature ribosomal RNA > nucleoplasmic RNA. In each RNA fraction, the amount of resistant component was greater when measured by a cytidine label than by a uridine label. Comparison with known double-stranded RNA indicated that the bulk of the resistant component consists of lessstable structures, such as short or imperfect helices.     

Structure and function of 5S ribosomal ribonucleic acid from Torulopsis utilis. IV. Detection of exposed guanine residues by chemical modification with kethoxal

The reaction of Torulopsis (Candida) utilis 5S ribosomal RNA with kethoxal (beta-ethoxy-alpha-ketobutyraldehyde) was studied in an attempt to identify the exposed guanine residues. At most 7-8 out of 32 guanine residues in T.utilis 5S RNA were kethoxalated after reaction at 37 degrees C for 4 h in the presence of magnesium ions. Localization of the kethoxalated guanine residues in T.utilis 5S RNA was achieved by sequence analyses of RNase T1 digests of the kethoxalated 5S RNA. These analyses showed that residues G37, G57, G91, and some of the three guanine residues G80, G82, and G85, are the most accessible sites. Residues G30, G41, and G49 also reacted with kethoxal though less strongly. These results are for the most part compatible with our secondary structure model for T.utilis 5S 5S RNA (Nishikawa and Takemura (1974) J. Biochem. 76, 935-947). However, partial formation of some hydrogen bonds within the loop region of the model seems to be necessary to explain the inaccessibility of residue G101 to kethoxal. The results are also discussed in comparison with those of similar studies on E.coli 5S RNA.     

The role of tyrosine residues in the RNA N-glycosidase activity of cinnamomin A-chain

Cinnamomin is a type II ribosome-inactivating protein (RIP) and its A-chain (CTA) is a RNA N-glycosidase. It is observed that modification of tyrosine residues by N-acetylimidazole (N-AI) causes almost complete loss of CTA activity. Adenine partially protects tyrosine residues from modification by N-AI. It is proposed that tyrosine residues are involved in the active site of CTA and they are crucial in recognition and binding of ribosomal RNA. Tryptophan residues of CTA are also studied by NBS modification.     

Solution structure of a luteoviral P1-P2 frameshifting mRNA pseudoknot

A hairpin-type messenger RNA pseudoknot from pea enation mosaic virus RNA1 (PEMV-1) regulates the efficiency of programmed -1 ribosomal frameshifting. The solution structure and 15N relaxation rates reveal that the PEMV-1 pseudoknot is a compact-folded structure composed almost entirely of RNA triple helix. A three nucleotide reverse turn in loop 1 positions a protonated cytidine, C(10), in the correct orientation to form an A((n-1)).C(+).G-C(n) major groove base quadruple, like that found in the beet western yellows virus pseudoknot and the hepatitis delta virus ribozyme, despite distinct structural contexts. A novel loop 2-loop 1 A.U Hoogsteen base-pair stacks on the C(10)(+).G(28) base-pair of the A(12).C(10)(+).G(28)-C(13) quadruple and forms a wedge between the pseudoknot stems stabilizing a bent and over-rotated global conformation. Substitution of key nucleotides that stabilize the unique conformation of the PEMV-1 pseudoknot greatly reduces ribosomal frameshifting efficacy.     

Inhibition of restriction endonuclease cleavage by triple helix formation with RNA and 2'-O-methyl RNA oligonucleotides containing 8-oxo-adenosine in place of cytidine.

The ability of homopyrimidine oligoribonucleotides (RNA) and oligo-2'-O-methyl-ribonucleotides (2'-O-methyl RNA) containing 8-oxo-adenosine (AOH) and 8-oxo-2'-O-methyl (AmOH) adenosine to form stable, triple-helical structures with sequences containing the recognition site for the class II-S restriction enzyme, Ksp632-I, was studied as a function of pH. The AOH- and AmOH-substituted RNA and 2'-O-methyl RNA oligonucleotides were shown to bind within the physiological pH range in a pH-independent fashion, without a compromise in specificity. The substitutions of three cytidine residues with AOH showed higher endonuclease inhibition than the substitution of either one or two cytidine residues with AOH. In particular, the 2'-O-methyl RNA oligonucleotide with only one cytidine substituted with AmOH showed higher endonuclease inhibition than the homopyrimidine RNA and 2'-O-methyl RNA oligonucleotides and the RNA oligonucleotides containing either one or two AOH moieties. Furthermore, the AmOH-substituted 2'-O-methyl RNA oligonucleotides were stable (53%) after an incubation in 10% fetal bovine serum for 8 h, whereas the RNA oligonucleotides were completely degraded. Increased resistance to nucleases is observed with the introduction of 2'-O-methylnucleosides. This stabilization should help us to design much more efficient third strand homopyrimidine oligomer and antisense nucleic acid-based antiviral therapies, which could be used as tools in cellular biology.     

Biosynthetic Precursors of Some Modified Nucleosides in the Transfer Ribonucleic Acid of Mycoplasma mycoides var. capri

The ribosomal and transfer ribonucleic acid (tRNA) from Mycoplasma mycoides var. capri, grown in a medium containing uridine-((14)C)-5'-triphosphate and cytidine-(5-(3)H)-5'-triphosphate, were isolated and separated. The uridine in both species of RNA was shown to contain (14)C and the cytidine to contain both (3)H and (14)C. Comparison of the labeling of 4-thiouridine and pseudouridine, obtained from an enzymatic digest of the RNA, indicates that their biosynthetic precursor is uridine, not cytidine. It is probable that ribothymidine and dihydrouridine have the same derivation.     

The incorporation of cytidine 5′-monophosphate and other ribonucleotides by an enzyme preparation from rat-liver microsomes

1. An enzyme preparation from rat-liver microsomes incorporated all four ribonucleotides from the corresponding triphosphates into ribosomal RNA. The reaction was Mn(2+)-dependent, but UMP incorporation also occurred in the presence of Mg(2+). 2. The incorporation of any one ribonucleotide was inhibited by the presence of the other three ribonucleoside triphosphates and by denatured DNA. 3. The product of the reaction consisted of short chains of homopolymer attached to the primer ribosomal RNA. 4. ;Soluble' RNA, synthetic polyribonucleotides, and oligoribonucleotides were also effective primers for CMP incorporation. 5. When phosphodiesterase-treated ;soluble' RNA was the primer, CMP was incorporated into positions usually occupied by the normal terminal trinucleotide sequence of intact ;soluble' RNA, but the enzyme did not synthesize a specific terminal sequence consisting of a defined number of CMP residues.     

Directed cleavage of ribopolynucleotides with nucleases restricted by multiple modification of substrate.

Simultaneous exhaustive modification of cytidine and uridine residues of rRNA with methoxyamine and sodium metabisulfite renders adjacent phosphodiester bonds resistant to pancreatic and T2 ribonucleases. Another method of T2 RNAase restriction is modification of cytidine with methoxyaminebisulfite followed by modification of guanosine residues with beta-ethoxy-alpha-ketobutyraldehyde. Mild alkaline treatment leads to demodification of uridine and guanosine residues leaving intact modified cytidine residues, thus providing a means of stepwise, directed cleavage of the polynucleotide. The series of combined cleavage procedures and methods of isolation of oligo(C), oligo(G) and oligopyrimidine tracts, as well as the procedure of selective cleavage at uridine residues elaborated in the course of the present studies may serve as a basis for more rational procedures of RNA sequencing.     

Effects of 5-azacytidine on nucleolar RNA and the preribosomal particles in Novikoff hepatoma cells.

Examination of nucleolar RNA from cultured Novikoff hepatoma cells treated for 3 hr with 5 x 10-4 M 5-azacytidine shows that significant amounts of analog-substituted 45S RNA are processed to the 32S RNA species, but 28S RNA formation is completely inhibited. Under these conditions of analog treatment 37% of the cytidine residues in the 45S RNA is replaced by 5-azacytidine. During coelectrophoresis of nucleolar RNA from 5-azacytidine-treated and control cells, the analog-substituted 45S RNA and 32S RNA display reduced mobilities compared to the control 45S RNA and 32S RNA. Coelectrophoresis of analog-substituted and control RNA after formaldehyde denaturation shows no differences in electrophoretic mobility between the two RNA samples, suggesting that 5-azacytidine incorporation may alter the secondary structure of the 45S RNA and the 32S RNA. 5-Azacytidine at 5 x 10-4 M severely inhibits protein synthesis in Novikoff cells by 3 hr. After this length of treatment, however, CsCl buoyant density analysis reveals no difference in density of either the 80S or 55S preribosomal ribonucleoprotein particles when compared to normal particles. Also 5-azacytidine treatment does not appear to cause major changes in the polyacrylamide gel electrophoresis patterns of the proteins in the 80S and 55S preribosomal particles. These results together with previous findings suggest that 5-azacytidine's inhibition of rRNA processing is possibly related to its alteration of the structure of the ribosomal precursor RNAs and is not a consequence of a general inhibition of ribosomal protein formation.     

Studies on Deoxyribonucleotide Synthesis in Vicia faba

The incorporation of uniformly labelled [¹⁴C] cytidine into the nucleic acids was studied in root tips of Vicia faba. Cytidine was found to be incorporated into RNA and DNA and the specific activities of the individual mononucleotides were deter- mined. The pyrimidine nucleotides were degrade and the ratio between the specific activity of the pentose and the specific activity of the base was determined for each nucleotide. CMP of RNA and deoxy CMP of DNA bad almost the same pentose: base ratios as The cytidine added to the incubation medium. It was concluded that the administered cytidine or a derivative of it was reduced to the corresponding deoxycytidine compound without breakage of the bond between pentose and base. [¹⁴C)-cytidine was transformed to UMP of RNA with some loss of radioactivity from the pentose and had almost the same pentose: base ratio as deoxy TMP of DNA. This indicates that the formation of thymidine phosphates involved The reduction of a uridine compound. Furthermore the incorporation of ¹⁴C-labelled thymidine, deoxyadenosine and deoxyguanosine into DNA was studied. Deoxyguanosine was found to be incorporated only to a slight extent. This finding has been discussed in relation to previous results.     

The nucleotide sequence of the chloroplast 5S ribosomal RNA from spinach.

Spinacia oleracia cholorplast 5S ribosomal RNA was end-labeled with [32P] and the complete nucleotide sequence was determined. The sequence is: pUAUUCUGGUGUCCUAGGCGUAGAGGAACCACACCAAUCCAUCCCGAACUUGGUGGUUAAACUCUACUGCGGUGACGAU ACUGUAGGGGAGGUCCUGCGGAAAAAUAGCUCGACGCCAGGAUGOH. This sequence can be fitted to the secondary structural model proposed for prokaryotic 5S ribosomal RNAs by Fox and Woese (1). However, the lengths of several single- and double-stranded regions differ from those common to prokaryotes. The spinach chloroplast 5S ribosomal RNA is homologous to the 5S ribosomal RNA of Lemna chloroplasts with the exception that the spinach RNA is longer by one nucleotide at the 3' end and has a purine base substitution at position 119. The sequence of spinach chloroplast 5S RNA is identical to the chloroplast 5S ribosomal RNA gene of tobacco. Thus the structures of the chloroplast 5S ribosomal RNAs from some of the higher plants appear to be almost totally conserved. This does not appear to be the case for the higher plant cytoplasmic 5S ribosomal RNAs.     

Specific incorporation of 5-fluorocytidine into Escherichia coli RNA

RNAs isolated from Escherichia coli B grown in the presence of 5-fluorouracil have high levels of the analog replacing uridine and uridine-derived modified nucleosides. Cytidine has also been shown to be replaced in these RNAs by 5-fluorocytidine, a metabolic product of 5-fluorouracil, but to a considerably lesser extent. When 5-fluorocytidine is added to cultured of E. coli B little 5-fluorocytidine (0.20 mol%) is incorporated into cellular RNAs because of the active cytosine/cytidine deaminase activities. Addition of the cytidine deaminase inhibitor tetrahydrouridine (70 micrograms/ml) increases 5-fluorocytidine incorporation to about 3 mol% in tRNAs, but does not eliminate 5-fluorouridine incorporation. E. coli mutants lacking cytosine/cytidine deaminase activities are able to more than double the extent of 5-fluorocytidine incorporation into their transfer and ribosomal RNAs, replacing cytidine with no detectable 5-fluorouridine incorporation. Levels of 5-methyluridine, pseudouridine and dihydrouridine in tRNAs are not affected. These fluorocytidine-containing tRNAs show amino acid-accepting activities similar to control tRNAs. Fluorocytidine was found to be quite susceptible to deamination under alkaline conditions. Its conversion to primarily 5-fluorouridine follows pseudo-first-order reaction kinetics with a half-life of 10 h in 0.3 M KOH at 37 degrees C. This instability in alkali probably explains why 5-fluorocytidine was not found earlier in RNAs isolated from cells treated with 5-fluorouridine, since most early RNA hydrolyses were carried out in alkali. It may also explain the mild mutagenic properties observed in some systems following 5-fluorouridine treatment. Initial 19F-NMR measurements in fluorocytidine-containing tRNAs indicate that this modified tRNA may be useful in future structural studies of tRNAs and in probing tRNA-protein complexes.     

Ribonucleic acid destruction and synthesis during intraperiplasmic growth of Bdellovibrio bacteriovorus.

During growth of Bdellovibrio bacteriovorus on (2-14C)uracil-labeled Escherichia coli approximately 50% of the radioactivity is incorporated by the bdellovibrio and most of the remainder is released as free nucleic acid bases. Kinetic studies showed that 50 and 30S ribosomal particles and 23 and 16S ribosomal ribonucleic acid (RNA) of E. coli are almost completely degraded by the first 90 min in a 210- to 240-min bdellovibrio developmental cycle. Synthesis of bdellovibrio ribosomal RNA was first detected after 90 min. The specific activity and the ratio of radioactivity in the bases of the synthesized bdellovibrio RNA was essentially the same as those of the substrate E. coli. The total radioactivity of the bdellovibrio deoxyribonucleic acid (DNA) exceeded that in the DNA of the substrate E. coli cell, and the ratio of radioactivity of cytosine to thymine residues differed. Intraperiplasmic growth of B. bacteriovorus in the presence of added nucleoside monophosphates (singly or in combination) significantly decreased the uptake of radioactivity from (2-14C)uracil-labeled E. coli; nucleosides or nucleic acid bases did not. It is concluded that the RNA of the substrate cell, in the form of nucleoside monophosphates, is the major or exclusive precursor of the bdellovirbrio RNA and also serves as a precursor for some of the bdellovibrio DNA.     

Double modification of cytidine residues in DNA]

The reaction of O-beta-diethylaminoethylhydroxylamine (O-beta-HA) with cytidine was studied and its mechanism was shown to be analogous to that of the reaction of hydroxylamine of O-methylhydroxylamine with cytidine. In experiments involving reaction of denatured DNA with O-beta-HA., Sephadex G-15 columns were used for the quantitative separation of normal and modified nucleosides after enzymatic hydrolysis of modified DNA by exonuclease A5 followed by alkaline phosphatase treatment. DNA cytidine residues of free cytidine with O-beta-HA. Modified cytidines can form complex with phosphotungstic acid (PTA). It was shown that one mole of PTA was bound per one mole of modified cytidine either in DNA or in free state. Electron microscopic examination of denatured DNA molecules modified by O-beta-HA and reacted with PTA revealed linear arrays of electron-scattering spots which presumably correspond to PTA molecules complexed with modified cytidine in DNA chains.