Differences in the organization and chromosomal allocation of satellite DNA between the European long tailed house miceMus domesticus andMus musculus

We compared the organization of satellite DNA (stDNA) and its chromosomal allocation inMus domesticus and inMus musculus. The two stDNAs show similar restriction fragment profiles after digestion (probed withM. domesticus stDNA) with some endonucleases of which restriction sequences are present in the 230–240 bp repetitive unit of theM. domesticus stDNA. In contrast, EcoRI digestion reveals thatM. musculus stDNA lacks most of the GAATTC restriction sites, particularly at the level of the half-monomer. The chromosome distribution of stDNA (revealed by anM. domesticus stDNA probe) shows different patterns in theM. domesticus andM. musculus karyotypes, with about 60% ofM. domesticus stDNA retained in theM. musculus genome. It is particularly noteworthy that the pericentromeric regions ofM. musculus chromosomes 1 and X are totally devoid ofM. domesticus stDNA sequences. In both groups, the differences in energy transfer between the stDNA-bound fluorochromes Hoechst 33258 and propidium iodide suggest that AT-rich repeated sequences have a much more clustered array in theM. domesticus stDNA, as if they are organized in tandem repeats longer than those ofM. musculus. Considering the data as a whole, it seems likely that the evolutionary paths of the two stDNAs diverged after the generation of the ancestral 230–240 bp stDNA repetitive unit through the amplification, in theM. domesticus genome, of a family repeat which included the EcoRI GAATTC restriction sequence.     

Restriction endonuclease cleavage of satellite DNA in intact bovine nuclei

We have analyzed the efficiency with which specific nucleotide sequences within nucleosomes are recognized and cleaved by DNA restriction endonucleases. A system amenable to this sort of analysis is the cleavage of the bovine genome with the restriction endonuclease EcoRI. Bovine satellite I comprises 7% of the genome and is tandemly repetitious with an EcoRI site at 1400 base pair (bp) intervals within this sequence. The ease with which this restriction fragment can be measured permits an analysis of the accessibility of this sequence when organized in a nucleosomal array.Initial studies indicated that satellite I sequences are organized in a nucleosomal structure in a manner analogous to that observed for total genomic DNA. We then examined the accessibility of the EcoRI cleavage sites in satellite to endonucleolytic cleavage in intact nuclei. We find that whereas virtually all the satellite I sequences from naked DNA are cleaved into discrete 1400 bp fragments, only 33% of the satellite I DNA is liberated as this fragment from intact nuclei. These data indicate that 57% of the EcoRI sites in nuclei are accessible to cleavage and that cleavage can occur within the core of at least half the nucleosomal subunits. Analysis of the products of digestion suggests a random distribution of nucleosomes about the EcoRI sites of satellite I DNA.Finally, the observation that satellite sequences can be cleaved from nuclei to 1400 bp length fragments with their associated proteins provides a method for the isolation of specific sequences as chromatin. Using sucrose gradient velocity centrifugation, we have isolated a 70% pure fraction of satellite I chromatin. Nuclease digestion of this chromatin fraction reveals the presence of nucleosomal subunits and indicates that specific sequences can be isolated in this manner without gross disorganization of their subunit structure.     

Cytological and biochemical characterization of the in situ endonuclease digestion of fixed Tenebrio molitor chromosomes

Cytological and biochemical experiments were undertaken in order to characterize the action of several restriction enzymes on fixed chromosomes of Tenebrio molitor (Coleoptera). EcoRI cuts the satellite DNA of this organism into suunit monomers of 142 bp in naked DNA and acts on fixed chromosomes cleaving and extracting these tandemly repeated sequences present in median centromeric heterochromatin. AluI, in contrast, is unable to attack the satellite sequences but does cut the main band DNA both in naked DNA and in fixed chromosomes. These enzymes therefore permit the in situ localization of satellite DNA or main band DNA in T. molitor. Other enzymes such HinfI or Sau3A do not produce longitudinal differentiation in chromosomes because of the extraction of DNA from satellite and main band DNA regions. In situ hybridization with a satellite DNA probe from T. molitor confirms that the DNA extracted from the chromosomes is the abundant and homogenous highly repeated DNA present in pericentromeric regions. These results plus the analysis of the DNA fractions retained on the slide and solubilized by the action of the restriction enzymes in situ provide evidence that: (a) as an exception to the rule EcoRI (6 bp cutter) is able to produce chromosome banding; (b) the size of the fragments produced by in situ digestion of satellite DNA with EcoRI is not a limiting factor in the extraction; (c) there is a remarkable accord between the action of EcoRI and AluI on naked DNA and on DNA in fixed chromosomes, and (d) the organization of specific chromosome regions seems to be very important in producing longitudinal differentiation on chromosomes.by E.R. Schmidt     

A subtelomeric satellite DNA family isolated from the genome of the dioecious plant Silene latifolia.

In an ongoing effort to trace the evolution of the sex chromosomes of Silene latifolia, we have searched for the existence of repetitive sequences specific to these chromosomes in the genome of this species by direct isolation from low-melting agarose gels of satellite DNA bands generated by digestion with restriction enzymes. Five monomeric units belonging to a highly repetitive family isolated from Silene latifolia, the SacI family, have been cloned and characterized. The consensus sequence of the repetitive units is 313 bp in length (however, high variability exists for monomer length variants) and 52.9% in AT. Repeating units are tandemly arranged at the subtelomeric regions of the chromosomes in this species. The sequence does not possess direct or inverted sequences of significant length, but short direct repeats are scattered throughout the monomer sequence. Several short sequence motives resemble degenerate monomers of the telomere repeat sequence of plants (TTTAGGG), confirming a tight association between this subtelomeric satellite DNA and the telomere repeats. Our approach in this work confirms that SacI satellite DNA sequences are among the most abundant in the genome of S. latifolia and, on the other hand, that satellite DNA sequences specific of sex chromosomes are absent in this species. This agrees with a sex determination system less cytogenetically diverged from a bisexual state than the system present in other plant species, such as R. acetosa, or at least a lesser degree of differentiation between the sex chromosomes of S. latifolia and the autosomes.     

Distribution and evolution of two satellite DNAs in the genus Beta

Summary EcoRI monomers of a highly repetitive DNA family of Beta vulgaris have been cloned. Sequence analysis revealed that the repeat length varies between 157–160 bp. The percentage of AT-residues is 62% on average. The basic repeat does not show significant homology to the BamHI sequence family of B. vulgaris that was analyzed by us earlier. Both the EcoRI and BamHI sequences are investigated and compared to each other with respect to their genomic organization in the genus Beta. Both repeats were found to be tandemly arranged in the genome of B. vulgaris in a satellite-like manner. The EcoRI satellite DNA is present in three sections (Beta, Corollinae and Nanae) of the genus, whereas the BamHI satellite DNA exists only in the section Beta. The distribution of the EcoRI and BamHI satellite families in the genus is discussed with respect to their evolution.     

New families of site-specific repetitive DNA sequences that comprise constitutive heterochromatin of the Syrian hamster (Mesocricetus auratus, Cricetinae, Rodentia)

We molecularly cloned new families of site-specific repetitive DNA sequences from BglII- and EcoRI-digested genomic DNA of the Syrian hamster (Mesocricetus auratus, Cricetrinae, Rodentia) and characterized them by chromosome in situ hybridization and filter hybridization. They were classified into six different types of repetitive DNA sequence families according to chromosomal distribution and genome organization. The hybridization patterns of the sequences were consistent with the distribution of C-positive bands and/or Hoechst-stained heterochromatin. The centromeric major satellite DNA and sex chromosome-specific and telomeric region-specific repetitive sequences were conserved in the same genus (Mesocricetus) but divergent in different genera. The chromosome-2-specific sequence was conserved in two genera, Mesocricetus and Cricetulus, and a low copy number of repetitive sequences on the heterochromatic chromosome arms were conserved in the subfamily Cricetinae but not in the subfamily Calomyscinae. By contrast, the other type of repetitive sequences on the heterochromatic chromosome arms, which had sequence similarities to a LINE sequence of rodents, was conserved through the three subfamilies, Cricetinae, Calomyscinae and Murinae. The nucleotide divergence of the repetitive sequences of heterochromatin was well correlated with the phylogenetic relationships of the Cricetinae species, and each sequence has been independently amplified and diverged in the same genome.     

Recent amplification of an alpha satellite DNA in humans.

A repeat sequence 682 base pairs (bp) long produced by cleavage of human DNA with Xba I restriction enzyme is composed of four tandemly arranged subunits with lengths of 171, 170, 171, and 170 bp each. The sequence organization of the 682 bp Xba I repeat bears a striking resemblance to other complex satellite DNAs of primates, including the Eco RI human alpha satellite family which also occurs as a 170 bp repeat. The Eco RI tetramer and the 682 bp Xba I repeat show a sequence divergence of 21%. The 682 bp Xba I repeat sequence is restricted to humans and is only distantly related to the previously reported 340 bp Xba human repeated DNA sequence. These finding are consistent with the concept of occasional amplifications of members or groups of members of alpha satellite DNA during human evolution. Amplifications apparently occurred after humans, apes and gibbons diverged from Old World monkeys (Eco RI satellite), after humans and apes diverged from gibbons (340 bp Xba I satellite) and after humans diverged from the great apes (682 bp Xba I satellite).     

A comparative study of the heterochromatin of Apodemus sylvaticus and Apodemus flavicollis

The two closely related species Apodemus sylvaticus and Apodemus flavicollis (Muridae) differ in the distribution of their heterochromatin. Two major repetitive sequences known to occur in both species were isolated from A. flavicollis after digestion of total nuclear DNA with the restriction enzymes HindIII and EcoRI respectively and characterized in both species by filter hybridisation and in situ hybridisation to metaphase chromosomes. The EcoRI clone detects a dispersed repetitive sequence family in the genome of both species. Southern blot hybridisation with the HindIII satellite DNA probe reveals major similarities and minor differences in the two species. In situ hybridisation with the HindIII probe labels all chromosomes of A. flavicollis exclusively in the centromeric heterochromatin, whereas in A. sylvaticus several autosomes are also labelled distally. The labelling patterns correspond to the distribution of heterochromatin in the two species. It is concluded that the additional distal heterochromatin of A. sylvaticus contains similar sequences to those of the centromeric heterochromatin of both species. The distal heterochromatin in A. sylvaticus most likely evolved by transposition and amplification of centromeric satellite DNA elements, after the separation of the two species.     

Nucleotide sequence of mouse satellite DNA.

The nucleotide sequence of uncloned mouse satellite DNA has been determined by analyzing Sau96I restriction fragments that correspond to the repeat unit of the satellite DNA. An unambiguous sequence of 234 bp has been obtained. The sequence of the first 250 bases from dimeric satellite fragments present in Sau96I limit digests corresponds almost exactly to two tandemly arranged monomer sequences including a complete Sau96I site in the center. This is in agreement with the hypothesis that a low level of divergence which cannot be detected in sequence analyses of uncloned DNA is responsible for the appearance of dimeric fragments. Most of the sequence of the 5% fraction of Sau96 monomers that are susceptible to TaqI has also been determined and has been found to agree completely with the prototype sequence. The monomer sequence is internally repetitious being composed of eight diverged subrepeats. The divergence pattern has interesting implications for theories on the evolution of mouse satellite DNA.     

CHARACTERIZATION OF THE NUCLEAR DNA OF HORDEUM VULGARE ROOT HAIRS: AMPLIFICATION DISAPPEARS UNDER SALT STRESS

In Hordeum vulgare L., the nucleus of differentiating root hairs contains amplified, extrachromosomal DNA sequences. Cytophotometry shows that the nuclei of trichoblasts and root hairs grown under normal conditions contain up to 50% more DNA than those grown in 200 mM salt. Although the root hairs develop and differentiate under salt stress, amplification of their nuclear DNA is suppressed. From this, we conclude that amplification is not necessary for differentiation at the cellular level. Characterization of the amplified nuclear DNA of the root hair is based on the physical/chemical nature of the DNA. The amplified sequences separate as a satellite band when total nucleic acids are centrifuged on CsCl gradients. Enzyme restriction of the satellite and main bands with Msp I and Hpa II followed by agarose gel electrophoresis shows that the satellite band is not more highly methylated than the main band. Restriction of the root hair DNA with EcoRI reveals repetitive DNA sequences not seen in similarly restricted whole root, leaf or salt-stressed root hair preparations. While these unique, repetitive sequences in the 2–6 kb region of the gel do not hybridize with ribosomal, chloroplast, or mitochondrial DNAs, RNA hybridization shows that some of them are transcribed. We believe that the amplified sequences are extrachromosomal based on their selective degradation during root hair senescence, their separation as a satellite band and their restriction patterns.     

MuA transposase separates DNA sequence recognition from catalysis

Confronted with thousands of potential DNA substrates, a site-specific enzyme must restrict itself to the correct DNA sequence. The MuA transposase protein performs site-specific DNA cleavage and joining reactions, resulting in DNA transposition-a specialized form of genetic recombination. To determine how sequence information is used to restrict transposition to the proper DNA sites, we performed kinetic analyses of transposition with DNA substrates containing either wild-type transposon sequences or sequences carrying mutations in specific DNA recognition modules. As expected, mutations near the DNA cleavage site reduce the rate of cleavage; the observed effect is about 10-fold. In contrast, mutations within the MuA recognition sequences do not directly affect the DNA cleavage or joining steps of transposition. It is well established that the recognition sequences are necessary for assembly of stable, multimeric MuA-DNA complexes, and we find that recognition site mutations severely reduce both the extent and the rate of this assembly process. Yet if the MuA-DNA complexes are preassembled, the first-order rate constants for both DNA cleavage and DNA strand transfer (the joining reaction) are unaffected by the mutations. Furthermore, most of the mutant DNA molecules that are cleaved also complete DNA strand transfer. We conclude that the sequence-specific contacts within the recognition sites contribute energetically to complex assembly, but not directly to catalysis. These results contrast with studies of more orthodox enzymes, such as EcoRI and some other type II restriction enzymes. We propose that the strategy employed by MuA may serve as an example for how recombinases and modular restriction enzymes solve the DNA specificity problem, in that they, too, may separate substrate recognition from catalysis.     

Cae I: an endonuclease isolated from the African green monkey with properties indicating site-specific cleavage of homologous and heterologous mammalian DNA.

Component alpha DNA is a highly repetitive sequence that comprises nearly a quarter of the African green monkey (Cercopithecus aethiops) genome. A previous microbial restriction enzyme analysis showed that the repeat structure of component alpha DNA is based upon a monomeric unit of 176 +/- 4 base-pairs. An endonuclease, provisionally termed Case I, has been isolated from African green monkey testes that cleaves component alpha DNA into multimeric segments based upon the same repeat periodicity as that revealed by microbial restriction enzymes. The primary sites of Cae I cleavage in the component alpha sequence appear to be 120 +/- 6 base-pairs distant from the Hind III sites and 73 +/- 6 base-pairs distant from the Eco RI* sites. Cae I has been partially characterized with special reference to the effects of ATP and S-adenosylmethionine on the cleavage of component alpha DNA. Cae I may be a member of a class of similar site-specific nucleases present in mammalian cells. Cae I also cleaves mouse satellite DNA into a multimeric series of discrete segments: the periodicity of this series is shorter than that revealed by Eco RII retriction analysis of mouse satellite DNA.     

Localization and characterization of recombinant DNA clones derived from the highly repetitive DNA sequences in the Indian muntjac cells: their presence in the Chinese muntjac

A total of seven, highly repeated, DNA recombinant M13 mp8 clones derived from a Hpa II digest of cultured cells of the Indian muntjac (Muntiacus muntjac vaginalis) were analyzed by restriction enzymes, in situ hybridization, and DNA sequencing. Two of the clones, B1 and B8, contain satellite DNA inserts which are 80% homologous in their DNA sequences. B1 contains 781 nucleotides and consist of tandem repetition of a 31 bp consensus sequence. This consensus sequence, TCCCTGACGCAACTCGAGAGGAATCCTGAGT, has only 3 bp changes, at positions 7, 24, and 27, from the consensus sequence of the 31 bp subrepeats of the bovine 1.715 satellite DNA. The satellite DNA inserts in B1 and B8 hybridize primarily but not specifically to chromosome X, and secondarily to other sites such as the centromeric regions of chromosomes 1 and 2. Under less stringent hybridization conditions, both of them hybridize to the interior of the neck region and all other chromosomes (including chromosomes 3 and Y). The other five DNA clones contain highly repetitive, interdispersed DNA inserts and are distributed throughout the genome except for the neck region of the compound chromosome X+3. Blot hybridization results demonstrate that the satellite DNA component is also present in Chinese muntjac DNA (Muntiacus reevesi) in spite of the very different karyotypes of the Chinese and Indian muntjacs.     

Characterization of a tandemly repeated DNA from the fleshflySarcophaga bullata

In studies on the highly repetitive DNA sequences of the flesh flySarcophaga bullata, a 279 bp tandem repeat was cloned and sequenced. A 17 bp stretch within the clone was identical to a motif repeated five times in the satellite DNA of the Bermuda land crab. Southern DNA blotting showed the tandem repeat had a high degree of conservation of MboI sites, but had divergence for EcoRI sites; thus, all repeat units were not identical. The cloned DNA localized to the quinacrine-bright centromeric heterochromatin of the C and E autosomes and to sites on the chromosomal arms. In cases of asynapsis of homologs, the probe localized to euchromatic sites on both homologs or sometimes only on one homolog. The probe also localized near, to, or at a major developmental puff (B9). We conclude that blocks of this short interspersed repetitive DNA occur throughout theSarcophaga genome in both heterochromatin and euchromatin, and also that the variable position of these sequences suggests they possess a degree of instability.     

Conservation of repetitive DNA sequences in deer species studied by Southern blot transfer

Summary The Cervidae show one of the largest variations in chromosome number found within a mammalian family. The five species of the deer family which are the subject of this study vary in chromosome number from 2n=70 to 2n=6. Digestion with the restriction enzymes EcoRI, HpaII, HaeIII and MspI reveals that there is a series of highly repetitive sequences forming similar band patterns in the different species. To obtain information on the degree of homology among these conserved sequences we isolated a HpaII restriction fragment of approximately 990 base pairs from reindeer DNA. This DNA sequence was³²P-labelled and hybridized by the Southern blot technique to DNAs cleaved with HpaII and HaeIII from the reindeer and four other Cervidae species. Hybridization to specific restriction fragments was recorded in all species. The patterns of hybridization showed a higher degree of similarity between reindeer, elk and roe deer than between reindeer and the Asiatic species (fallow deer and muntjac). Homologies are still present between the highly repetitive sequences of the five species despite the drastic reorganization that led to a change in chromosome number from 6 to 70.     

Construction and restriction endonuclease mapping of hybrid plasmids containing Saccharomyces cerevisiae ribosomal DNA.

Summary Fragments produced by partial digestion of Saccharomyces cerevisiae ribosomal DNA (rDNA) with the restriction endonuclease EcoRI were ligated in vitro to the bacterial plasmid RSF2124. The resulting hybrid plasmids were cloned in Escherichia coli. Three hybrid plasmids which contain at least one intact repetitive unit of the multiple, tandem sequences of the yeast rDNA genes have been further characterized. These plasmids have been used to construct a map of the EcoRI, SmaI, HindII and HindIII restriction sites in the individual repetitive units of yeast rDNA.     

Chromatin structure of Drosophila nasutoides satellites as probed by cross-linking DNA in situ

Chromatin structure can be probed by cross-linking DNA in situ using trioxsalen and irradiation with UV light. Presumably DNA within a nucleosome is protected from cross-linking so that this region appears as a single-strand loop in the electron microscope under a condition in which single-strands and double-strands are distinguished. Unprotected regions appear as duplex due to cross-linking.We have used this approach to investigate the structure of chromatins containing satellite DNAs of Drosophila nasutoides. We have previously shown that D. nasutoides has an unusually large autosome pair which is almost entirely heterochromatic. Its nuclear DNA reveals four major satellite components amounting up to 60% of the total genome. All of them are localized in this large heterochromatic chromosome. We wish to ask whether chromatins containing different satellite sequences have different arrangements of nucleosomes. Our results from cross-linking experiments show that all DNA components including main band DNA have different patterns of protected and unprotected regions: (a) The length distributions of protected regions show multiple peaks with the smallest unit lengths being 200 nucleotides for main band DNA, 180 for satellites I, II and III, and 160 for satellite IV. (b) The amounts of unprotected regions, presumably internucleosome DNA, vary from 16% for main band DNA to 60% for satellite IV, suggesting that satellite chromatins have fewer nucleosomes per given length of chromatin than main band DNA chromatin. The spacings between nucleosomes appear to be random in satellite chromatins.     

Satellite DNA derived from 5S rDNA in Physalaemus cuvieri (Anura, Leiuperidae)

In the present study, we describe for the first time a family of 190-bp satellite DNA related to 5S rDNA in anurans and the existence of 2 forms of 5S rDNA, type I (201 bp) and type II (690 bp). The sequences were obtained from genomic DNA of Physalaemus cuvieri from Palmeiras, State of Bahia, Brazil. Analysis of the nucleotide sequence revealed that the satellite DNA obtained by digestion with EcoRI, called PcP190EcoRI, is 70% similar to the coding region of type I 5S rDNA and 66% similar to the coding region of type II 5S rDNA. Membrane hybridization and PCR amplification of the sequence showed that PcP190EcoRI is tandemly repeated. The satellite DNA as well as type I and type II 5S rDNA were localized in P. cuvieri chromosomes by fluorescent in situ hybridization. The PcP190EcoRI sequence was found in the centromeres of chromosomes 1-5 and in the pericentromeric region of chromosome 3. Type I 5S rDNA was detected in chromosome 3, coincident with the site of PcP190EcoRI. Type II 5S rDNA was located interstitially in the long arm of chromosome 5. None of these sequences co-localized with nucleolar organizer regions. Our data suggests that this satellite DNA originates from the 5S ribosomal multigene family, probably by gene duplication, nucleotide divergence and sequence dispersion in the genome.     

Satellite DNA relationships in man and the primates

We have investigated the genomes of a series of primates to identify the presence of sequences related to human satellite DNAs I, II and III by restriction enzyme digestion and hybridisation with probes of these satellite DNAs. Where we have found such related sequences we have examined the extent to which they have diverged by measuring the stability of the hybrids. DNA satellite III is the oldest sequence being common to species which have diverged some 24 million years ago. In contrast DNA satellites I and II are of much more recent origin. Our results permit us to draw conclusions about the way these sequences have evolved, and how the evolution of repeated DNA sequences may be related to the evolution of the primate lineage.