Configurational entropy change of netropsin and distamycin upon DNA minor-groove binding

Binding of a small molecule to a macromolecular target reduces its conformational freedom, resulting in a negative entropy change that opposes the binding. The goal of this study is to estimate the configurational entropy change of two minor-groove-binding ligands, netropsin and distamycin, upon binding to the DNA duplex d(CGCGAAAAACGCG).d(CGCGTTTTTCGCG). Configurational entropy upper bounds based on 10-ns molecular dynamics simulations of netropsin and distamycin in solution and in complex with DNA in solution were estimated using the covariance matrix of atom-positional fluctuations. The results suggest that netropsin and distamycin lose a significant amount of configurational entropy upon binding to the DNA minor groove. The estimated changes in configurational entropy for netropsin and distamycin are -127 J K(-1) mol(-1) and -104 J K(-1) mol(-1), respectively. Estimates of the configurational entropy contributions of parts of the ligands are presented, showing that the loss of configurational entropy is comparatively more pronounced for the flexible tails than for the relatively rigid central body.     

Molecular dynamics simulations and free energy calculations of netropsin and distamycin binding to an AAAAA DNA binding site

Molecular dynamics simulations have been performed on netropsin in two different charge states and on distamycin binding to the minor groove of the DNA duplex d(CGCGAAAAACGCG)·d(CGCGTTTTTCGCG). The relative free energy of binding of the two non-covalently interacting ligands was calculated using the thermodynamic integration method and reflects the experimental result. From 2 ns simulations of the ligands free in solution and when bound to DNA, the mobility and the hydrogen-bonding patterns of the ligands were studied, as well as their hydration. It is shown that even though distamycin is less hydrated than netropsin, the loss of ligand–solvent interactions is very similar for both ligands. The relative mobilities of the ligands in their bound and free forms indicate a larger entropic penalty for distamycin when binding to the minor groove compared with netropsin, partially explaining the lower binding affinity of the distamycin molecule. The detailed structural and energetic insights obtained from the molecular dynamics simulations allow for a better understanding of the factors determining ligand–DNA binding.     

Accessibility of the minor groove of DNA in chromatin to the binding of antibiotics netropsin and distamycin A

The interaction of the antibiotics distamycin A, distamycin analogue and netropsin with chromatin of calf thymus has been studied by circular dichroism measurements and by gel filtration. The minor groove of DNA in chromatin is accessible by 83–89% to the binding of these antibiotics as compared with that of free DNA. The present results combined with our data on the methylation of chromatin with dimethylsulphate [3] strongly suggest that the minor groove of DNA in chromatin is not occupied by chromatin proteins.Abbreviations DM distamycin A - DM₂ analogue of distamycin - Nt netropsin - CD spectra circular dichroism spectra     

Molecular structure of the netropsin-d(CGCGATATCGCG) complex: DNA conformation in an alternating AT segment

The molecular structure of the complex between a minor groove binding drug (netropsin) and the DNA dodecamer d(CGCGATATCGCG) has been solved and refined by single-crystal X-ray diffraction analysis to a final R factor of 20.0% to 2.4-A resolution. The crystal is similar to that of the other related dodecamers with unit cell dimensions of a = 25.48 A, b = 41.26 A, and c = 66.88 A in the space group P2(1)2(1)2(1). In the complex, netropsin binds to the central ATAT tetranucleotide segment in the narrow minor groove of the dodecamer B-DNA double helix as expected. However, in the structural refinement the drug is found to fit the electron density in two orientations equally well, suggesting the disordered model. This agrees with the results from solution studies (chemical footprinting and NMR) of the interactions between minor groove binding drugs (e.g., netropsin and distamycin A) and DNA. The stabilizing forces between drug and DNA are provided by a combination of ionic, van der Waals, and hydrogen-bonding interactions. No bifurcated hydrogen bond is found between netropsin and DNA in this complex due to the unique dispositions of the hydrogen-bond acceptors (N3 of adenine and O2 of thymine) on the floor of the DNA minor groove. Two of the four AT base pairs in the ATAT stretch have low propeller twist angles, even though the DNA has a narrow minor groove. Alternating helical twist angles are observed in the ATAT stretch with lower twist in the ApT steps than in the TpA step.     

Interaction of lambda cro repressor with synthetic operator OR3 studied by competition binding with minor groove binders.

In the present work, we employ a combination of CD spectroscopy and gel retardation technique to characterize thermodynamically the binding of lambda phage cro repressor to a 17 base pair operator OR3. We have found that three minor groove-binding antibiotics, distamycin A, netropsin and sibiromycin, compete effectively with the cro for binding to the operator OR3. Among these antibiotics, sibiromycin binds covalently to DNA in the minor groove at the NH2 of guanine, whereas distamycin A and netropsin interact preferentially with runs of AT base pairs and avoid DNA regions containing guanine bases in the two polynucleotide strands. Only subtle DNA conformation changes are known to take place upon binding of these antibiotics. Both the CD spectral profiles and the results of the gel retardation experiments indicate that distamycin A and netropsin can displace cro repressor from the operator OR3. The binding of cro repressor to the OR3 is accompanied by considerable changes in CD in the far-UV region which appear to be attributed to a DNA-dependent structural transition in the protein. Spectral changes are also induced in the wavelength region of 270-290 nm. The CD spectral profile of the cro-OR3 mixture in the presence of distamycin A can be represented as a sum of the CD spectrum of the repressor-operator complex and spectrum of distamycin-DNA complex at the appropriate molar ratio of the bound antibiotic to the operator DNA (r). When r tends to the saturation level of binding the CD spectrum in the region of 270-360 nm approaches a CD pattern typical of complexes of the antibiotic with the free DNA oligomer. This suggests that simultaneous binding of cro repressor and distamycin A to the same DNA oligomer is not possible and that distamycin A and netropsin can be used to determine the equilibrium affinity constant of cro repressor to the synthetic operator from competition-type experiments. The binding constant of cro repressor to the OR3 is found to be (6 +/- 1).10(6)M-1 at 20 degrees C in 10 mM sodium cacodylate buffer (pH 7.0) in the presence of 0.1 M NH4F.     

Minor groove to major groove, an unusual DNA sequence-dependent change in bend directionality by a distamycin dimer

DNA sequence-dependent conformational changes induced by the minor groove binder, distamycin, have been evaluated by polyacrylamide gel electrophoresis. The distamycin binding affinity, cooperativity, and stoichiometry with three target DNA sequences that have different sizes of alternating AT sites, ATAT, ATATA, and ATATAT, have been determined by mass spectrometry and surface plasmon resonance to help explain the conformational changes. The results show that distamycin binds strongly to and bends five or six AT base pair minor groove sites as a dimer with positive cooperativity, while it binds to ATAT as a weak, slightly anticooperative dimer. The bending direction was evaluated with an in phase A-tract reference sequence. Unlike other similar monomer minor groove binding compounds, such as netropsin, the distamycin dimer changes the directionality of the overall curvature away from the minor groove to the major groove. This distinct structural effect may allow designed distamycin derivatives to have selective therapeutic effects.     

Binding of netropsin to several DNA constructs: evidence for at least two different 1:1 complexes formed from an -AATT-containing ds-DNA construct and a single minor groove binding ligand

Isothermal titration calorimetry, ITC, has been used to determine the thermodynamics (DeltaG, DeltaH, and -TDeltaS) for binding netropsin to a number of DNA constructs. The DNA constructs included: six different 20-22mer hairpin forming sequences and an 8-mer DNA forming a duplex dimer. All DNA constructs had a single -AT-rich netropsin binding with one of the following sequences, (A(2)T(2))(2), (ATAT)(2), or (AAAA/TTTT). Binding energetics are less dependent on site sequence than on changes in the neighboring single stranded DNA (hairpin loop size and tail length). All of the 1:1 complexes exhibit an enthalpy change that is dependent on the fractional saturation of the binding site. Later binding ligands interact with a significantly more favorable enthalpy change (partial differential DeltaH(1-2) from 2 to 6 kcal/mol) and a significantly less favorable entropy change (partial differential (-TDeltaS(1-2))) from -4 to -9 kcal/mol). The ITC data could only be fit within expected experimental error by use of a thermodynamic model that includes two independent binding processes with a combined stoichiometry of 1 mol of ligand per 1 mol of oligonucleotide. Based on the biophysical evidence reported here, including theoretical calculations for the energetics of "trapping" or structuring of a single water molecule and molecular docking computations, it is proposed that there are two modes by which flexible ligands can bind in the minor groove of duplex DNA. The higher affinity binding mode is for netropsin to lay along the floor of the minor groove in a bent conformation and exclude all water from the groove. The slightly weaker binding mode is for the netropsin molecule to have a slightly more linear conformation and for the required curvature to be the result of a water molecule that bridges between the floor of the minor groove and two of the amidino nitrogens located at one end of the bound netropsin molecule.     

Interactions of nucleic acids with distamycins. The drug monomeric chromophore

A study of the monomeric chromophore of the oligopeptides netropsin (1), distamycin III (2), and distamycin V (3) by polarization spectroscopy techniques and molecular orbital calculations is reported. Linear dichroism spectra of the monomeric model compounds 1-methyl-2(ethylcarbamoyl)-4-acetamido-pyrrole (4) and 1-methyl-2(ethylcarbamoyl)-pyrrole (5) dissolved and oriented in lyotropic and thermotropic liquid crystals provide, together with the magnetic CD spectra, experimental checks of the theoretical calculations. The polarization directions of the investigated transition obtained by these means in this study allow us to build up in the following paper the exciton states of (1)-(3) and these provide a stereochemical interpretation of the flow linear dichroism spectra of the complexes of DNA with (2) and (3).     

Specific interaction of netropsin, distamycin-3 and analogs with LC duplexes: reversion towards the B form of the 2''-deoxy-.2''-deoxy-2''-fluoro-hybrid duplexes upon specific interaction with netropsin, distamycin-3 and analogs.

Binding of the B-form specific ligands netropsin and distamycin-3, -4 and -5 has been used to monitor the presence and/or the inducibility of a B-type structure in various poly-inosinic.poly-cytidilic double stranded polymers with deoxyribose, ribose or 2'-deoxy-2'-fluororibose as sugar on either strand. The efficiency of binding was followed by circular dichroism and further evaluated by the increase in melting temperature of the complexes. The efficient binding of netropsin and distamycins to the hybrid polymer (dIfl)n. (dC)n demonstrated that the fluorine carrying strand may undergo a A to B-type transition reflecting a change of the 2'-deoxy-2'-fluororibose from the 3'-endo to the 1'-exo or 2'-endo pucker. The less efficient binding of the same ligands to the reverse hybrid (dI)n.(dCfl)n showed that the geometry of the pyrimidine strand is the most critical for the specific interaction. Taking into account the recent findings about the regular hydration in the minor groove of the B-type dodecamer dCGCGAATTCGCG in solid-state, the different binding modes observed between the different polymers and antibiotics are explained by differences in their possibilities of hydration. Binding of netropsin to a double stranded deoxypolymer is interpreted as a local replacement of water molecules by netropsin in the minor groove hydration network which is typical of the B-form.     

Mode of reversible binding of neocarzinostatin chromophore to DNA: evidence for binding via the minor groove

Two general approaches have been taken to understand the mechanism of the reversible binding of the nonprotein chromophore of neocarzinostatin to DNA: (1) measurement of the relative affinity of the chromophore for various DNAs that have one or both grooves blocked by bulky groups and (2) studies on the influence of adenine-thymine residue-specific, minor groove binding agents such as the antibiotics netropsin and distamycin on the chromophore-DNA interaction. Experiments using synthetic DNAs containing halogen group (Br, I) substituents in the major groove or natural DNAs with glucosyl moieties projecting into the major groove show that obstruction of the major groove does not decrease the binding stoichiometry or the binding constant for the DNA-chromophore interaction. Chemical methylation of bases in both grooves of calf thymus DNA, resulting in 13% methylation of N-7 of guanine in the major groove and 7% methylation of N-3 of adenine in the minor groove, decreases the binding affinity and increases the size of the binding site for neocarzinostatin chromophore. Similar results were obtained whether binding parameters were determined directly by spectroscopic measurements or indirectly by measuring the ability of the DNA to protect the chromophore against degradation. On the other hand, netropsin and distamycin compete with neocarzinostatin chromophore for binding to the minor groove of DNA, as shown by their decrease in the ability of poly(dA-dT) to protect the chromophore against degradation and their reduction in chromophore-induced DNA damage as measured by thymine release.(ABSTRACT TRUNCATED AT 250 WORDS)     

An unexpected major groove binding of netropsin and distamycin A to tRNA(phe)

Crystalline complexes of yeast tRNA(phe) and the oligopeptide antibiotics netropsin and distamycin A were prepared by diffusing drugs into crystals of tRNA. X-ray structure analyses of these complexes reveal a single common binding site for both drugs which is located in the major or deep groove of the tRNA T-stem. The netropsin-tRNA complex is stabilized by specific hydrogen bonds between the amide groups of the drug and the tRNA bases G51 O(6), U52 O(4) and G53 N(7) on one strand, and is further stabilized by electrostatic interactions between the positively charges guanidino side chain of the drug and the tRNA phosphate P53 on the same strand and the positively charged amidino propyl side chain and the phosphates P61, P62 and P63 on the opposite strand of the double helix. These results are in contrast to the implicated minor groove binding of these drugs to non-guanine sequences in DNA. The binding to the GUG sequence in tRNA implies that major groove binding to certain DNA sequences is possible.     

Use of capillary electrophoresis in the study of ligand-DNA interactions.

Free solution capillary electrophoresis (FSCE) has been used to separate two non-self-complementary 12mer oligonucleotide duplexes: d(AAATTATATTAT).d(ATAA-TATAATTT) and d(GGGCCGCGCCGC).d(GCGGCGCGGCCC). Titration of mixtures of the two oligonucleotides with model intercalators (ethidium bromide andactinomycin D) and minor groove binders (netropsin, Hoechst 33258 and distamycin) has shown the suitability of FSCE as a method to study the sequence selectivity of DNA binding agents. Binding data have shown cooperativity of binding for netropsin and Hoechst 33258 and have provided ligand:DNA binding ratios for all five compounds. Cooperativity of netropsin binding to a 12mer with two potential sites has been demonstrated for the first time. Ligands binding in the minor groove caused changes in migration time and peak shape which were significantly different from those caused by intercalators.     

Molecular recognition of B-DNA by Hoechst 33258.

The binding sites of Hoechst 33258, netropsin and distamycin on three DNA restriction fragments from plasmid pBR322 were compared by footprinting with methidiumpropyl-EDTA X Fe(II) [MPE X Fe(II)]. Hoechst, netropsin and distamycin share common binding sites that are five +/- one bp in size and rich in A X T DNA base pairs. The five base pair protection patterns for Hoechst may result from a central three base pair recognition site bound by two bisbenzimidazole NHs forming a bridge on the floor of the minor groove between adjacent adenine N3 and thymine O2 atoms on opposite helix strands. Hydrophobic interaction of the flanking phenol and N-methylpiperazine rings would afford a steric blockade of one additional base pair on each side.     

DNA binding properties of minor groove binders and their influence on the topoisomerase II cleavage reaction

We present titrations of the human δβ-globin gene region with DNA minor groove binders netropsin, bisnetropsin, distamycin, chromomycin and four bis-quaternary ammonium compounds in the presence of calf thymus topoisomerase II and DNase I. With increasing ligand concentration, stimulation and inhibition of enzyme activity were detected and quantitatively evaluated. Additionally we show a second type of stimulation, the appearance of strong new topoisomerase II cleavage sites at high ligand concentrations. The specific binding sites of the minor groove binders of the DNA sequence and their microscopic binding constants were determined from DNase I footprints. A binding mechanism for minor groove binders is proposed in order to explain these results especially when ligand concentration is increased. © 1998 John Wiley & Sons, Ltd.     

Molecular orbital calculations on the oligopeptides netropsin, distamycin and related compounds

The electronic structure of the antibiotics netropsin, distamycin A, and related compounds has been examined by various theoretical models. Calculations of both the Pariser-Parr-Pople (PPP) and the semiempirical CNDO/S types can account for the absorption spectrum of netropsin and distamycin A. The CD spectrum has been calculated for the conformation of netropsin found in the crystal structure of a netropsin/DNA dodecamer. Not all the CD spectral features can be attributed entirely to the chiral conformation of netropsin, indicating that there are significant interactions between netropsin and DNA. A CD calculation was also performed for distamycin A in a similar conformation. An examination of the charge-density maps of the excited states suggests that there is substantial charge transfer from the pyrrole ring to either of the adjacent peptide linkages in these systems. At higher energies, even longer distance charge transfer can be observed. Similar behavior was seen in the monomers pyrrole-2-carboxamide and 3-(formylamino)pyrrole.     

An Unexpected Major Groove Binding of Netropsin and Distamycin A to tRNAphe

Abstract

Crystalline complexes of yeast tRNA^phe and the oligopeptide antibiotics netropsin and distamycin A were prepared by diffusing drugs into crystals of tRNA. X-ray structure analyses of these complexes reveal a single common binding site for both drugs which is located in the major or deep groove of the tRNA T-stem. The netropsin-tRNA complex is stabilized by specific hydrogen bonds between the amide groups of the drug and the tRNA bases G51 0(6), U52 0(4) and G53 N(7) on one strand, and is further stabilized by electrostatic interactions between the positively charges guanidino side chain of the drug and the tRNA phosphate P53 on the same strand and the positively charged amidino propyl side chain and the phosphates P61, P62 and P63 on the opposite strand of the double helix. These results are in contrast to the implicated minor groove binding of these drugs to non-guanine sequences in DNA. The binding to the GUG sequence in tRNA implies that major groove binding to certain DNA sequences is possible.     

Binding of netropsin and 4,6-diamidino-2-phenylindole to an A2T2 DNA hairpin: a comparison of biophysical techniques

Isothermal titration calorimetry (ITC), differential scanning calorimetry (DSC), and biosensor-surface plasmon resonance (SPR) are evaluated for their accuracy in determining equilibrium constants, ease of use, and range of application. Systems chosen for comparison of the three techniques were the formation of complexes between two minor groove binding compounds, netropsin and 4,6-diamidino-2-phenylindole (DAPI), and a DNA hairpin having the sequence 5'-d(CGAATTCGTCTCCGAATTCG)-3'. These systems were chosen for their structural differences, simplicity (1:1 binding), and binding affinity in the range of interest (K approximately 10(8) M(-1)). The binding affinities determined from all three techniques were in excellent agreement; for example, netropsin/DNA formation constants were determined to be K = 1.7x10(8) M(-1) (ITC), K = 2.4x10(8) M(-1) (DSC), and K = 2.9x10(8) M(-1) (SPR). DSC and SPR techniques have an advantage over ITC in studies of ligands that bind with affinities greater than 10(8) M(-1). The ITC technique has the advantage of determining a full set of thermodynamic parameters, including deltaH, TdeltaS, and deltaC(p) in addition to deltaG (or K). The ITC data revealed complex binding behavior in these minor groove binding systems not detected in the other methods. All three techniques provide accurate estimates of binding affinity, and each has unique benefits for drug binding studies.     

Structure of a beta-alanine-linked polyamide bound to a full helical turn of purine tract DNA in the 1:1 motif

Polyamides composed of N-methylpyrrole (Py), N-methylimidazole (Im) and N-methylhydroxypyrrole (Hp) amino acids linked by beta-alanine (beta) bind the minor groove of DNA in 1:1 and 2:1 ligand to DNA stoichiometries. Although the energetics and structure of the 2:1 complex has been explored extensively, there is remarkably less understood about 1:1 recognition beyond the initial studies on netropsin and distamycin. We present here the 1:1 solution structure of ImPy-beta-Im-beta-ImPy-beta-Dp bound in a single orientation to its match site within the DNA duplex 5'-CCAAAGAGAAGCG-3'.5'-CGCTTCTCTTTGG-3' (match site in bold), as determined by 2D (1)H NMR methods. The representative ensemble of 12 conformers has no distance constraint violations greater than 0.13 A and a pairwise RMSD over the binding site of 0.80 A. Intermolecular NOEs place the polyamide deep inside the minor groove, and oriented N-C with the 3'-5' direction of the purine-rich strand. Analysis of the high-resolution structure reveals the ligand bound 1:1 completely within the minor groove for a full turn of the DNA helix. The DNA is B-form (average rise=3.3 A, twist=38 degrees ) with a narrow minor groove closing down to 3.0-4.5 A in the binding site. The ligand and DNA are aligned in register, with each polyamide NH group forming bifurcated hydrogen bonds of similar length to purine N3 and pyrimidine O2 atoms on the floor of the minor groove. Each imidazole group is hydrogen bonded via its N3 atom to its proximal guanine's exocyclic amino group. The important roles of beta-alanine and imidazole for 1:1 binding are discussed.     

Netropsin and bis-netropsin analogs as inhibitors of the catalytic activity of mammalian DNA topoisomerase II and topoisomerase cleavable complexes.

This study examined the ability of netropsin and related minor groove binders to interfere with the actions of DNA topoisomerases II and I. We evaluated a series of netropsin dimers linked with flexible aliphatic chains of different lengths. These agents are potentially able to occupy longer stretches of DNA than the parental drug as a result of bidentate binding. Both netropsin and its dimers were found: (i) to inhibit the catalytic activity of isolated topoisomerase II and (ii) to interfere with the stabilization of the cleavable complexes of topoisomerase II and I in nuclei. Dimers with linkers consisting of 0-4 and 6-9 methylene groups (n) were far more inhibitory than netropsin against isolated enzyme and in the nuclear system. The compound with n = 5 was less active than netropsin in both assays while the dimer with n = 10 inhibited only the isolated enzyme. The comparison of dimers with fixed linker length (n = 2) but varying number of N-methylpyrrole residues (from 1 to 3) revealed that the inhibitory properties were enhanced with increasing number of N-methylpyrrole units. For dimers with varying linker length, drug ability to inhibit catalytic activity of isolated topoisomerase II was positively correlated with calf thymus DNA association constants. In contrast, no such correlation existed in nuclei. However, the inhibitory effects in the nuclear system were correlated with the association constants for poly(dAdT). The results indicate that bidentate binding can significantly enhance anti-topoisomerase activity of netropsin related dimeric minor groove binders. However, other factors such as the length of the linker, the number of pyrrole moieties and the nature of the target (isolated enzyme/DNA versus chromatin in nuclei) also contribute to these activities.