Sequence and pH effects of LNA-containing triple helix-forming oligonucleotides: physical chemistry, biochemistry, and modeling studies

Triple helix-forming oligonucleotides (TFOs) have been demonstrated to be capable of interfering with gene expression and modifying genomic DNA in a sequence-specific manner. Partial incorporation of 2'-O,4'-C-methylene linked locked nucleic acid (LNA) residues in TFOs has been shown to enhance significantly triple helix formation, whereas the full-length LNA TFO failed to form a stable triplex. This work is aimed at understanding the triple helix-forming properties of LNA-containing TFOs and at optimally designing their sequences. Both DNA thermal melting, gel retardation, and restriction enzyme experiments as well as modeling studies by molecular mechanics were carried out to investigate the base composition/sequence and pH-dependence effects of LNA-containing TFOs, as well as their structural features underlying triple helix formation. Alternating LNA substitution every 2-3 nucleotides in TFOs is mandatory, whereas the use of thymine LNA residues should be favored under neutral pH conditions. A rule for designing optimal LNA-containing TFOs is proposed. In addition, alternative LNA and 2'-O-methyl residues in TFOs do not significantly improve triple helix formation.     

Inhibition of restriction endonuclease cleavage via triple helix formation by homopyrimidine oligonucleotides

A 17-mer homopyrimidine oligonucleotide was designed to bind to the major groove of SV40 DNA at a 17 base pair homopurine-homopyrimidine sequence via Hoogsteen base pairing. This sequence contains the recognition site for the class II-S restriction enzyme Ksp 632-I. The oligonucleotide was shown to inhibit enzymatic cleavage under conditions that allow for triple helix formation. Inhibition is sequence-specific and occurs in the micromolar concentration range. Triple helix formation by oligonucleotides opens new possibilities for sequence-specific regulation of gene expression.     

Sequence-specific labeling of superhelical DNA by triple helix formation and psoralen crosslinking.

Site-specific labeling of covalently closed circular DNA was achieved by using triple helix-forming oligonucleotides 10, 11 and 27 nt in length. The sequences consisted exclusively of pyrimidines (C and T) with a reactive psoralen at the 5'-end and a biotin at the 3'-end. The probes were directed to different target sites on the plasmids pUC18 (2686 bp), pUC18/4A (2799 bp) and pUC1 8/4A-H 1 (2530 bp). After triple helix formation at acid pH the oligonucleotides were photocrosslinked to the target DNAs via the psoralen moiety, endowing the covalent adduct with unconditional stability, e.g. under conditions unfavorable for preservation of the triplex, such as neutral pH. Complex formation was monitored after polyacrylamide gel electrophoresis by streptavidin-alkaline phosphatase (SAP)-induced chemiluminescence. The yield of triple helix increased with the molar ratio of oligonucleotide to target and the length of the probe sequence (27mer > 11mer). The covalent adduct DNA were visualized by scanning force microscopy (SFM) using avidin or streptavidin as protein tags for the biotin group on the oligonucleotide probes. We discuss the versatility of triple helix DNA complexes for studying the conformation of superhelical DNA.     

Effect of third strand composition on the triple helix formation: purine versus pyrimidine oligodeoxynucleotides.

Exon 5 of the human aprt gene contains an oligo-purine-oligopyrimidine stretch of 17 bp (5'-CCCTCTTCTCTCTCCT-3') within the coding region. (T,C)-, (G,T)- and (G,A)-containing oligonucleotides were compared for their ability to form stable triple helices with their DNA target. (G,T) oligodeoxynucleotides, whether parallel or antiparallel, were unable to bind to this sequence. This is in contrast to (G,A) (purine) and (T,C) (pyrimidine) oligonucleotides, which bind to the duplex at near neutral pH. Binding was highly sequence specific, as unrelated competitors were unable to interfere with target recognition. A major difference between the purine and pyrimidine oligodeoxynucleotides was observed in the kinetics of binding: the (G,A) oligonucleotide binds to its target much faster than the (T,C) oligomer. With the purine oligonucleotide, complete binding was achieved in a matter of minutes at micromolar concentrations, whereas several hours were required with the pyrimidine oligomer. Thus, the general observation that triplex formation is slow with pyrimidine oligodeoxynucleotides does not hold for (G,A) oligodeoxynucleotides. Purine and pyrimidine oligodeoxynucleotides covalently linked to a psoralen group were able to induce crosslinks on the double-stranded DNA target upon UV irradiation. This study provides a detailed comparison of the different types of DNA triplexes under the same experimental conditions.     

Triplex formation by oligonucleotides containing 5-(1-propynyl)-2'-deoxyuridine: decreased magnesium dependence and improved intracellular gene targeting

Oligonucleotides capable of sequence-specific triple helix formation have been proposed as DNA binding ligands useful for modulation of gene expression and for directed genome modification. However, the effectiveness of such triplex-forming oligonucleotides (TFOs) depends on their ability to bind to their target sites within cells, and this can be limited under physiologic conditions. In particular, triplex formation in the pyrimidine motif is favored by unphysiologically low pH and high magnesium concentrations. To address these limitations, a series of pyrimidine TFOs were tested for third-strand binding under a variety of conditions. Those containing 5-(1-propynyl)-2'-deoxyuridine (pdU) and 5-methyl-2'-deoxycytidine (5meC) showed superior binding characteristics at neutral pH and at low magnesium concentrations, as determined by gel mobility shift assays and thermal dissociation profiles. Over a range of Mg2+ concentrations, pdU-modified TFOs formed more stable triplexes than did TFOs containing 2'-deoxythymidine. At 1 mM Mg2+, a DeltaTm of 30 degreesC was observed for pdU- versus T-containing 15-mers (of generic sequence 5' TTTTCTTTTTTCTTTTCT 3') binding to the cognate A:T bp rich site, indicating that pdU-containing TFOs are capable of substantial binding even at physiologically low Mg2+ concentrations. In addition, the pdU-containing TFOs were superior in gene targeting experiments in mammalian cells, yielding 4-fold higher mutation frequencies in a shuttle vector-based mutagenesis assay designed to detect mutations induced by third-strand-directed psoralen adducts. These results suggest the utility of the pdU substitution in the pyrimidine motif for triplex-based gene targeting experiments.     

Proton exchange and local stability in a DNA triple helix containing a G.TA triad

Recognition of a thymine-adenine base pair in DNA by triplex-forming oligonucleotides can be achieved by a guanine through the formation of a G.TA triad within the parallel triple helix motif. In the present work, we provide the first characterization of the stability of individual base pairs and base triads in a DNA triple helix containing a G.TA triad. The DNA investigated is the intramolecular triple helix formed by the 32mer d(AGATAGAACCCCTTCTATCTTATATCTGTCTT). The exchange rates of imino protons in this triple helix have been measured by nuclear magnetic resonance spectroscopy using magnetization transfer from water and real-time exchange. The exchange rates are compared with those in a homologous DNA triple helix in which the G.TA triad is replaced by a canonical C⁺.GC triad. The results indicate that, in the G.TA triad, the stability of the Watson–Crick TA base pair is comparable with that of AT base pairs in canonical T.AT triads. However, the presence of the G.TA triad destabilizes neighboring triads by 0.6–1.8 kcal/mol at 1°C. These effects extend to triads that are two positions removed from the site of the G.TA triad. Therefore, the lower stability of DNA triple helices containing G.TA triads originates, in large part, from the energetic effects of the G.TA triad upon the stability of canonical triads located in its vicinity.     

Structural polymorphism of telomeric DNA regulated by pH and divalent cation

DNA oligonucleotides can form multi-stranded structures such as a duplex, triplex, and quadruplex, while the double helical structure is generally considered as the canonical structure of DNA oligonucleotides. Guanine-rich or cytosine-rich oligonucleotides, which are observed in telomere, centromere, and other biologically important sequences in vivo, can form four-stranded G-quadruplex and I-motif structures in vitro. In this study, we have investigated the effects of pH and cation on the structures and their stabilities of d(G4T4G4) and d(C4A4C4). The CD spectra and thermal melting curves of DNAs at various pHs demonstrated that acidic conditions induced a stable I-motif structure of d(C4A4C4), while the pH value did not affect the G-quadruplex structure and stability of d(G4T4G4). The CD spectra of the 1:1 mixture of d(G4T4G4) and d(C4A4C4) indicated that the acidic conditions inhibit the duplex formation between d(G4T4G4) and d(C4A4C4). Isothermal titration calorimetry measurements of the duplex formation at various pHs also quantitatively indicated that the acidic conditions inhibit the duplex formation. On the other hand, the CD spectra and thermal melting curves of DNAs in the absence and presence of Ca2+ indicated that Ca2+ induces a parallel G-quadruplex structure of d(G4T4G4) and then inhibits the duplex formation. These results lead to the conclusion that both the pH and coexisting cation can induce and regulate the structural polymorphisms the oligonucleotides in which they form the G-quadruplex, I-motif, and duplex depending on the conditions. Thus, the results reported here indicate pivotal roles of pH and coexisting cations in biological processes by regulating the conformational switching between the duplex and quadruplexes structures of the guanine-rich or cytosine-rich oligonucleotides in vivo.     

Triplex formation by morpholino oligodeoxyribonucleotides in the HER-2/neu promoter requires the pyrimidine motif

Triplex-forming oligonucleotides (TFOs) are good candidates to be used as site-specific DNA-binding agents. Two obstacles encountered with TFOs are susceptibility to nuclease activity and a requirement for magnesium for triplex formation. Morpholino oligonucleotides were shown in one study to form triplexes in the absence of magnesium. In the current study, we have compared phosphodiester and morpholino oligonucleotides targeting a homopurine–homopyrimidine region in the human HER2/neu promoter. Using gel mobility shift analysis, our data demonstrate that triplex formation by phosphodiester oligonucleotides at the HER-2/neu promoter target is possible with pyrimidine-parallel, purine-antiparallel and mixed sequence (GT)-antiparallel motifs. Only the pyrimidine-parallel motif morpholino TFO was capable of efficient triple helix formation, which required low pH. Triplex formation with the morpholino TFO was efficient in low or no magnesium. The pyrimidine motif TFOs with either a phosphodiester or morpholino backbone were able to form triple helices in the presence of potassium ions, but required low pH. We have rationalized the experimental observations with detailed molecular modeling studies. These data demonstrate the potential for the development of TFOs based on the morpholino backbone modification and demonstrate that the pyrimidine motif is the preferred motif for triple helix formation by morpholino oligonucleotides.     

Design and optimization of camptothecin conjugates of triple helix-forming oligonucleotides for sequence-specific DNA cleavage by topoisomerase I.

To achieve a sequence-specific DNA cleavage by topoisomerase I, derivatives of the antitumor drug camptothecin have been covalently linked to triple helix-forming oligonucleotides that bind in a sequence-specific manner to the major groove of double-helical DNA. Triplex formation at the target sequence positions the drug selectively at the triplex site, thereby stimulating topoisomerase I-mediated DNA cleavage at this site. In a continuous effort to optimize this strategy, a broad set of conjugates consisting of (i) 16-20-base-long oligonucleotides, (ii) alkyl linkers of variable length, and (iii) camptothecin derivatives substituted on the A or B quinoline ring were designed and synthesized. Analysis of the cleavage sites at nucleotide resolution reveals that the specificity and efficacy of cleavage depends markedly on the length of both the triple-helical structure and the linker between the oligonucleotide and the poison. The optimized hybrid molecules induced strong and highly specific cleavage at a site adjacent to the triplex. Furthermore, the drug-stabilized DNA-topoisomerase I cleavage complexes were shown to be more resistant to salt-induced reversal than the complexes induced by camptothecin alone. Such rationally designed camptothecin conjugates could provide useful antitumor drugs directed selectively against genes bearing the targeted triplex binding site. In addition, they represent a powerful tool to probe the molecular interactions in the DNA-topoisomerase I complex.     

A directional nucleation-zipping mechanism for triple helix formation

A detailed kinetic study of triple helix formation was performed by surface plasmon resonance. Three systems were investigated involving 15mer pyrimidine oligonucleotides as third strands. Rate constants and activation energies were validated by comparison with thermodynamic values calculated from UV-melting analysis. Replacement of a T·A base pair by a C·G pair at either the 5′ or the 3′ end of the target sequence allowed us to assess mismatch effects and to delineate the mechanism of triple helix formation. Our data show that the association rate constant is governed by the sequence of base triplets on the 5′ side of the triplex (referred to as the 5′ side of the target oligopurine strand) and provides evidence that the reaction pathway for triple helix formation in the pyrimidine motif proceeds from the 5′ end to the 3′ end of the triplex according to the nucleation-zipping model. It seems that this is a general feature for all triple helices formation, probably due to the right-handedness of the DNA double helix that provides a stronger base stacking at the 5′ than at the 3′ duplex–triplex junction. Understanding the mechanism of triple helix formation is not only of fundamental interest, but may also help in designing better triple helix-forming oligonucleotides for gene targeting and control of gene expression.     

Targeted mutagenesis in mammalian cells mediated by intracellular triple helix formation.

As an alternative to standard gene transfer techniques for genetic manipulation, we have investigated the use of triple helix-forming oligonucleotides to target mutations to selected genes within mammalian cells. By treating monkey COS cells with oligonucleotides linked to psoralen, we have generated targeted mutations in a simian virus 40 (SV40) vector contained within the cells via intracellular triple helix formation. Oligonucleotide entry into the cells and sequence-specific triplex formation within the SV40 DNA deliver the psoralen to the targeted site. Photoactivation of the psoralen by long-wavelength UV light yields adducts and thereby mutations at that site. We engineered into the SV40 vector novel supF mutation reporter genes containing modified polypurine sites amenable to triplex formation. By comparing the abilities of a series of oligonucleotides to target these new sites, we show that targeted mutagenesis in vivo depends on the strength and specificity of the third-strand binding. Oligonucleotides with weak target site binding affinity or with only partial target site homology were ineffective at inducing mutations in the SV40 vectors within the COS cells. We also show that the targeted mutagenesis is dependent on the oligonucleotide concentration and is influenced by the timing of the oligonucleotide treatment and of the UV irradiation of the cells. Frequencies of intracellular targeted mutagenesis in the range of 1 to 2% were observed, depending upon the conditions of the experiment. DNA sequence analysis revealed that most of the mutations were T.A-to-A.T transversions precisely at the targeted psoralen intercalation site. Several deletions encompassing that site were also seen. The ability to target mutations to selected sites within mammalian cells by using modified triplex-forming oligonucleotides may provide a new research tool and may eventually lead to therapeutic applications.     

Parallel intramolecular DNA triple helix with G and T bases in the third strand stabilized by Zn(2+) ions

We present evidence of formation of an intramolecular parallel triple helix with T•A.T and G•G.C base triplets (where • represents the hydrogen bonding interaction between the third strand and the duplex while . represents the Watson–Crick interactions which stabilize the duplex). The third GT strand, containing seven GpT/TpG steps, targets the polypurine sequence 5′-AGG-AGG-GAG-GAG-3′. The triple helix is obtained by the folding back twice of a 36mer, formed by three dodecamers tethered by hydroxyalkyl linkers (-L-). Due to the design of the oligonucleotide, the third strand orientation is parallel with respect to the polypurine strand. Triple helical formation has been studied in concentration conditions in which native gel electrophoresis experiments showed the absence of intermolecular structures. Circular dichroism (CD) and UV spectroscopy have been used to evidence the triplex structure. A CD spectrum characteristic of triple helical formation as well as biphasic UV and CD melting curves have been obtained in high ionic strength NaCl solutions in the presence of Zn²⁺ ions. Specific interactions with Zn²⁺ ions in low water activity conditions are necessary to stabilize the parallel triplex.     

Energetics of strand-displacement reactions in triple helices: a spectroscopic study.

DNA triple helices offer exciting new perspectives toward oligonucleotide-directed inhibition of gene expression. Purine and GT triplexes appear to be the most promising motifs for stable binding under physiological conditions compared to the pyrimidine motif, which forms at relatively low pH. There are, however, very little data available for comparison of the relative stabilities of the different classes of triplexes under identical conditions. We, therefore, designed a model system which allowed us to set up a competition between the oligonucleotides of the purine and pyrimidine motifs targeting the same Watson-Crick duplex. Several conclusions may be drawn: (i) a weak hypochromism at 260 nm is associated with purine triplex formation; (ii) delta H degree of GA, GT and TC triplex formation (at pH 7.0) was calculated as -0.1, -2.5 and -6.1 kcal/mol per base triplet, respectively. This unexpectedly low delta H degree for the purine triple helix formation implies that its delta G degree is nearly temperature-independent and it explains why these triplexes may still be observed at high temperatures. In contrast, the pyrimidine triplex is strongly favoured at lower temperatures; (iii) as a consequence, in a system where two third-strands compete for triplex formation, displacement of the GA or GT strand by a pyrimidine strand may be observed at neutral pH upon lowering the temperature. This original purine-to-pyrimidine triplex conversion shows a significant hypochromism at 260 nm and a hyperchromism at 295 nm which is similar to the duplex-to-triplex conversion in the pyrimidine motif. Further evidence for this triplex-to-triplex conversion is provided by mung bean-nuclease foot-printing assay.     

An intercalation-locked parallel-stranded DNA tetraplex

DNA has proved to be an excellent material for nanoscale construction because complementary DNA duplexes are programmable and structurally predictable. However, in the absence of Watson–Crick pairings, DNA can be structurally more diverse. Here, we describe the crystal structures of d(ACTCGGATGAT) and the brominated derivative, d(AC^BrUCGGA^BrUGAT). These oligonucleotides form parallel-stranded duplexes with a crystallographically equivalent strand, resulting in the first examples of DNA crystal structures that contains four different symmetric homo base pairs. Two of the parallel-stranded duplexes are coaxially stacked in opposite directions and locked together to form a tetraplex through intercalation of the 5′-most A–A base pairs between adjacent G–G pairs in the partner duplex. The intercalation region is a new type of DNA tertiary structural motif with similarities to the i-motif. ¹H–¹H nuclear magnetic resonance and native gel electrophoresis confirmed the formation of a parallel-stranded duplex in solution. Finally, we modified specific nucleotide positions and added d(GAY) motifs to oligonucleotides and were readily able to obtain similar crystals. This suggests that this parallel-stranded DNA structure may be useful in the rational design of DNA crystals and nanostructures.     

Alternate strand recognition of double-helical DNA by (T,G)-containing oligonucleotides in the presence of a triple helix-specific ligand.

Triple helix formation requires a polypurine- polypyrimidine sequence in the target DNA. Recent works have shown that this constraint can be circumvented by using alternate strand triplex-forming oligonucleotides. We have previously demonstrated that (T,G)-containing triplex- forming oligonucleotides may adopt a parallel or an antiparallel orientation with respect to an oligopurine target, depending upon the sequence and, in particular, upon the number of 5'-GpT-3' and 5'-TpG-3' steps [Sun et al. (1991) C.R. Acad. Sci. Paris Ser III, 313, 585-590]. A single (T,G)-containing oligonucleotide can therefore interact with two oligopurine stretches which alternate on the two strands of the target DNA. The (T,G) switch oligonucleotide contains a 5'-part targeted to one of the oligopurine sequences in a parallel orientation followed by a 3'-part that adopts an antiparallel orientation with respect to the second oligopurine sequence. We show that a limitation to the stability of such a triplex may arise from the instability of the antiparallel part, composed of reverse-Hoogsteen C.GxG and T.AxT base triplets. Using DNase I footprinting and ultraviolet absorption experiments, we report that a benzo[e]pyridoindole derivative [(3-methoxy- 7H-8-methyl-11-[(3'-amino-propyl) amino] benzo[e]pyrido [4,3-b]indole (BePI)], a drug interacting more tightly with a triplex than with a duplex DNA, strongly stabilizes triplexes with reverse-Hoogsteen C.GxG and T.AxT triplets thus allowing a stabilization of the triplex-forming switch (T,G) oligonucleotide on alternating oligopurine- oligopyrimidine 5'-(Pu)14(Py)14-3' duplex sequences. These results lead to an extension of the range of oligonucleotide sequences for alternate strand recognition of duplex DNA.     

Presence of divalent cation is not mandatory for the formation of intramolecular purine-motif triplex containing human c-jun protooncogene target

Modulation of endogenous gene function, through sequence-specific recognition of double helical DNA via oligonucleotide-directed triplex formation, is a promising approach. Compared to the formation of pyrimidine motif triplexes, which require relatively low pH, purine motif appears to be the most gifted for their stability under physiological conditions. Our previous work has demonstrated formation of magnesium-ion dependent highly stable intermolecular triplexes using a purine third strand of varied lengths, at the purine?pyrimidine (Pu?Py) targets of SIV/HIV-2 (vpx) genes (Svinarchuk, F., Monnot, M., Merle, A., Malvy, C., and Fermandjian, S. (1995) Nucleic Acids Res. 23, 3831-3836). Herein, we show that a designed intramolecular version of the 11-bp core sequence of the said targets, which also constitutes an integral, short, and symmetrical segment (G(2)AG(5)AG(2))?(C(2)TC(5)TC(2)) of human c-jun protooncogene forms a stable triplex, even in the absence of magnesium. The sequence d-C(2)TC(5)TC(2)T(5)G(2)AG(5)AG(2)T(5)G(2)AG(5)AG(2) (I-Pu) folds back twice onto itself to form an intramolecular triple helix via a double hairpin formation. The design ensures that the orientation of the intact third strand is antiparallel with respect to the oligopurine strand of the duplex. The triple helix formation has been revealed by non-denaturating gel assays, UV-thermal denaturation, and circular dichroism (CD) spectroscopy. The monophasic melting curve, recorded in the presence of sodium, represented the dissociation of intramolecular triplex to single strand in one step; however, the addition of magnesium bestowed thermal stability to the triplex. Formation of intramolecular triple helix at neutral pH in sodium, with or without magnesium cations, was also confirmed by gel electrophoresis. The triplex, mediated by sodium alone, destabilizes in the presence of 5'-C(2)TC(5)TC(2)-3', an oligonucleotide complementary to the 3'-oligopurine segments of I-Pu, whereas in the presence of magnesium the triplex remained impervious. CD spectra showed the signatures of triplex structure with A-like DNA conformation. We suggest that the possible formation of pH and magnesium-independent purine-motif triplexes at genomic Pu?Py sequences may be pertinent to gene regulation.     

Pyrimidine morpholino oligonucleotides form a stable triple helix in the absence of magnesium ions

Oligonucleotides can be used as sequence-specific DNA ligands by forming a local triple helix. In order to form more stable triple-helical structures or prevent their degradation in cells, oligonucleotide analogues that are modified at either the backbone or base level are routinely used. Morpholino oligonucleotides appeared recently as a promising modification for antisense applications. We report here a study that indicates the possibility of a triple helix formation with a morpholino pyrimidine TFO and its comparison with a phosphodiester and a phosphoramidate oligonucleotide. At a neutral pH and in the presence of a high magnesium ion concentration (10 mM), the phosphoramidate oligomer forms the most stable triple helix, whereas in the absence of magnesium ion but at a physiological monovalent cation concentration (0.14 M) only morpholino oligonucleotides form a stable triplex. To our knowledge, this is the first report of a stable triple helix in the pyrimidine motif formed by a noncharged oligonucleotide third strand (the morpholino oligonucleotide) and a DNA duplex. We show here that the structure formed with the morpholino oligomer is a bona fide triple helix and it is destabilized by high concentrations of potassium ions or divalent cations (Mg(2+)).     

Triplex formation at physiological pH by 5-Me-dC-N4-(spermine) [X] oligodeoxynucleotides: non protonation of N3 in X of X*G:C triad and effect of base mismatch/ionic strength on triplex stabilities.

Oligodeoxynucleotide (ODN) directed triplex formation has therapeutic importance and depends on Hoogsteen hydrogen bonds between a duplex DNA and a third DNA strand. T*A:T triplets are formed at neutral pH and C+*G:C are favoured at acidic pH. It is demonstrated that spermine conjugation at N4 of 5-Me-dC in ODNs 1-5 (sp-ODNs) imparts zwitterionic character, thus reducing the net negative charge of ODNs 1-5. sp-ODNs form triplexes with complementary 24mer duplex 8:9 show foremost stability at neutral pH 7.3 and decrease in stability towards lower pH, unlike the normal ODNs where optimal stability is found at an acidic pH 5.5. At pH 7.3, control ODNs 6 and 7 carrying dC or 5-Me-dC, respectively, do not show any triple helix formation. The stability order of triplex containing 5-Me-dC-N4-(spermine) with normal and mismatched duplex was found to be X*G:C approximately X*A:T > X*C:G > X*T:A. The hysteresis curve of sp-ODN triplex 3*8:9 indicated a better association with complementary duplex 8:9 as compared to unmodified ODN 6 in triplex 6*8:9. pH-dependent UV difference spectra suggest that N3 protonation is not a requirement for triplex formation by sp-ODN and interstrand interaction of conjugated spermine more than compensates for loss in stability due to absence of a single Hoogsteen hydrogen bond. These results may have importance in designing oligonucleotides for antigene applications.